Highly water-soluble perylenediimide-cored poly(amido amine) vector for efficient gene transfection

Article abstract of DOI:10.1039/c4tb00195h

A highly water-soluble perylenediimide-core poly(amido amine) (PDI-PAmAm) with peripheral amine groups has been synthesized. The central PDI chromophore allows optical monitoring of relevant cellular experiments by fluorescence microscopy. The PAmAm shell provides the steric bulk that notably suppresses the aggregation of the central PDI chromophore in aqueous solution. The peripheral amines provide water solubility and positive charges, and also serve as active sites for the further growth of PAmAm. PDI-PAmAm can be rapidly internalized into live cells with high efficacy of gene delivery and low cytotoxicity. Both in vitro and in vivo experiments demonstrate the high gene transfection efficacy of PDI-PAmAm.

Full text of DOI:10.1039/c4tb00195h

Journal of
Materials Chemistry B
View Article Online
View Journal | View Issue
PAPER
Highly water-soluble perylenediimide-cored
poly(amido amine) vector for efficient gene
transfection†
Cite this: J. Mater. Chem. B, 2014, 2,
3079
a
b
b
a
a
Zejun Xu, Bicheng He, Wei Wei, Kelan Liu, Meizhen Yin, Wantai Yanga
*
b
*
and Jie Shen
A highly water-soluble perylenediimide-core poly(amido amine) (PDI-PAmAm) with peripheral amine
groups has been synthesized. The central PDI chromophore allows optical monitoring of relevant
cellular experiments by fluorescence microscopy. The PAmAm shell provides the steric bulk that notably
suppresses the aggregation of the central PDI chromophore in aqueous solution. The peripheral amines
provide water solubility and positive charges, and also serve as active sites for the further growth of
PAmAm. PDI-PAmAm can be rapidly internalized into live cells with high efficacy of gene delivery and
low cytotoxicity. Both in vitro and in vivo experiments demonstrate the high gene transfection efficacy of
PDI-PAmAm.
Received 6th February 2014
Accepted 24th February 2014
DOI: 10.1039/c4tb00195h
www.rsc.org/MaterialsB
polyester units are not stable under basic conditions; thus, the
dendrimers have to be treated with diluted HCl to yield their
ammonium salts.19 The hydrophobic nature of outer polyesters
Introduction
Perylenediimides (PDIs) are an attractive class of uorophores
because of their exceptional chemical, thermal, and photo-
chemical stability, and high uorescence quantum yields in
organic solvents.1,2 However, the poor solubility and very weak
uorescence of PDIs in an aqueous environment3 have hindered
their utilization in the biological and medicinal elds. Hydro-
philic moieties have been incorporated in the bay region or at
the imide positions to increase the water solubility of PDIs.4–7 In
general, the substituents in the bay regions of PDIs have the
advantage of a signicant red shi in the absorption maximum,
and also a larger Stokes shi. These shis have attracted great
interest as the interference from cell auto-uorescence is
minimized.8–10 Another hydrophilic modication of PDIs is the
attachment of water-soluble topological macromolecules (such
as star polymers,11–14 dendrimers,15–19 or hyperbranched poly-
mers20) to the PDI core. Compared with linear polymers, the
branched polycations have a great number of functional groups,
and exhibit low cytotoxicity and high transfection efficiency
because of their globular structures.19,21,22 The most reported
PDI-cored dendrimers are neutral, water-soluble, and biocom-
patible in character.15–18 PDI-cored cationic polyester den-
drimers19 have been reported by our group. The outer dendritic
leads to the relatively low water solubility of the previous PDI-
cored dendrimers. Therefore, in this present work, highly water-
soluble poly(amido amine) (PAmAm) dendritic units are incor-
porated into the bay regions of PDIs. Cationic PAmAm den-
drimers exhibit good transfection efficiency and low
cytotoxicity.23 Additionally, the well-dened geometry of the
PAmAm dendrimer allows the ease of modication to increase
their efficiency.24,25 The structure of PDI-cored poly(amido
amine) (PDI-PAmAm) is given in Scheme 1. The water solubility
and chemical stability of PDI-PAmAm are dramatically higher
than those of the previous cationic polyester dendrimers19 at all
pH values. The central PDI chromophore allows optical moni-
toring of relevant cellular experiments by uorescence micros-
copy.13,19,26 The PAmAm shell provides the steric bulk that
notably suppresses the aggregation of the central PDI chromo-
phore. The peripheral amines provide water solubility and
positive charges, and also serve as active sites for the further
growth of PAmAm. The optical properties of PDI-PAmAm in
water were investigated. The cell-penetrating ability and the
gene transfection efficacy of PDI-PAmAm were assayed both in
vitro and in vivo.
Experimental section
aState Key Laboratory of Chemical Resource Engineering, Key Laboratory of Carbon
Fiber and Functional Polymers, Ministry of Education, Beijing University of Materials
Chemical Technology, 100029 Beijing, China. E-mail: yinmz@mail.buct.edu.cn
bDepartment of Entomology, China Agricultural University, 100193 Beijing, China.
Triethylamine (Et3N, 99.5%), 2,6-diisopropylaniline (90+%), N-
methyl-2-pyrrolidone (NMP, 99+%), 1-(2-aminoethyl) piperazine
(AEPZ, 98%), N,N0-methylene bisacrylamide (MBA, 99%) were
purchased from Alfa Aesar and used without further
E-mail: shenjie@cau.edu.cn
† Electronic supplementary information (ESI) available. See DOI:
10.1039/c4tb00195h
This journal is © The Royal Society of Chemistry 2014
J. Mater. Chem. B, 2014, 2, 3079–3086 | 3079

View Article Online
Journal of Materials Chemistry B
Paper
Scheme 1 Synthesis of PDI-PAmAm.
purication. 1,6,7,12-Tetrachloroperylene-3,4,9,10-tetracarbox- used as received. S2 cells were propagated in Schneider
ylic acid dianhydride was obtained from Beijing Wenhaiyang Drosophila Medium supplemented with 10% fetal bovine
Perylene Chemistry (Beijing, China). All other solvents and serum (FBS), 100 U mLꢀ1 penicillin and 100 mg mLꢀ1 strepto-
ꢁ
reagents were purchased from commercial suppliers and were mycin at 25 C without CO2.
3080 | J. Mater. Chem. B, 2014, 2, 3079–3086
This journal is © The Royal Society of Chemistry 2014

View Article Online
Paper
Journal of Materials Chemistry B
3518.47, found: 3519.15(M + H+), 3390.41 (M-AEPZ), 3258.12 (M-
2AEPZ).
Synthesis of compound 1
Compound 1 was synthesized according to the literature.27 1H-
NMR (400 MHz, CF3COOD) d 8.49 (s, 4H, perylene), 7.59 (d, J ¼
7.8 Hz, 2H, Ph-H), 7.46 (d, J ¼ 7.9 Hz, 4H, Ph-H), 7.32 (d, J ¼ 8.2
Hz, 8H, Ph-H), 7.19 (d, J ¼ 8.3 Hz, 8H, Ph-H), 3.59 (s, 8H, CH2),
3.18 (s, 8H, CH2), 2.78–2.70 (m, 4H, CH), 1.21 (d, J ¼ 6.4 Hz,
24H, CH3 isopropyl). 13C-NMR (151 MHz, CF3COOD) d 166.20,
156.75, 154.77, 145.53, 132.62, 131.81, 130.91, 130.28, 128.46,
124.87, 122.15, 121.42, 121.08, 120.76, 120.13, 42.01, 31.95,
29.08, 22.40. MS (MALDI-TOF, m/z) calc. for C80H78N6O8:
1251.51, found: 1250.7.
Synthesis of intermediate product 3b
Compound 3 (281.4 mg, 0.08 mmol) and MBA (295.6 mg, 1.92
mmol) were added into a vial and dissolved in a methanol–
water mixture (6.0 mL, 8/2 v/v) at room temperature under a N2
atmosphere. The reaction was carried out at 50 ꢁC for 60 h. Aer
cooling down to room temperature, the solution was washed
with ether–hexane (4 : 1, v/v) (60 mL ꢂ 3). The residue was dried
1
under vacuum to give a red solid intermediate product 3b. H
NMR (400 MHz, MeOD) d 8.13 (s, 4H, perylene), 7.47 (s, 2H, Ph-
H), 7.22 (m, 12H, Ph-H), 7.03 (s, 8H, Ph-H), 6.27 (d, J ¼ 5.7 Hz,
32H, CH2]CHCO), 5.71 (d, J ¼ 6.0 Hz, 16H, CH2]CHCO), 4.63
(m, 48H, NHCH2NH), 3.34 (m, 64H, NCH2), 2.75–2.40 (m, 216H,
CH2 & CH), 1.10 (d, 24H, CH3 isopropyl). 13C NMR (151 MHz,
MeOD) d 175.27, 174.19, 168.21, 164.87, 154.75, 152.85, 147.16,
139.15, 138.60, 131.83, 131.63, 130.60, 129.54, 127.61, 126.11,
125.05, 123.78, 121.81, 121.46, 120.45, 69.47, 67.01, 58.94,
54.22, 51.03, 45.20, 37.27, 35.37, 34.45, 30.90, 24.37, 21.33. MS
(MALDI-TOF, m/z) calc. for C296H438N78O56: 5985.13, found:
5870.21 (M-MBA + K+), 5853.95 (M-MBA + Na+), 5715.26
(M-2MBA + K+), 5700.07 (M-2MBA + Na+).
Synthesis of PDI-PAmAm
PDI-PAmAm was synthesized via Michael addition copolymeri-
zation (Scheme 1 and S1†).28–30
Synthesis of intermediate product 2
Compound 1 (200.0 mg, 0.16 mmol) and MBA (246.5 mg, 1.6
mmol) were added into a vial and dissolved in a methanol–
water mixture (6.0 mL, 8/2 v/v) at room temperature under a N2
atmosphere. The reaction was carried out at 50 ꢁC for 48 h. Aer
cooling down to room temperature, the solution was washed
with ether–hexane (4 : 1, v/v) (50 mL ꢂ 3). The residue was dried
under vacuum to give a red solid intermediate product 2 in 95%
Synthesis of intermediate product 4
1
yield. H NMR (400 MHz, DMSO) d 8.62 (d, J ¼ 51.8 Hz, 16H,
Intermediate product 4 was synthesized by using compound 3b
and AEPZ (309.6 mg, 2.4 mmol) according to the procedure
described previously for the synthesis of compound 3.
NH), 7.94 (s, 4H, perylene), 7.43 (s, 2H, Ph-H), 7.25 (d, J ¼ 17.3
Hz, 12H, Ph-H), 6.98 (d, J ¼ 11.8 Hz, 8H, Ph-H), 6.17 (d, J ¼ 45.1
Hz, 16H, CH2]CHCO), 5.59 (s, 8H, CH2]CHCO), 4.45 (s, 16H,
NHCH2NH), 3.38 (t, 16H, NCH2), 2.70 (m, 20H, CH2 & CH), 2.24
(t, 16H, CH2), 1.01 (d, 24H, CH3 isopropyl). 13C NMR (151 MHz,
DMSO) d 171.89, 170.86, 164.87, 162.76, 155.69, 152.68, 145.44,
137.25, 137.08, 131.42, 130.44, 130.16, 129.30, 125.79, 123.72,
122.41, 119.85, 119.58, 68.06, 57.76, 54.47, 49.19, 43.18, 39.52,
35.58, 33.02, 32.06, 28.31, 23.72. MS (MALDI-TOF, m/z) calc.
for C136H158N22O24: 2484.84, found: 2485.47 (M + H+), 2507.74
(M + Na+).
1
Compound 4 was obtained as a red solid. H NMR (400 MHz,
MeOD) d 8.15 (s, 4H, perylene), 7.45 (s, 2H, Ph-H), 7.38–7.16 (m,
12H, Ph-H), 7.03 (s, 8H, Ph-H), 4.56 (s, 48H, NHCH2NH), 3.33 (t,
96H, NCH2), 2.72–2.37 (m, 408H, CH2 & CH), 1.13 (d, 24H, CH3
isopropyl). 13C NMR (151 MHz, MeOD) d 175.24, 174.75, 174.15,
164.90, 157.69, 154.75, 147.15, 138.63, 134.45, 131.62, 131.45,
130.64, 125.05, 123.80, 121.45, 121.22, 120.02, 69.48, 58.95,
54.94, 53.83, 53.63, 50.75, 46.20, 45.09, 38.13, 37.27, 35.75,
34.44, 33.74, 30.32, 24.39. MS (MALDI-TOF, m/z) calc. for
C
392H678N126O56: 8052.39, found: 7523.39.15 (M-2(MBA + AEPZ)
Synthesis of intermediate product 3
+ K+), 7261.52 (M-3(MBA + AEPZ) + Na+ + K+).
Next, the intermediate product 2 (248.5 mg, 0.1 mmol) and
AEPZ (129.0 mg, 1.0 mmol) were dissolved in a methanol–water
mixture (6.0 mL, 8/2 v/v). The solution was stirred at room
Synthesis of intermediate product 4b
temperature under a N2 atmosphere for 5 h, and then stirred at Compound 4b was synthesized by using intermediate product 4
50 ꢁC for 56 h. Aer cooling down to room temperature, the (483.1 mg, 0.06 mmol) and MBA (369.6 mg, 2.4 mmol) accord-
solution was washed with ether–hexane (6 : 1, v/v) (50 mL ꢂ 3). ing to the procedure described previously for the synthesis of
The residue was dried under vacuum to give a red solid inter- compound 2. Compound 4b was obtained as a red solid. 1H
1
mediate product 3 in 88% yield. H NMR (600 MHz, DMSO) d NMR (400 MHz, MeOD) d 8.13 (s, 4H, perylene), 7.47 (s, 2H, Ph-
8.53 (d, J ¼ 32.0 Hz, 16H, NH), 7.95 (s, 4H, perylene), 7.40 (s, 2H, H), 7.22 (s, 12H, Ph-H), 7.03 (s, 8H, Ph-H), 6.27 (d, J ¼ 5.8 Hz,
Ph-H), 7.26 (d, J ¼ 38.3 Hz, 12H, Ph-H), 6.94 (d, J ¼ 28.6 Hz, 8H, 64H, CH2]CHCO), 5.71 (d, J ¼ 5.7 Hz, 32H, CH2]CHCO), 4.67
Ph-H), 4.34 (s, 16H, NHCH2NH), 3.39 (t, 32H, NCH2), 2.69–2.21 (m, 112H, NHCH2NH), 3.34 (m, 162H, NCH2), 2.77–2.39 (m,
(m, 152H, CH2 & CH), 1.01 (d, 24H, CH3 isopropyl). 13C NMR 476H, CH2 & CH), 1.14 (d, 24H, CH3 isopropyl). 13C NMR (151
(101 MHz, DMSO) d 171.80, 170.62, 165.93, 162.87, 155.62, MHz, MeOD) d 175.29, 174.99, 174.21, 168.23, 164.96, 154.79,
152.65, 145.52, 137.24, 137.06, 130.45, 130.23, 129.18, 123.71, 147.17, 138.63, 134.43, 131.82, 131.63, 130.65, 127.74, 125.06,
122.36, 119.89, 119.50, 68.04, 64.83, 60.62, 57.75, 54.65, 53.76, 123.77, 121.87, 121.46, 120.39, 69.48, 58.92, 56.89, 54.80, 54.09,
52.80, 52.44, 49.20, 45.48, 43.05, 35.56, 33.01, 32.77, 32.04, 53.15, 51.08, 45.19, 37.27, 34.36, 33.73, 33.62, 30.31, 24.38. GPC:
28.29, 23.71. MS (MALDI-TOF, m/z) calc. for C184H278N46O24: Mw, 7.1 ꢂ 103 Da; PD, 1.01.
This journal is © The Royal Society of Chemistry 2014
J. Mater. Chem. B, 2014, 2, 3079–3086 | 3081

View Article Online
Journal of Materials Chemistry B
Paper
PAmAm–DNA complexes were measured in triplicate using a
Synthesis of the nal product, PDI-PAmAm
Zetasizer Nano ZS (Malvern Instruments, Southborough, MA).
PDI-PAmAm was synthesized by using compound 4b and AEPZ
(495.4 mg, 3.84 mmol) according to the procedure described
previously for the synthesis of compound 3. PDI-PAmAm was
obtained as a red solid in 90% yield. The chemical structure of
PDI-PAmAm was characterized by 1H NMR and 13C NMR using a
Bruker spectrometer. 1H NMR (400 MHz, D2O) d 8.48 (s, 4H,
perylene), 7.98 (s, 2H, Ph-H), 7.73 (s, 12H, Ph-H), 7.66 (d, 8H, Ph-
H), 4.54 (s, 112H, NHCH2NH), 3.34 (m, 224H, NCH2), 2.84–2.46
(m, 900H, CH2 & CH), 1.16 (d, 24H, CH3 isopropyl). 13C NMR
(101 MHz, DMSO) d 171.87, 171.56, 170.53, 162.69, 155.42,
152.84, 145.58, 137.14, 132.58, 130.63, 130.40, 130.26, 123.54,
122.07, 119.71, 118.55, 67.93, 57.46, 54.52, 52.63, 52.44, 52.33,
49.74, 48.91, 45.23, 43.14, 37.04, 35.88, 33.00, 32.77, 32.02,
28.59, 23.86. GPC: Mw, 1.0 ꢂ 104 Da; PD, 1.04.
Cytotoxicity assay
Cell viability was monitored using Tali™ viability kit-Dead Cell
Green (Invitrogen, Catalog A10787). The measurement was
performed according to the manufacturer's instructions. PEI,
PDI-PAmAm and the PDI-PAmAm–DNA complexes were sepa-
rately added into the culture medium to treat cells for 48 h.
Then fresh cell medium containing Dead Cell Green (1 : 100
dilution) was used for an additional 0.5 h incubation.
Cellular uptake
The cellular uptake experiment was performed in a 35 mm ꢂ 35
mm cell culture dish, 2.5 ꢂ 105 cells per well. Aer 6 h of cell
seeding, PDI-PAmAm was added into the cell culture dish.
Cellular uptake was imaged under a uorescence microscope.
The uorescence intensity of the internalized PDI-PAmAm was
calculated by an Image-J Program.
Characterization
Nuclear magnetic resonance (NMR) spectra were recorded on a
Bruker 400 (400 MHz 1H; 100 MHz 13C) or Bruker 600 (600 MHz
1H; 150 MHz 13C) spectrometer using D2O, MeOD, DMSO or
CF3COOD as solvents at room temperature. Chemical shis
DNA delivery
were reported downeld from 0.00 ppm using TMS as the DNA fragments (20 bp, 100 mM) were labelled with 30 mM CXR
internal reference. Matrix-assisted laser desorption–ionization Reference Dye (Promega, Catalog C5411) that could bind with
time-of-ight mass spectrometry (MALDI-TOF MS) were deter- DNA at a nal concentration of 0.3–0.5 mM. The DNA and PDI-
mined on a Bruker Daltonics Inc. BIFLEX III MALDI-TOF mass PAmAm, at different N/P ratios of 2 : 1, 4 : 1, and 8 : 1, were pre-
spectrometer. Number-average (Mn) and weight-average (Mw)
molecular weights and the polydispersity indices (Mw/Mn, PD) of
incubated in culture medium at room temperature. Then, the
complex was added into the culture medium to treat the cells.
4b and PDI-PAmAm were determined by gel permeation chro- Aer an incubation of 24 h, 36 h, and 48 h, the uorescence
matography (GPC) (Agilent 2600 Series) with dimethyl form- image of PDI-PAmAm and DNA was obtained by uorescence
amide (DMF) as the mobile phase. The column model was PLgel microscopy. PEI–DNA complexes were used as a control.
3
˚
5 mm 10 A, the ow rate of the mobile phase was set to be 1 mL
minꢀ1, and the temperature of both the column and detector
Gene transfection assay
was 25 ꢁC. The standard curve was determined using a series of
Gene transfection assays were performed using a plasmid, pAc-
narrow distribution polystyrene standard samples. The UV-Vis
absorption spectra were recorded on a spectrophotometer
(Cintra 20, GBC, and Australia). The corrected uorescence
spectroscopic studies were performed on a uorescence spec-
trophotometer (Horiba Jobin Yvon FluoroMax-4 NIR, NJ, USA) at
room temperature (25 ꢁC). Fluorescence quantum yields (Øf)
GFP (323 ng mLꢀ1), as the reporter gene in the S2 cell line. In
brief, the cells were seeded in plates at a density of 2.5 ꢂ 105
cells in 1000 mL of fresh normal medium (supplemented with
10% FBS) per well, in 35 mm ꢂ 35 mm cell culture dishes and
incubated for 5 h. We prepared the PDI-PAmAm–pDNA
complexes at an N/P ratio of 20 by adding the PDI-PAmAm to the
were measured at room temperature by using Cresyl violet in
DNA solutions, followed by incubation for 15 min at room
methanol as a reference.5
temperature. At the time of transfection, the medium was
replaced with serum-free medium. The PDI-PAmAm–pDNA
complexes were added to the medium and incubated with the
cells for 6 h under standard incubation conditions. Then, the
medium was replaced with 1500 mL of fresh normal medium
(supplemented with 10% FBS). The cells were incubated for an
additional 54 h under the same conditions, giving rise to a total
transfection time of 60 h. Next, GFP expression was detected
using uorescence microscopy. PEI–pDNA complexes at the N/P
ratio of 20 were used as a control.
Characterization of the PDI-PAmAm–DNA complexes
The purity and concentration of the puried DNA were deter-
mined by absorption at 260 and 280 nm and by agarose gel
electrophoresis. N/P ratios are expressed as molar ratios of
nitrogen (N) in PDI-PAmAm to phosphate (P) in DNA. An
average mass weight of 325 per phosphate group of DNA was
assumed. All PDI-PAmAm–DNA complexes were formed by
mixing equal volumes of PDI-PAmAm and DNA solutions to
achieve the desired N : P ratio. Each mixture was vortexed and
incubated for 30 min at room temperature. PDI-PAmAm was
Insect rearing
examined for its ability to bind DNA through agarose gel elec- Drosophila larvae were fed with an articial diet containing the
trophoresis using the procedures similar to those described gene carrier PDI-PAmAm from the rst to third instar, and then
earlier.14 The particle sizes and zeta potentials of the PDI- the guts of the third instar larvae were dissected and observed
3082 | J. Mater. Chem. B, 2014, 2, 3079–3086
This journal is © The Royal Society of Chemistry 2014

View Article Online
Paper
Journal of Materials Chemistry B
under a uorescence microscope. Immediately aer hatching
from eggs, black cutworm larvae were picked out and individ-
ually fed with an articial diet mixed with dsRNA alone or a
complex of dsRNA–PDI-PAmAm. The larval development status
was imaged for analysis.
Gene carrier-delivered RNAi in insects
dsRNA targeting a key developmental gene, the decapentaplegic
(dpp) gene, was synthesized using a T7 RiboMAX expression
RNAi system (Promega). 12 mg of dsRNA was mixed with 12 mg of
the gene carrier, PDI-PAmAm, and then the complex was mixed
with a fresh articial diet. The newly-hatched larvae were indi-
vidually fed with this diet. The larvae fed with dsRNA alone were
used as the control experiment. Aer 4 days, dsRNA-incorpo-
rated food was replaced with fresh normal food and photos were Fig. 1 1H NMR spectra of the intermediate products 2 and 3 in DMSO
(note: the characteristic peaks of the methylene group (CH2]) at 5.59,
6.11 and 6.23 ppm disappeared completely, indicating the completion
of the Michael addition of acrylamides in 2).
taken for comparison.
The sequence of the synthesized dpp-dsRNA is as follows:
CAGAACATAATCATGGACTATTAGTGCGTGTGTTAGAAGAGGGT
GAGCAAAATATAGACGCTAAACAACCACATGTGAGAGTGCGGA
GACGTGCCGAGGAGGAGGAGGCCGAGTGGAGCACGCGGCAAC
CTCTGCTGCTGCTGTACACGGAGGACGCGCGCGCGCGCGCCG
CTCGGGAGAGCGGAGAGACGCGGCTGGTTCGCAACAAGCGCG
CGACGCAGCGGCGTGGTCATCGAGCACATCACCGCCGCAAGG
uorescence intensity of PDI-PAmAm in aqueous solution
remained nearly unchanged aer 24 h exposure under natural
light (Fig. S1, ESI†), suggesting its good photostability. High
water solubility and photostability are essential properties for
AGGCGCGCGAGATCTGCCAGCGACGTCCGCTCTACGTGGACT
TCGCGGAGGTGGGCTGGAGCGATTGGATCGTGGCGCCGCACG
biological applications.
GCTACGAGGCGTACTACTGCCAGGGCGACTGCCCGTTCCCGC
Optical properties of PDI-PAmAm
TGGCCGACCACCTCAACGGCACGAACCACGCGATCGTGCAGAC
TCTCGTGAACTCAGTGAACCCGGCCGCAGTGCCGAAAGCGTGC
TGTGTACCGACACAGCTCTCCTCTATTTCCAT.
The aggregation behavior of PDI-PAmAm in aqueous solution
was studied by concentration-dependent UV-Vis absorption
spectroscopy (Fig. 2(A)). The absorption bands of PDI-PAmAm
show the characteristic p–p* transitions at 455, 554 and 596
nm, consistent with those of the bay-modied PDIs.4,17 The
absorption spectra of aqueous solutions of PDI-PAmAm in the
Results and discussion
Synthesis
The detailed synthesis and material characterization proce- concentration range 0.2 mM to 2.0 mM exhibit the same
dures and can be found in the Experimental section and in the absorption peak as the PDI chromophore core. A linear
ESI.† Amine-functionalized PDI (1, Scheme 1) was prepared concentration-dependent absorbance is observed over the
according to the literature.27 The four primary amines in dye 1 whole concentration range studied (Fig. 2(A), inset), implying
reacted with one acrylamide group in excess N,N0-methylene that PDI-PAmAm exists in a typically monomeric form in the
bisacrylamide (1 : MBA ¼ 1 : 10) via a Michael addition reaction concentration range studied. The concentration-dependent
to form vinyl-functionalized intermediate product 2,28–30 to uorescence behaviour of PDI-PAmAm in water at an excita-
ensure the completion of the reaction, as monitored by MALDI- tion wavelength of 554 nm was also investigated (Fig. 2(B)).
TOF MS spectrometry and 1H NMR spectra (Fig. S7 and S8, PDI-PAmAm retains the characteristic emission properties of
ESI†). Repeated washing with ether–hexane (4 : 1, v/v) yielded bay-region substituted PDIs and exhibits an emission peak at
pure 2. The acrylamides at the periphery of 2 selectively reacted 631 nm. Even when the concentration of PDI-PAmAm in water
with the secondary amine group in excess 1-(2-aminoethyl) is as high as 2.0 mM, the maximum emission peak is almost
piperazine (AEPZ) (2 : AEPZ ¼ 1 : 10) by a Michael addition unshied and no new emission peaks are observed, indi-
resulting in 3.29 The characteristic peaks of the methylene group cating that the aggregation of the central PDI in aqueous
(CH2]) at 5.59, 6.11, and 6.23 ppm disappear completely solution was inhibited by PAmAm. The uorescence quantum
(Fig. 1), indicating the completion of the Michael addition of yield (Øf) of aqueous PDI-PAmAm was 0.18, obtained by using
acrylamides in compound 2. Repeated washing with ether– Cresyl violet with a Øf of 0.54 in methanol as a reference
hexane (6 : 1, v/v) removed the unreacted AEPZ. Similarly, chromophore.5 The above results indicate that the PAmAm
alternately adding MBA and APEZ into the reaction system shell encapsulates the PDI chromophore and clearly improves
produced amine-functionalized intermediate product 4 and the the water solubility of PDI by suppressing aggregation in
desired product, PDI-PAmAm. PDI-PAmAm contains dendritic water. These characterizations make PDI-PAmAm a useful
polyamide units and shows high water solubility (>20 mg candidate in bio-applications such as cell uptake and gene
mLꢀ1), and chemical stability without treatment with HCl. The transfection.
This journal is © The Royal Society of Chemistry 2014
J. Mater. Chem. B, 2014, 2, 3079–3086 | 3083

View Article Online
Journal of Materials Chemistry B
Paper
DNA into small nanoparticles, as shown in Table S1 (ESI†). In
general, the hydrodynamic size of the complex decreases with
increasing N/P ratio and PDI-PAmAm can condense DNA into
nanoparticles of various diameters in the range 100–200 nm at
an N/P ratio above 2. Zeta potential is an indicator of surface
charges on the polymer–DNA nanoparticles.
A positively
charged surface allows electrostatic interaction with anionic cell
surfaces and facilitates cellular uptake. The zeta-potentials of
PDI-PAmAm before and aer it forms a complex with DNA at
various N/P ratios are presented in Table S2 (ESI†). The zeta
potentials of the PDI-PAmAm–DNA complex increased with
increasing N/P ratios, indicating the efficient binding of PDI-
PAmAm and DNA.
Cytotoxicities of PDI-PAmAm and the PDI-PAmAm–DNA
complexes
It is very important to evaluate the potential toxicity of poly-
meric materials for biomedical applications. Here, the in vitro
cytotoxicity of PEI, PDI-PAmAm and the PDI-PAmAm–DNA
complexes were assessed by a Tali™ viability assay13,19 using
Drosophila S2 cells. As shown in Fig. 4, the cell viabilities of PDI-
PAmAm are higher than 92% at all the concentrations studied.
This cell viability of PDI-PAmAm is comparable with the value of
previously reported cationic dendrimers19 and is better than
that of previously reported uorescent nanoparticles,13 indi-
cating that the PDI-PAmAm solutions at these concentrations
have low toxicity. The cell viabilities of the PDI-PAmAm–DNA
complexes are still high (>91%), as shown in Fig. 4. Both the
pure PDI-PAmAm and the PDI-PAmAm–DNA complexes exhibit
much lower toxicity than the commercial gene carrier, PEI
(1 mM) (Fig. 4). The cell viability of PEI is consistent with the
results reported in the literature.21
Fig. 2 Concentration-dependent (A) absorbance and (B) fluorescence
(FL) spectra of PDI-PAmAm in water (concentration: 0.2 mM to 2.0 mM,
lex ¼ 554 nm). Inset: dependence of absorbance intensity (at lmax of
596 nm) on concentration.
PDI-PAmAm–DNA complexes
For cellular transfection, PDI-PAmAm and DNA have to form a
stable complex in solution. A gel retardation test at various N/P
ratios of the PDI-PAmAm–DNA complexes was performed to
determine whether the complexes are stable. As shown in Fig. 3,
PDI-PAmAm can prevent the DNA band from moving in the gel
at an N/P ratio above 1. PDI-PAmAm can efficiently compact
Gene transfection
To investigate the ability of PDI-PAmAm to enter into live cells,
Drosophila S2 cells were incubated with PDI-PAmAm. Because of
the central PDI chromophore, the distributions of PDI-PAmAm
in live cells can be traced by uorescence microscopy. The
detectable uorescent signal depends on the PDI-PAmAm
concentration. As shown in Fig. 5(C), PDI-PAmAm can be
detected inside the cells aer an incubation period of
Fig. 3 Agarose gel electrophoresis of PDI-PAmAm–DNA complexes
at various N/P ratios.
Fig. 4 Cell viability assays.
3084 | J. Mater. Chem. B, 2014, 2, 3079–3086
This journal is © The Royal Society of Chemistry 2014

View Article Online
Paper
Journal of Materials Chemistry B
with negatively charged macromolecules, such as DNA, through
electrostatic forces.31–33 In order to assess whether PDI-PAmAm
can act as a carrier for delivering DNA into cells, live S2 cells
were incubated with a buffer containing PDI-PAmAm–DNA
complexes at N/P ratios of 2 : 1, 4 : 1, and 8 : 1. In the control
experiment, DNA alone cannot enter into live cells (Fig. 5(A)).
The gene delivery efficacies of the PDI-PAmAm–DNA complexes
were visualized by uorescent tracing of their cellular distri-
bution of PDI-PAmAm and of DNA labelled using CXR Refer-
ence Dye (CRD). Aer 36 h incubation, both PDI-PAmAm and
DNA are enriched in live cells, suggesting effective delivery by
PDI-PAmAm (Fig. 5(B), (B0) and (B00)). The gene delivery rate and
efficacy of PDI-PAmAm are conrmed by the quantied uo-
rescence intensity of the CRD-labelled DNA inside the cells
(Fig. S2 and S3, ESI†). The gene delivery efficacy of PDI-PAmAm
is better than that of the previously reported uorescent nano-
particles (FNP)13 and cationic dendrimers19 (Fig. S3(B)†). The
remarkable uorescence intensity of CRD-labelled DNA at lower
N/P ratios suggests the high gene delivery efficacy of PDI-
PAmAm, while the commercial DNA carrier, PEI, requires high
N/P ratios for gene delivery.21 Under the same conditions, PDI-
PAmAm delivering DNA into live cells is much faster than the
commercial DNA carrier (Fig. S4, ESI†).
To examine the efficacy of PDI-PAmAm for gene transfection
in vitro, a GFP plasmid was chosen for a further in vitro test. As
shown in Fig. 5(D) and S5 (ESI†), weak green uorescence is
observed in the cells in a control experiment of PEI-delivered
GFP expression. As expected, strong green uorescence is
observed in the cells in the case of PDI-PAmAm-delivered GFP
expression (Fig. 5(E) and S5 (ESI†)). This suggests that PDI-
PAmAm is an efficient gene carrier for in vitro applications.
To investigate the gene delivery efficacy of PDI-PAmAm
under in vivo conditions, we rstly tested whether PDI-PAmAm
is able to enter into the gut tissue of Drosophila larvae. First,
instar larvae were fed with a fresh articial diet containing PDI-
PAmAm. Aer 3 days of feeding, the larvae were dissected to
obtain guts for uorescence observations. As shown in
Fig. S6(A),† red uorescent spots were observed in the gut cells,
indicating that PDI-PAmAm passed through the peritrophic
membrane and entered into the gut cells. All tested larvae
survived to adulthood, which demonstrates the safety of PDI-
PAmAm-incorporated diet. We then tested whether the PDI-
PAmAm–dsRNA complex is able to enter into gut tissue. A GFP–
Fig. 5 Gene transfection assays of PDI-PAmAm. (A) Control experi-
ment. DNA alone cannot enter into live cells. (B) Fluorescence images
of the PDI-PAmAm–DNA complex internalized into live cells (2 mM
PDI-PAmAm, 100 mM DNA, N/P ¼ 8 : 1). Separated channels are shown
in (B0) (blue, DNA) and (B00) (red, PDI-PAmAm). DNA was fluorescently
labelled using CXR Reference Dye (blue). (C) Required incubation time
(h) of PDI-PAmAm and previously reported G1, G2 and G3 for fluo-
rescence detection. (D) Relatively weak GFP expression of the PEI-
delivered GFP plasmid in cells. (E) Much stronger GFP expression of the
PDI-PAmAm-delivered GFP plasmid in cells. (F) After oral feeding with
an artificial diet containing PDI-PAmAm-delivered dsRNA targeting a dsRNA fragment was synthesized with a T7 RiboMAX expression
key developmental gene, the decapentaplegic gene, larvae show
apparent growth defects compared with the control.
RNAi system, and was labelled with a blue-uorescence CRD.
The dissected larval guts were incubated with PDI-PAmAm–
dsRNA (at the N/P ratio of 2 : 1) complexes. The delivery of
dsRNA by PDI-PAmAm was observed by the uorescence
approximately 1 h at a concentration of 2 mM, demonstrating distributions of PDI-PAmAm and the CRD labelled dsRNA in gut
the efficient and rapid internalization of PDI-PAmAm, while tissues (Fig. S6(B) and (B00)†). For in vivo applications to interfere
previously reported cationic polyester dendrimers19 required with gene expression, dsRNA fragments were synthesized to
higher concentrations to be detected inside live cells (Fig. 5(C)). specically target a key developmental gene, the decap-
Therefore, the outer PAmAm shell structure contributes to the entaplegic (dpp) gene,34 of the black cutworm. Aer oral feeding
enhanced cellular internalization of PDI-PAmAm.
with an articial diet containing the PDI-PAmAm–dsRNA (at an
The above cell uptake results demonstrate that PDI-PAmAm N/P ratio of 2 : 1) complexes, the tested larvae showed apparent
can be rapidly internalized into live cells within a short incu- growth defects compared with the control, which was fed
bation time. The positive charges in PDI-PAmAm can interact dsRNA alone (Fig. 5(F)), and the negative GFP–dsRNA complex
This journal is © The Royal Society of Chemistry 2014
J. Mater. Chem. B, 2014, 2, 3079–3086 | 3085

View Article Online
Journal of Materials Chemistry B
Paper
control. Aer 4 days of treatment, the growth inhibition was 10 S. K. Yang and S. C. Zimmerman, Adv. Funct. Mater., 2012,
quantied by measuring the larval body length. Compared with 22, 3023.
the larvae fed with dsRNA alone, the body lengths of the PDI- 11 M. Yin, J. Shen, G. O. Pugfelder and K. Mullen, J. Am. Chem.
PAmAm–dsRNA-fed larvae were reduced by 35%, indicating an Soc., 2008, 130, 7806.
apparent growth defect induced by the complexes. These results 12 M. Yin, J. Shen, R. Gropeanu, G. O. Pugfelder, T. Weil and
¨
¨
K. Mullen, Small, 2008, 4, 894.
demonstrate that PDI-PAmAm fulls the requirements of a gene
carrier for both in vitro and in vivo applications.
¨
13 B. He, Y. Chu, M. Yin, K. Mullen, C. An and J. Shen, Adv.
Mater., 2013, 25, 4580.
14 M. Yin, C. Feng, J. Shen, Y. Yu, Z. Xu, W. Yang, W. Knoll and
Conclusions
¨
K. Mullen, Small, 2011, 7, 1629.
In conclusion, the synthesis and optical properties of a novel
water-soluble PDI-PAmAm are reported. The aggregation of the
encapsulated PDI chromophore was noticeably suppressed by
the outer PAmAm shells, thus leading to the enhancement of
optical performance of PDI in water. Strong red uorescence,
good water solubility, and high photostability were the prime
attractions for bio-applications. PDI-PAmAm can be rapidly
internalized into live cells, with high efficacy of gene delivery
and low cytotoxicity. PDI-PAmAm shows great gene transfection
and gene interference performance in both in vitro and in vivo
experiments.
¨
15 T. Heek, C. Fasting, C. Rest, X. Zhang, F. Wurthner and
R. Haag, Chem. Commun., 2010, 46, 1884.
¨
16 T. Heek, F. Wurthner and R. Haag, Chem. - Eur. J., 2013, 19,
10911.
17 S. K. Yang, X. Shi, S. Park, S. Doganay, T. Ha and
S. C. Zimmerman, J. Am. Chem. Soc., 2011, 133, 9964.
18 B. Gao, H. Li, H. Liu, L. Zhang, Q. Bai and X. Ba, Chem.
Commun., 2011, 47, 3894.
19 Z. Xu, B. He, J. Shen, W. Yang and M. Yin, Chem. Commun.,
2013, 49, 3646.
20 A. T. Zill, K. Licha, R. Haag and S. C. Zimmerman, New
J. Chem., 2012, 36, 419.
21 Y. Chen, L. Zhou, Y. Pang, W. Huang, F. Qiu, X. Jiang, X. Zhu,
D. Yan and Q. Chen, Bioconjugate Chem., 2011, 22, 1162.
22 G. Wang, H. Yin, J. C. Y. Ng, L. Cai, J. Li, B. Z. Tang and
B. Liu, Polym. Chem., 2013, 4, 5297.
23 Y. Gao, G. Gao, Y. He, T. Liu and R. Qi, Mini-Rev. Med. Chem.,
2008, 8, 889.
24 A. Ghilardi, D. Pezzoli, M. C. Bellucci, C. Malloggi, A. Negri,
A. Sganappa, G. Tedeschi, G. Candiani and A. Volonterio,
Bioconjugate Chem., 2013, 24, 1928.
25 J. S. Choi, K. Nam, J.-y. Park, J.-B. Kim, J.-K. Lee and J.-s. Park,
J. Controlled Release, 2004, 99, 445.
Acknowledgements
This work was nancially supported by the 973 Program
(2013CB127603), the National Science Foundation of China
(21174012, 51103008, 51221002, 31372255), Beijing Natural
Science Foundation (2142026), the Special Fund for Agro-
scientic Research in the Public Interest (201003025), the New
Century Excellent Talents Award Program from the Ministry of
Education (NCET-10-0215) and the Doctoral Program of Higher
Education Research Fund (20120010110008).
26 M. Chen and M. Yin, Prog. Polym. Sci., 2014, 39, 365.
Notes and references
´
¨
27 H.-A. Klok, J. R. Hernandez, S. Becker and K. Mullen,
J. Polym. Sci., Part A: Polym. Chem., 2001, 39, 1572.
28 Y.-Z. You, J.-J. Yan, Z.-Q. Yu, M.-M. Cui, C.-Y. Hong and
B.-J. Qu, J. Mater. Chem., 2009, 19, 7656.
1 M. D. Yilmaz, O. A. Bozdemir and E. U. Akkaya, Org. Lett.,
2006, 8, 2871.
2 T. Weil, T. Vosch, J. Hoens, K. Peneva and K. Mullen,
¨
Angew. Chem., Int. Ed., 2010, 49, 9068.
3 H. Langhals, W. Jona, F. Einsiedl and S. Wohnlich, Adv.
Mater., 1998, 10, 1022.
29 Y.-Z. You, Z.-Q. Yu, M.-M. Cui and C.-Y. Hong, Angew. Chem.,
Int. Ed., 2010, 49, 1099.
30 B. Zhang, X. Ma, W. Murdoch, M. Radosz and Y. Shen,
Biotechnol. Bioeng., 2013, 110, 990.
31 J. Li, K. Guo, J. Shen, W. Yang and M. Yin, Small, 2014, 10,
1351.
¨
4 J. Qu, C. Kohl, M. Pottek and K. Mullen, Angew. Chem., Int.
Ed., 2004, 43, 1528.
¨
5 C. Kohl, T. Weil, J. Qu and K. Mullen, Chem. - Eur. J., 2004, 10,
5297.
¨
32 M. Yin, J. Shen, W. Pisula, M. Liang, L. Zhi and K. Mullen,
¨
6 C. Backes, C. D. Schmidt, F. Hauke, C. Bottcher and
J. Am. Chem. Soc., 2009, 131, 14618.
33 W. Qu, S. Chen, S. Ren, X. Jiang, R. Zhuo and X. Zhang, Chin.
J. Polym. Sci., 2013, 31, 713.
34 X. Zhang, D. Luo, G. O. Pugfelder and J. Shen, Development,
2013, 140, 2917.
A. Hirsch, J. Am. Chem. Soc., 2009, 131, 2172.
7 S. Rehm, V. Stepanenko, X. Zhang, T. H. Rehm and
¨
F. Wurthner, Chem. - Eur. J., 2010, 16, 3372.
8 S. Demmig and H. Langhals, Chem. Ber., 1988, 121, 225.
9 H. Kobayashi, M. Ogawa, R. Alford, P. L. Choyke and
Y. Urano, Chem. Rev., 2009, 110, 2620.
3086 | J. Mater. Chem. B, 2014, 2, 3079–3086
This journal is © The Royal Society of Chemistry 2014