Discovery of a selective, substrate-competitive inhibitor of the lysine methyltransferase SETD8

Article abstract of DOI:10.1021/jm500871s

The lysine methyltransferase SETD8 is the only known methyltransferase that catalyzes monomethylation of histone H4 lysine 20 (H4K20). Monomethylation of H4K20 has been implicated in regulating diverse biological processes including the DNA damage response. In addition to H4K20, SETD8 monomethylates non-histone substrates including proliferating cell nuclear antigen (PCNA) and promotes carcinogenesis by deregulating PCNA expression. However, selective inhibitors of SETD8 are scarce. The only known selective inhibitor of SETD8 to date is nahuoic acid A, a marine natural product, which is competitive with the cofactor. Here, we report the discovery of the first substrate-competitive inhibitor of SETD8, UNC0379 (1). This small-molecule inhibitor is active in multiple biochemical assays. Its affinity to SETD8 was confirmed by ITC (isothermal titration calorimetry) and SPR (surface plasmon resonance) studies. Importantly, compound 1 is selective for SETD8 over 15 other methyltransferases. We also describe structure-activity relationships (SAR) of this series.

Full text of DOI:10.1021/jm500871s

Article
pubs.acs.org/jmc
Open Access on 07/17/2015
Discovery of a Selective, Substrate-Competitive Inhibitor of the
Lysine Methyltransferase SETD8
Anqi Ma,†,∞ Wenyu Yu,⊥,∞ Fengling Li,⊥ Rachel M. Bleich,† J. Martin Herold,† Kyle V. Butler,†
Jacqueline L. Norris,† Victoria Korboukh,† Ashutosh Tripathy,∥ William P. Janzen,†
Cheryl H. Arrowsmith,⊥ Stephen V. Frye,† Masoud Vedadi,⊥,# Peter J. Brown,⊥ and Jian Jin*,†,‡,§
†Center for Integrative Chemical Biology and Drug Discovery, Division of Chemical Biology and Medicinal Chemistry, UNC
Eshelman School of Pharmacy, ‡Department of Pharmacology, School of Medicine, §Lineberger Comprehensive Cancer Center, and
∥Department of Biochemistry and Biophysics, UNC Macromolecular Interactions Facility, University of North Carolina at Chapel
Hill, Chapel Hill, North Carolina 27599, United States
⊥Structural Genomics Consortium, University of Toronto, Toronto, Ontario M5G 1L7, Canada
#Department of Pharmacology and Toxicology, University of Toronto, Toronto, Ontario M5S 1A8, Canada
S
* Supporting Information
ABSTRACT: The lysine methyltransferase SETD8 is the only known methyltransfer-
ase that catalyzes monomethylation of histone H4 lysine 20 (H4K20). Mono-
methylation of H4K20 has been implicated in regulating diverse biological processes
including the DNA damage response. In addition to H4K20, SETD8 monomethylates
non-histone substrates including proliferating cell nuclear antigen (PCNA) and
promotes carcinogenesis by deregulating PCNA expression. However, selective
inhibitors of SETD8 are scarce. The only known selective inhibitor of SETD8 to
date is nahuoic acid A, a marine natural product, which is competitive with the
cofactor. Here, we report the discovery of the first substrate-competitive inhibitor of
SETD8, UNC0379 (1). This small-molecule inhibitor is active in multiple biochemical
assays. Its affinity to SETD8 was confirmed by ITC (isothermal titration calorimetry) and SPR (surface plasmon resonance)
studies. Importantly, compound 1 is selective for SETD8 over 15 other methyltransferases. We also describe structure−activity
relationships (SAR) of this series.
corresponding methyltransferases in various human dis-
eases.16,19,20,28,29,33,39−42
INTRODUCTION
■
Protein lysine methyltransferases (PKMTs, also known as
histone lysine methyltransferases (HKMTs)) catalyze the
transfer of the methyl group from the cofactor S-adenosyl-L-
methionine (SAM) to lysine residues of histone and non-
histone substrates, leading to lysine mono-, di-, and/or
trimethylation.1−3 Histone lysine methylation has been
increasingly recognized as a major epigenetic gene regulation
mechanism in eukaryotic cells.1−6 Therefore, PKMTs as a class
of potential drug targets have received considerable attention
from the medicinal chemistry and chemical biology community.
With the exception of DOT1L, PKMTs contain an
evolutionarily conserved SET (Su(var), E(z), and Trithorax)
domain.7 This catalytic domain consists of a substrate binding
groove and a cofactor binding site.8 A number of selective
small-molecule inhibitors of PKMTs including G9a/GLP,
EZH2, SMYD2, DOT1L, and SETD2 have been discov-
ered.9−35 These inhibitors are competitive with either the
peptide substrate or the cofactor SAM. In addition, a number of
selective inhibitors of protein arginine methyltransferases
(PRMTs), another class of protein methyltransferases, have
been reported.36−38 Some of these inhibitors have subsequently
been utilized as valuable tools for investigating the role of the
SETD8 (also known as SET8, PR-SET7, or KMT5A (lysine
methyltransferase 5A)) is the sole methyltransferase that
catalyzes monomethylation of histone H4 lysine 20
(H4K20).43−45 SETD8 and H4K20me (H4K20 monomethy-
lation) have been implicated in regulating a diverse set of
biological processes including the DNA damage response, DNA
replication, and mitotic condensation.45 A recent study has
shown that (1) SETD8 is physically associated with TWIST, a
master regulator of EMT (epithelial−mesenchymal transition),
(2) SETD8 and TWIST are functionally interdependent on
promoting EMT, (3) SETD8 acts on the promoters of the
TWIST target genes such as N-cadherin via exertion of its
H4K20 monomethylation activity, and (4) SETD8 expression
is positively correlated with metastasis and the expression of
TWIST and N-cadherin in breast cancer cells.46 In addition to
H4K20, SETD8 methylates many non-histone substrates
including the tumor suppressor p53 and proliferating cell
nuclear antigen (PCNA).47,48 The monomethylation of p53 at
lysine 382 (p53K382me1) catalyzed by SETD8 suppresses p53-
Received: June 9, 2014
Published: July 17, 2014
© 2014 American Chemical Society
6822
dx.doi.org/10.1021/jm500871s | J. Med. Chem. 2014, 57, 6822−6833

Journal of Medicinal Chemistry
Article
mediated transcription activation of highly responsive target
genes.47 SETD8 and PCNA are coexpressed in lung cancer
tissues.48 The monomethylation of PCNA at lysine 248
(PCNAK248me1) catalyzed by SETD8 stabilizes PCNA
protein, enhances the interaction between PCNA and the flap
endonuclease FEN1, and promotes the proliferation of cancer
cells.48
However, selective inhibitors of SETD8 are scarce. To date,
nahuoic acid A, a marine natural product, is the only known
selective inhibitor of SETD8 (Figure 1).25 This inhibitor is
inhibitor of SETD8 (Figure 2). Interestingly, compound 1 was
originally prepared for targeting L3MBTL1, a methyllysine
reader protein,49 but showed no appreciable activity for
L3MBTL1. On the other hand, compound 1 displayed
inhibitory activity with an IC50 of 7.3 1.0 μM (n = 2) in a
radioactive biochemical assay that measures the transfer of the
3
tritiated methyl group from H-SAM to a peptide substrate
catalyzed by SETD8 (Figure 2). The inhibitory activity of
compound 1 was confirmed in an orthogonal biochemical
assay, microfluidic capillary electrophoresis (MCE) assay. This
SETD8 MCE assay was developed analogously to the
previously reported G9a MCE assay.50 Compound 1 exhibited
an IC50 of 9.0 μM in the SETD8 MCE assay.
Analogue Synthesis. To determine SAR for this promising
hit, we designed and synthesized a number of analogues that
contain various 2- and 4-substituents at the quinazoline core.
We synthesized compounds 1−24 from commercially available
2,4-dichloro-6,7-dimethoxyquinazoline and corresponding
amines in good yields (Scheme 1 and Tables 1 and 2). Using
Scheme 1. Typical Synthesis of 2,4-Diamino-6,7-
a
dimethoxyquinazolines
Figure 1. Structure of the known SETD8 inhibitor nahuoic acid A.25
competitive with the cofactor SAM and noncompetitive with
the peptide substrate. Here we report the discovery of
UNC0379 (1), the first substrate-competitive inhibitor of
SETD8. Compound 1 is a synthetic small-molecule inhibitor
that displays inhibitory activity in multiple biochemical assays
and is selective for SETD8 over 15 other methyltransferases.
The binding affinity of compound 1 to SETD8 was determined
using biophysical assays such as ITC (isothermal titration
calorimetry) and SPR (surface plasmon resonance) and is
largely consistent with its potency in biochemical assays. We
describe hit identification, analogue synthesis, structure−
activity relationship (SAR) findings, and comprehensive
characterization of compound 1 in a number of biochemical
and biophysical assays including mechanism of action and
selectivity studies.
a
(a) R1 amines, THF, N,N-diisopropylethylamine, room temperature;
(b) R2 amines, n-BuOH, DIPEA, microwave, 160 °C.
the methods developed previously,10 we displaced the 4-chloro
group with the first set of amines at room temperature and the
2-chloro group with the second set of amines under microwave
heating conditions to yield the desired 2,4-diamino-6,7-
dimethoxyquinazolines.
SAR in SETD8 Biochemical Assay. The synthesized
compounds were then evaluated in the SETD8 radioactive
methyl transfer assay. IC50 values of these compounds in this
biochemical assay are summarized in Tables 1 and 2.
We first explored the 4-amino group of the quinazoline
scaffold (Table 1). Reducing the length of the alkyl linker
between the two amino groups resulted in the decrease of the
potency (compound 1 versus compounds 2−4). The distal
amino group can be changed from the pyrrolidinyl to
piperidinyl or dimethylamino without any potency loss
(compound 1 versus compounds 5 and 6). Interestingly, the
diethylamino analogue (compound 7) was somewhat less
potent than compounds 1, 5, and 6. We also attempted to
RESULTS AND DISCUSSION
■
Discovery of Compound 1 as a SETD8 Inhibitor. We
previously reported that 2,4-diaminoquinazolines are selective,
substrate-competitive inhibitors of the lysine methyltransferases
G9a and GLP.10,12−14,30 To identify a substrate-competitive
inhibitor of SETD8, we cross-screened our quinazoline-based
inhibitor set, which consists of >150 compounds, against
SETD8. From this study, we discovered compound 1 as an
Figure 2. Compound 1 was identified as an inhibitor of SETD8 by cross-screening a quinazoline-based inhibitor set. (A) Structure of compound 1.
(B) Concentration−response curve of compound 1 in the SETD8 radioactive methyl transfer assay.
6823
dx.doi.org/10.1021/jm500871s | J. Med. Chem. 2014, 57, 6822−6833

Journal of Medicinal Chemistry
Article
Table 1. SAR of the 4-Amino Group
Table 2. SAR of the 2-Amino Group
a
IC50 determination experiments were performed in duplicate.
8−12). However, these structural modifications led to a
potency loss, suggesting that an additional basic amino group
(compounds 9−12) or a large substituent (compound 8) is
detrimental to inhibiting SETD8. In addition, we found that the
basicity of the pyrrolidinyl group in compound 1 was an
important contributor to its SETD8 inhibitory activity, as the
corresponding amide analogue (compound 13) was about 8-
fold less potent than compound 1. We also explored whether
the NH group in compound 1 was potentially engaged in a
hydrogen bond interaction and found that the N-methyl
analogue (compound 14) was drastically less potent than
compound 1, suggesting that the hydrogen of the secondary
amine likely serves as a hydrogen bond donor.
a
IC50 determination experiments were performed in duplicate.
replace the piperidinyl group with a piperazinyl or N-
substituted piperazinyl group (compound 1 versus compounds
6824
dx.doi.org/10.1021/jm500871s | J. Med. Chem. 2014, 57, 6822−6833

Journal of Medicinal Chemistry
Article
We next explored the 2-amino group of the quinazoline
scaffold (Table 2). The replacement of the pyrrolidinyl group
with either the piperidinyl or azepanyl group resulted in a
significant loss of the potency (compound 1 versus compounds
15 and 16), suggesting a large group is disfavored. On the other
hand, the dimethylamino group (compound 17) did not lead to
any significant potency loss. The introduction of an additional
basic amino group (compound 15 versus the unsubstituted
piperazinyl analogue 18 and the N-methylpiperazinyl analogue
19) resulted in a complete loss of the potency. We also
explored other amino groups such as N-methyl-N-cyclopentyl-
amine (compound 20) and N-methyl-N-cyclohexylamine
(compound 21). Compared with compound 1, compounds
20 and 21 were about 4-fold less potent. Interestingly,
removing the methyl group from either compound 20 or 21
led to the complete loss of inhibitory activity (compounds 22
and 23), suggesting that tertiary amino groups are preferred
compared with secondary amino groups. In addition, the chloro
analogue (compound 24) was inactive. Taken together, these
results suggest that SETD8 inhibitory activity is very sensitive
to the 2-substituent.
MOA Studies. We next studied the MOA (mechanism of
action) of the SETD8 inhibition by compound 1 via varying
concentrations of the H4 peptide substrate or the cofactor
SAM. As illustrated in Figure 5A, IC50 values of compound 1
increased linearly with H4 peptide concentrations. On the
other hand, IC50 values of compound 1 remained constant in
the presence of increasing concentrations of SAM (Figure 5B).
These results indicate that compound 1 is competitive with the
peptide substrate and noncompetitive with the cofactor SAM.
Peptide Displacement Assay. To confirm the findings
from the MOA studies, we tested compound 1 and an inactive
control (compound 14) in a peptide displacement assay using
fluorescence polarization (FP), which measures effects of
inhibitors on displacing the H4K20me (1−24) peptide with
N-terminus labeled by fluorescein isothiocyanate (FITC). As
illustrated in Figure 6, compound 1 effectively displaced the
FITC-labeled peptide binding to SETD8 with an IC50 of 37.7
7.2 μM (n = 2). On the other hand, our negative control
(compound 14) did not displace the peptide in this FP assay.
These results further support that compound 1 is competitive
with the peptide substrate.
ITC and SPR Studies. We next characterized compound 1
in biophysical assays. In ITC studies, compound 1 bound
SETD8 with a KD of 18.3 3.2 μM (n = 3) (Figure 3). In SPR
Selectivity. We next determined the selectivity of inhibitor
1 for SETD8 over 15 other methyltransferases (Figure 7). With
the exception of PRC2 (polycomb repressive complex 2), the
IC50 values of compound 1 for 14 other methyltransferases
including G9a and GLP were all above 100 μM. For PRC2,
compound 1 was active only at the two highest concentrations
(50 and 100 μM) with an estimated IC50 value greater than 50
μM. Therefore, inhibitor 1 is a selective inhibitor of SETD8.
CONCLUSIONS
■
We discovered the first selective, substrate competitive inhibitor
of SETD8 by cross-screening our quinazoline-based epigenetic
library. Our SAR studies of this series reveal that while the 4-
amino moiety can be modified without a significant loss of
potency, modifications to the 2-amino moiety are not well
tolerated. We characterized compound 1 in a battery of
biochemical, biophysical, MOA, and selectivity assays and
found that the SETD8 inhibitory activity of this compound in
biochemical assays was largely consistent with its binding
affinity to SETD8 determined by ITC and SPR. Our MOA
studies indicate that this inhibitor is competitive with the
peptide substrate and noncompetitive with the cofactor SAM.
This MOA was further supported by our finding that
compound 1 effectively displaced the FITC-labeled H4 peptide
in a FP assay. Importantly, this inhibitor is selective for SETD8
over 15 other methyltransferases including G9a and GLP, the
two PKMTs that are known for being potently inhibited by
quinazolines. These results provide the first evidence that 2,4-
diaminoquinazolines can be modified to yield selective,
substrate competitive inhibitors of PKMTs other than G9a
and GLP.
Figure 3. Compound 1 binds SETD8 with a KD of 18.3 3.2 μM (n =
3) in ITC studies.
EXPERIMENTAL SECTION
■
Chemistry General Procedures. HPLC spectra for all com-
pounds were acquired using an Agilent 6110 series system with UV
detector set to 254 nm. Samples were injected (5 μL) onto an Agilent
Eclipse Plus 4.6 mm × 50 mm, 1.8 μm C18 column at room
temperature. A linear gradient from 10% to 100% B (MeOH + 0.1%
acetic acid) in 5.0 min was followed by pumping 100% B for another 2
min with A being H2O + 0.1% acetic acid. The flow rate was 1.0 mL/
min. Mass spectra data were acquired in positive ion mode using an
Agilent 6110 single quadrupole mass spectrometer with an electro-
studies, compound 1 behaved as a classic reversible inhibitor
with a fast on rate (ka = 2.18 0.36 × 104 1/Ms) and a fast off
rate (kd = 7.82
compound 1 was determined to be 36.0 2.3 μM (n = 3). The
binding affinity of compound 1 to SETD8 determined by ITC
and SPR is largely consistent with its potency in the
biochemical assays.
0.87 × 10−1 1/s) (Figure 4). The KD of
6825
dx.doi.org/10.1021/jm500871s | J. Med. Chem. 2014, 57, 6822−6833

Journal of Medicinal Chemistry
Article
Figure 4. Compound 1 exhibits rapid on and off rates in SPR studies.
Figure 5. MOA studies of compound 1. (A) Compound 1 is competitive with the peptide substrate, as its IC50 values increased linearly with H4
peptide concentrations. (B) Compound 1 is noncompetitive with the cofactor SAM, as its IC50 values remained constant in the presence of
increasing concentrations of SAM.
Figure 7. Selectivity of inhibitor 1 versus 15 other methyltransferases.
Figure 6. Peptide displacement assay. Compound 1 effectively
displaced the FITC-labeled H4K20me (1−14) peptide, while an
inactive control (compound 14) did not.
in 0.1% TFA in H2O (B) to 100% of MeOH (A). HPLC was used to
establish the purity of target compounds. All compounds had >95%
purity using the HPLC methods described above. High-resolution
spray ionization (ESI) source. Nuclear magnetic resonance (NMR)
spectra were recorded at Varian Mercury spectrometer with 400 MHz
for proton (1H NMR) and 100 MHz for carbon (13C NMR).
Chemical shifts are reported in ppm (δ). Preparative HPLC was
performed on Agilent Prep 1200 series with UV detector set to 254
nm. Samples were injected onto a Phenomenex Luna 75 mm × 30
mm, 5 μm C18 column at room temperature. The flow rate was 30
mL/min. A linear gradient was used with 10% (or 50%) of MeOH (A)
(positive ion) mass spectrometry (HRMS) for compound 1 was
performed using a Thermo LTqFT mass spectrometer under FT
control at 100 000 resolution.
6,7-Dimethoxy-2-(pyrrolidin-1-yl)-N-(5-(pyrrolidin-1-yl)-
pentyl)quinazolin-4-amine (1). To a solution of 2-chloro-6,7-
dimethoxy-N-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine (24, 84
mg, 0.17 mmol) and n-butanol (1.5 mL) were added pyrrolidine
(commercially available, 56 μL, 0.68 mmol) and N,N-diisopropylethyl-
6826
dx.doi.org/10.1021/jm500871s | J. Med. Chem. 2014, 57, 6822−6833

Journal of Medicinal Chemistry
Article
amine (89 μL, 0.51 mmol). The resulting solution was stirred inside a
microwave at 160 °C for 30 min. After the mixture was cooled, TLC
indicated the completion of the reaction. After removal of the solvent
by rotary evaporation, the residue was redissolved in CH2Cl2 and
washed with brine. The organic layer was dried, concentrated, and
purified by HPLC to give the title compound as a TFA salt, white solid
1-piperidinepentanamine (commercially available), N,N-diisopropyle-
thylamine, and THF. Compound 5 was prepared according to the
procedure for making 2 from 2-chloro-6,7-dimethoxy-N-(5-(piperidin-
1-yl)pentyl)quinazolin-4-amine (79 mg, 0.13 mmol), pyrrolidine (21
μL, 0.26 mmol), HCl in dioxane (4.0 M, 63 μL, 0.26 mmol), and
isopropanol (0.7 mL). The title compound 5 was obtained as a TFA
salt, brown solid (58 mg, yield 68%). 1H NMR (400 MHz, MeOH-d4)
δ 7.55 (s, 1H), 7.09 (s, 1H), 3.95 (s, 3H), 3.91 (s, 3H), 3.79−3.57 (m,
6H), 3.56−3.47 (m, 2H), 3.12−3.05 (m, 2H), 2.90 (td, J = 12.5, 2.7
Hz, 2H), 2.22−2.01 (m, 4H), 1.97−1.89 (m, 2H), 1.88−1.70 (m, 7H),
1.58−1.43 (m, 3H); 13C NMR (100 MHz, MeOH-d4) δ 160.40,
157.17, 151.53, 148.81, 136.96, 105.05, 103.62, 99.62, 58.12, 56.93,
56.79, 54.27 (four carbons), 42.50, 29.32, 25.29, 24.92, 24.24 (four
carbons), 22.72. HPLC purity: >95%; tR = 3.26 min. MS (ESI): 428
[M + H]+.
1
(70 mg, yield 64%). H NMR (400 MHz, MeOH-d4) δ 7.56 (s, 1H),
7.10 (s, 1H), 3.95 (s, 3H), 3.92 (s, 3H), 3.78−3.57 (m, 8H), 3.22−
3.16 (m, 2H), 3.10−3.01 (m, 2H), 2.19−1.97 (m, 8H), 1.86−1.73 (m,
4H), 1.55−1.47 (m, 2H); 13C NMR (100 MHz, MeOH-d4) δ 160.40,
157.17, 151.52, 148.80, 136.95, 105.04, 103.62, 99.62, 56.93, 56.79,
56.11, 55.08 (four carbons), 42.48, 29.31, 26.87, 25.20, 23.95 (four
carbons). HPLC purity: >95%; tR = 3.32 min. MS (ESI): 414 [M +
H]+. HRMS calcd for C23H35N5O2 + H, 414.2869; found, 414.2862
[M + H]+.
6,7-Dimethoxy-2-(pyrrolidin-1-yl)-N-(2-(pyrrolidin-1-yl)-
ethyl)quinazolin-4-amine (2). 2-Chloro-6,7-dimethoxy-N-(2-(pyr-
rolidin-1-yl)ethyl)quinazolin-4-amine was prepared according to the
procedure for making 24 from 2,4-dichloro-6,7-dimethoxylquinazoline,
1-(2-aminoethyl)pyrrolidine (commercially available), N,N-diisopro-
pylethylamine, and THF. To a solution of 2-chloro-6,7-dimethoxy-N-
(2-(pyrrolidin-1-yl)ethyl)quinazolin-4-amine (72 mg, 0.13 mmol) and
isopropanol (0.7 mL) were added pyrrolidine (21 μL, 0.26 mmol) and
HCl in dioxane (4.0 M, 63 μL, 0.26 mmol). The resulting solution was
stirred inside a microwave at 160 °C for 20 min. After the mixture was
cooled, TLC indicated the completion of the reaction. After removal of
the solvent by rotary evaporation, the residue was redissolved in
CH2Cl2, washed with brine. The organic layer was dried, concentrated,
and purified by HPLC to give the title compound 2 as a TFA salt,
N1-(6,7-Dimethoxy-2-(pyrrolidin-1-yl)quinazolin-4-yl)-N5,N5-
dimethylpentane-1,5-diamine (6). N1-(2-Chloro-6,7-dimethoxy-
quinazolin-4-yl)-N5,N5-dimethylpentane-1,5-diamine was prepared
according to the procedure for making 24 from 2,4-dichloro-6,7-
dimethoxylquinazoline, 5-(dimethylamino)amylamine (commercially
available), N,N-diisopropylethylamine, and THF. Compound 6 was
prepared according to the procedure for making 2 from N1-(2-chloro-
6,7-dimethoxyquinazolin-4-yl)-N5,N5-dimethylpentane-1,5-diamine
(70 mg, 0.15 mmol), pyrrolidine (21 μL, 0.30 mmol), HCl in dioxane
(4.0 M, 75 μL, 0.30 mmol), and isopropanol (1.0 mL). The title
compound 6 was obtained as a TFA salt, white solid (57 mg, yield
1
62%). H NMR (400 MHz, MeOH-d4) δ 7.55 (s, 1H), 7.09 (s, 1H),
3.95 (s, 3H), 3.91 (s, 3H), 3.78−3.54 (m, 6H), 3.16−3.09 (m, 2H),
2.87 (s, 6H), 2.22−1.98 (m, 4H), 1.89−1.72 (m, 4H), 1.58−1.39 (m,
2H); 13C NMR (100 MHz, MeOH-d4) δ 160.41, 157.19, 151.53,
148.82, 136.96, 105.05, 103.62, 99.62, 58.87, 56.93, 56.79, 43.37 (four
carbons), 42.48, 29.32 (two carbons), 25.47 (two carbons), 25.06.
HPLC purity: >95%; tR = 3.02 min. MS (ESI): 388 [M + H]+.
N1-(6,7-Dimethoxy-2-(pyrrolidin-1-yl)quinazolin-4-yl)-N5,N5-
diethylpentane-1,5-diamine (7). N1-(2-Chloro-6,7-dimethoxyqui-
nazolin-4-yl)-N5,N5-diethylpentane-1,5-diamine was prepared accord-
ing to the procedure for making 24 from 2,4-dichloro-6,7-
dimethoxylquinazoline, 5-(diethylamino)pentylamine (commercially
available), N,N-diisopropylethylamine, and THF. Compound 7 was
prepared according to the procedure for making 1 from N1-(2-chloro-
6,7-dimethoxyquinazolin-4-yl)-N5,N5-diethylpentane-1,5-diamine (62
mg, 0.16 mmol), pyrrolidine (54 μL, 0.64 mmol), N,N-diisopropyle-
thylamine (113 μL, 0.64 mmol), and n-butanol (0.2 mL). The title
compound 7 was obtained as a TFA salt, amber solid (79 mg, yield
1
white solid (56 mg, yield 73%). H NMR (400 MHz, MeOH-d4) δ
7.50 (s, 1H), 7.12 (s, 1H), 4.06 (t, J = 6.0 Hz, 2H), 3.96 (s, 3H), 3.92
(s, 3H), 3.82−3.71 (m, 4H), 3.68−3.56 (m, 4H), 3.22−3.10 (m, 2H),
2.22−1.99 (m, 8H). HPLC purity: >95%; tR = 2.88 min. MS (ESI):
372 [M + H]+.
6,7-Dimethoxy-2-(pyrrolidin-1-yl)-N-(3-(pyrrolidin-1-yl)-
propyl)quinazolin-4-amine (3). 2-Chloro-6,7-dimethoxy-N-(3-
(pyrrolidin-1-yl)propyl)quinazolin-4-amine was prepared according
to the procedure for making 24 from 2,4-dichloro-6,7-dimethox-
ylquinazoline, 1-(3-aminopropyl)pyrrolidine (commercially available),
N,N-diisopropylethylamine, and THF. Compound 3 was prepared
according to the procedure for making 2 from 2-chloro-6,7-dimethoxy-
N-(3-(pyrrolidin-1-yl)propyl)quinazolin-4-amine (66 mg, 0.19 mmol),
pyrrolidine (30 μL, 0.37 mmol), HCl in dioxane (4.0 M, 93 μL, 0.37
mmol), and isopropanol (1.0 mL). The title compound 3 was obtained
1
1
as a TFA salt, brown solid (45 mg, yield 40%). H NMR (400 MHz,
76%). H NMR (400 MHz, MeOH-d4) δ 7.53 (s, 1H), 7.07 (s, 1H),
MeOH-d4) δ 7.53 (s, 1H), 7.10 (s, 1H), 3.95 (s, 3H), 3.91 (s, 3H),
3.83−3.60 (m, 8H), 3.35−3.28 (m, 2H), 3.13−3.02 (m, 2H), 2.25−
2.00 (m, 10H); 13C NMR (100 MHz, MeOH-d4) δ 160.68, 157.34,
151.49, 148.83, 137.08, 105.03, 103.57, 99.57, 56.91, 56.82, 55.11 (four
carbons), 53.95, 39.75, 26.51, 23.96 (four carbons). HPLC purity:
>95%; tR = 3.24 min. MS (ESI): 386 [M + H]+.
6,7-Dimethoxy-2-(pyrrolidin-1-yl)-N-(4-(pyrrolidin-1-yl)-
butyl)quinazolin-4-amine (4). 2-Chloro-6,7-dimethoxy-N-(4-(pyr-
rolidin-1-yl)butyl)quinazolin-4-amine was prepared according to the
procedure for making 24 from 2,4-dichloro-6,7-dimethoxylquinazoline,
1-pyrrolidinebutanamine (commercially available), N,N-diisopropyle-
thylamine, and THF. Compound 4 was prepared according to the
procedure for making 1 from 2-chloro-6,7-dimethoxy-N-(4-(pyrroli-
din-1-yl)butyl)quinazolin-4-amine (109 mg, 0.30 mmol), pyrrolidine
(99 μL, 1.2 mmol), N,N-diisopropylethylamine (105 μL, 0.60 mmol),
and n-butanol (1.0 mL). The title compound 4 was obtained as a TFA
salt, white solid (144 mg, yield 77%). 1H NMR (400 MHz, MeOH-d4)
δ 7.54 (s, 1H), 7.09 (s, 1H), 3.94 (s, 3H), 3.91 (s, 3H), 3.79−3.54 (m,
8H), 3.28−3.19 (m, 2H), 3.12−3.01 (m, 2H), 2.19−1.97 (m, 8H),
1.89−1.79 (m, 4H). HPLC purity: >95%; tR = 3.02 min. MS (ESI):
400 [M + H]+.
3.93 (s, 3H), 3.90 (s, 3H), 3.77−3.54 (m, 6H), 3.22 (q, J = 7.4 Hz,
4H), 3.16−3.09 (m, 2H), 2.21−2.01 (m, 4H), 1.87−1.72 (m, 4H),
1.57−1.45 (m, 2H), 1.30 (t, J = 7.3 Hz, 6H). HPLC purity: >95%; tR =
3.54 min. MS (ESI): 416 [M + H]+.
tert-Butyl 4-(5-((6,7-Dimethoxy-2-(pyrrolidin-1-yl)-
quinazolin-4-yl)amino)pentyl)piperazine-1-carboxylate (8).
tert-Butyl 4-(5-((2-chloro-6,7-dimethoxyquinazolin-4-yl)amino)-
pentyl)piperazine-1-carboxylate was prepared according to the
procedure for making 24 from 2,4-dichloro-6,7-dimethoxylquinazoline,
tert-butyl 4-(5-aminopentyl)piperazine-1-carboxylate (commercially
available), N,N-diisopropylethylamine, and THF. Compound 8 was
prepared according to the procedure for making 1 from tert-butyl 4-(5-
((2-chloro-6,7-dimethoxyquinazolin-4-yl)amino)pentyl)piperazine-1-
carboxylate (200 mg, 0.40 mmol), pyrrolidine (135 μL, 1.6 mmol),
N,N-diisopropylethylamine (280 μL, 1.6 mmol), and n-butanol (0.5
mL). The title compound 8 was obtained as a TFA salt, yellow solid
(180 mg, yield 60%). 1H NMR (400 MHz, MeOH-d4) δ 7.54 (s, 1H),
7.09 (s, 1H), 4.33−4.08 (m, 2H), 3.95 (s, 3H), 3.91 (s, 3H), 3.77−
3.50 (m, 8H), 3.29−3.12 (m, 4H), 3.10−2.90 (m, 2H), 2.21−2.01 (m,
4H), 1.87−1.77 (m, 4H), 1.55−1.49 (m, 2H), 1.47 (s, 9H). HPLC
purity: >95%; tR = 3.98 min. MS (ESI): 529 [M + H]+.
6,7-Dimethoxy-N-(5-(piperidin-1-yl)pentyl)-2-(pyrrolidin-1-
yl)quinazolin-4-amine (5). 2-Chloro-6,7-dimethoxy-N-(5-(piperi-
din-1-yl)pentyl)quinazolin-4-amine was prepared according to the
procedure for making 24 from 2,4-dichloro-6,7-dimethoxylquinazoline,
6,7-Dimethoxy-N-(5-(piperazin-1-yl)pentyl)-2-(pyrrolidin-1-
yl)quinazolin-4-amine (9). To the solution of tert-butyl 4-(5-((6,7-
dimethoxy-2-(pyrrolidin-1-yl)quinazolin-4-yl)amino)pentyl)-
piperazine-1-carboxylate (8) in MeOH and THF was added TFA at
6827
dx.doi.org/10.1021/jm500871s | J. Med. Chem. 2014, 57, 6822−6833

Journal of Medicinal Chemistry
Article
room temperature and stirred overnight at 50 °C. LC−MS indicated
the completion of the reaction. After removal of the solvent by rotary
evaporation, the residue was purified by HPLC to give 14 mg of the
pound 13 was prepared according to the procedure for making 1 from
5-((2-chloro-6,7-dimethoxyquinazolin-4-yl)amino)-1-(pyrrolidin-1-yl)-
pentan-1-one (87 mg, 0.22 mmol), pyrrolidine (74 μL, 0.88 mmol),
N,N-diisopropylethylamine (154 μL, 0.88 mmol), and n-butanol (0.25
mL). The title compound 13 was obtained as a TFA salt, brown solid
1
title compound 9 as a TFA salt, white solid (14 mg, yield 80%). H
NMR (400 MHz, MeOH-d4) δ 7.56 (s, 1H), 7.11 (s, 1H), 3.96 (s,
3H), 3.92 (s, 3H), 3.82−3.49 (m, 14H), 3.23−3.17 (m, 2H), 2.21−
2.02 (m, 4H), 1.87−1.78 (m, 4H), 1.56−1.47 (m, 2H). HPLC purity:
95%; tR = 3.50 min. MS (ESI): 429 [M + H]+.
1
(16 mg, yield 13%). H NMR (400 MHz, MeOH-d4) δ 7.57 (s, 1H),
7.09 (s, 1H), 3.96 (s, 3H), 3.93 (s, 3H), 3.80−3.59 (m, 6H), 3.48 (t, J
= 6.8 Hz, 2H), 3.40 (t, J = 6.9 Hz, 2H), 2.41 (t, J = 7.0 Hz, 2H), 2.20−
2.03 (m, 4H), 2.01−1.93 (m, 2H), 1.91−1.84 (m, 2H), 1.83−1.71 (m,
4H). HPLC purity: >95%; tR = 4.58 min. MS (ESI): 428 [M + H]+.
6,7-Dimethoxy-N-methyl-2-(pyrrolidin-1-yl)-N-(5-(pyrroli-
din-1-yl)pentyl)quinazolin-4-amine (14). 2-Chloro-6,7-dime-
thoxy-N-methyl-N-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine was
prepared according to the procedure for making 24 from 2,4-
dichloro-6,7-dimethoxylquinazoline, N-methyl-5-(pyrrolidin-1-yl)-
pentan-1-amine (synthesized according to the precedures preported
previously),51 N,N-diisopropylethylamine, and THF. Compound 14
was prepared according to the procedure for making 2 from 2-chloro-
6,7-dimethoxy-N-methyl-N-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-
amine (50 mg, 0.13 mmol), pyrrolidine (21 μL, 0.26 mmol), HCl in
dioxane (4.0 M, 65 μL, 0.26 mmol), and isopropanol (0.7 mL). The
title compound 14 was obtained as a TFA salt, white solid (25 mg,
6,7-Dimethoxy-N-(5-(4-methylpiperazin-1-yl)pentyl)-2-(pyr-
rolidin-1-yl)quinazolin-4-amine (10). To the solution of 6,7-
dimethoxy-N-(5-(piperazin-1-yl)pentyl)-2-(pyrrolidin-1-yl)quinazolin-
4-amine (9, 80 mg, 0.12 mmol) in MeOH (1.0 mL) were added
formaldehyde (commercially available, 39 μL, 1.4 mmol), acetic acid
(80 μL, 1.4 mmol), and sodium cyanoborohydride (44 mg, 0.7 mmol)
at 0 °C. The resulting mixture was warmed to room temperature and
stirred overnight. LC−MS indicated the completion of the reaction.
After removal of the solvent by rotary evaporation, the residue was
purified by HPLC to give the title compound 10 as a TFA salt, gray
1
solid (25 mg, yield 31%). H NMR (400 MHz, MeOH-d4) δ 7.56 (s,
1H), 7.10 (s, 1H), 3.96 (s, 3H), 3.92 (s, 3H), 3.81−3.53 (m, 14H),
3.26−3.19 (m, 2H), 2.97 (s, 3H), 2.22−2.02 (m, 4H), 1.88−1.77 (m,
4H), 1.56−1.46 (m, 2H). HPLC purity: >95%; tR = 3.59 min. MS
(ESI): 443 [M + H]+.
1
yield 30%). H NMR (400 MHz, MeOH-d4) δ 7.47 (s, 1H), 7.17 (s,
N-(5-(4-Ethylpiperazin-1-yl)pentyl)-6,7-dimethoxy-2-(pyrro-
lidin-1-yl)quinazolin-4-amine (11). Compound 11 was prepared
according to the procedure for making 10 from 6,7-dimethoxy-N-(5-
(piperazin-1-yl)pentyl)-2-(pyrrolidin-1-yl)quinazolin-4-amine (9, 80
mg, 0.12 mmol), acetaldehyde (commercially available, 56 μL, 1.4
mmol), acetic acid (80 μL, 1.4 mmol) and sodium cyanoborohydride
(44 mg, 0.7 mmol) and MeOH (1.0 mL). The title compound 11 was
1H), 3.97 (s, 3H), 3.91 (s, 3H), 3.90−3.85 (m, 2H), 3.75−3.60 (m,
6H), 3.57 (s, 3H), 3.24−3.17 (m, 2H), 3.11−3.01 (m, 2H), 2.22−2.06
(m, 6H), 2.05−1.97 (m, 2H), 1.96−1.87 (m, 2H), 1.86−1.77 (m, 2H),
1.55−1.45 (m, 2H); 13C NMR (100 MHz, MeOH-d4) δ 162.30,
157.06, 150.22, 147.38, 139.69, 109.50, 104.02, 99.83, 56.97, 56.79,
56.04 (two carbons), 55.09 (two carbons), 54.45 (two carbons), 41.10,
27.43, 26.91 (two carbons), 25.08 (two carbons), 23.97 (two carbons).
HPLC purity: >95%; tR = 3.28 min. MS (ESI): 428 [M + H]+.
6,7-Dimethoxy-2-(piperidin-1-yl)-N-(5-(pyrrolidin-1-yl)-
pentyl)quinazolin-4-amine (15). Compound 15 was prepared
according to the procedure for making 2 from 2-chloro-6,7-
dimethoxy-N-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine (24, 70
mg, 0.19 mmol), piperidine (commercially available, 37 μL, 0.38
mmol), HCl in dioxane (4.0 M, 95 μL, 0.38 mmol), and isopropanol
(1.0 mL). The title compound 15 was obtained as a TFA salt, light
1
obtained as a TFA salt, gray solid (74 mg, yield 90%). H NMR (400
MHz, MeOH-d4) δ 7.55 (s, 1H), 7.10 (s, 1H), 3.95 (s, 3H), 3.92 (s,
3H), 3.81−3.55 (m, 14H), 3.35−3.26 (m, 2H), 3.26−3.20 (m, 2H),
2.18−2.02 (m, 4H), 1.88−1.78 (m, 4H), 1.56−1.48 (m, 2H), 1.37 (t, J
= 7.3 Hz, 3H). HPLC purity: >95%; tR = 3.60 min. MS (ESI): 457 [M
+ H]+.
N-(5-(4-Isopropylpiperazin-1-yl)pentyl)-6,7-dimethoxy-2-
(pyrrolidin-1-yl)quinazolin-4-amine (12). Compound 12 was
prepared according to the procedure for making 10 from 6,7-
dimethoxy-N-(5-(piperazin-1-yl)pentyl)-2-(pyrrolidin-1-yl)quinazolin-
4-amine (9, 80 mg, 0.12 mmol), acetone (commercially available, 103
μL, 1.4 mmol), acetic acid (80 μL, 1.4 mmol) and sodium
cyanoborohydride (44 mg, 0.7 mmol) and MeOH (1.0 mL). The
title compound 12 was obtained as a TFA salt, brown solid (61 mg,
1
yellow solid (101 mg, yield 83%). H NMR (400 MHz, MeOH-d4) δ
7.54 (s, 1H), 7.09 (s, 1H), 3.94 (s, 3H), 3.91 (s, 3H), 3.88−3.82 (m,
4H), 3.69−3.61 (m, 4H), 3.22−3.16 (m, 2H), 3.10−3.01 (m, 2H),
2.20−2.08 (m, 2H), 2.07−1.96 (m, 2H), 1.85−1.69 (m, 10H), 1.55−
1.46 (m, 2H); 13C NMR (100 MHz, MeOH-d4) δ 160.55, 157.21,
152.43, 149.01, 137.00, 104.87, 103.58, 99.79, 56.90, 56.81, 56.08,
55.06 (two carbons), 47.16 (two carbons), 42.56, 29.29, 26.87, 26.69
(two carbons), 25.19, 25.13, 23.95 (two carbons). HPLC purity:
>95%; tR = 3.22 min. MS (ESI): 428 [M + H]+.
1
yield 73%). H NMR (400 MHz, MeOH-d4) δ 7.56 (s, 1H), 7.10 (s,
1H), 3.96 (s, 3H), 3.92 (s, 3H), 3.82−3.48 (m, 15H), 3.24−3.18 (m,
2H), 2.20−2.03 (m, 4H), 1.88−1.78 (m, 4H), 1.56−1.47 (m, 2H),
1.40 (s, 3H), 1.38 (s, 3H). HPLC purity: >95%; tR = 3.61 min. MS
(ESI): 471 [M + H]+.
2-(Azepan-1-yl)-6,7-dimethoxy-N-(5-(pyrrolidin-1-yl)pentyl)-
quinazolin-4-amine (16). Compound 16 was prepared according to
the procedure for making 2 from 2-chloro-6,7-dimethoxy-N-(5-
(pyrrolidin-1-yl)pentyl)quinazolin-4-amine (24, 70 mg, 0.19 mmol),
hexamethyleneimine (commercially available, 42 μL, 0.38 mmol), HCl
in dioxane (4.0 M, 95 μL, 0.38 mmol), and isopropanol (1.0 mL). The
title compound 16 was obtained as a TFA salt, light yellow solid (35
mg, yield 28%). 1H NMR (400 MHz, MeOH-d4) δ 7.56 (s, 1H), 7.18
(s, 1H), 3.95 (s, 3H), 3.92 (s, 3H), 3.90−3.70 (m, 4H), 3.70−3.61 (m,
4H), 3.22−3.16 (m, 2H), 3.10−3.01 (m, 2H), 2.19−2.08 (m, 2H),
2.07−1.97 (m, 2H), 1.95−1.86 (m, 4H), 1.85−1.75 (m, 4H), 1.69−
1.61 (m, 4H), 1.56−1.47 (m, 2H); 13C NMR (100 MHz, MeOH-d4) δ
160.40, 157.23, 152.91, 148.99, 137.10, 104.89, 103.68, 99.85, 56.91,
56.80, 56.10, 55.09 (two carbons), 49.16 (two carbons), 42.59, 29.47,
28.58 (three carbons), 27.85, 26.91, 25.23, 23.95 (two carbons).
HPLC purity: >95%; tR = 3.67 min. MS (ESI): 442 [M + H]+.
6,7-Dimethoxy-N2,N2-dimethyl-N4-(5-(pyrrolidin-1-yl)-
pentyl)quinazoline-2,4-diamine (17). To a solution of Pd(OAc)2
(2 mg, 0.01 mmol), (+)-BINAP (6 mg, 0.01 mmol), and THF (0.5
mL) were added 2-chloro-6,7-dimethoxy-N-(5-(pyrrolidin-1-yl)-
pentyl)quinazolin-4-amine (24, 46 mg, 0.10 mmol), dimethylamine
hydrochloride (commercially available, 10 mg, 0.12 mmol), and
Cs2CO3 (73 mg, 0.24 mmol). The resulting solution was stirred inside
5-((6,7-Dimethoxy-2-(pyrrolidin-1-yl)quinazolin-4-yl)-
amino)-1-(pyrrolidin-1-yl)pentan-1-one (13). 5-((tert-
Butoxycarbonyl)amino)pentanoic acid (commercially available, 0.93
g, 4.3 mmol) and pyrrolidine (238 μL, 2.9 mmol) were dissolved in 23
mL of DMF. To this solution were added N,N-diisopropylethylamine
(2.5 mL, 14.5 mmol) and HATU (2.18 g, 5.8 mmol). The resulting
solution was stirred at 50 °C for 3 h. After the mixture was cooled,
TLC indicated the completion of the reaction. After removal of the
solvent by rotary evaporation, the residue was redissolved in CH2Cl2,
washed with brine. The organic layer was dried, concentrated, and
purified by ISCO to give tert-butyl (5-oxo-5-(pyrrolidin-1-yl)pentyl)-
carbamate. To the solution of tert-butyl (5-oxo-5-(pyrrolidin-1-
yl)pentyl)carbamate in MeOH and THF was added TFA at room
temperature and stirred overnight at room temperature. LC−MS
indicated the completion of the reaction. After removal of the solvent
by rotary evaporation, the product 5-amino-1-(pyrrolidin-1-yl)pentan-
1-one obtained was used for the next step without further purification.
5-((2-Chloro-6,7-dimethoxyquinazolin-4-yl)amino)-1-(pyrrolidin-1-
yl)pentan-1-one was prepared according to the procedure for making
24 from 2,4-dichloro-6,7-dimethoxylquinazoline, 5-amino-1-(pyrroli-
din-1-yl)pentan-1-one, N,N-diisopropylethylamine, and THF. Com-
6828
dx.doi.org/10.1021/jm500871s | J. Med. Chem. 2014, 57, 6822−6833

Journal of Medicinal Chemistry
Article
a microwave at 140 °C for 30 min. After the mixture was cooled, TLC
indicated the completion of the reaction. After removal of the solvent
by rotary evaporation, the residue was redissolved in CH2Cl2, washed
with brine. The organic layer was dried, concentrated, and purified by
HPLC to give 7.0 mg of the title compound 17 as a TFA salt, white
2H), 3.14 (s, 3H), 3.10−3.01 (m, 2H), 2.21−2.08 (m, 2H), 2.07−1.98
(m, 2H), 1.97−1.90 (m, 2H), 1.86−1.75 (m, 6H), 1.71−1.60 (m, 2H),
1.56−1.42 (m, 4H), 1.40−1.17 (m, 2H); 13C NMR (100 MHz,
MeOH-d4) δ 160.35, 157.24, 153.14, 149.04, 137.14, 104.89, 103.79,
99.93, 57.59, 56.91, 56.80, 56.08, 55.09 (three carbons), 42.68, 30.85
(two carbons), 30.09, 29.40, 26.93 (two carbons), 26.38, 25.34, 23.95
(two carbons). HPLC purity: >95%; tR = 3.54 min. MS (ESI): 456 [M
+ H]+.
1
solid (yield 13%). H NMR (400 MHz, MeOH-d4) δ 7.57 (s, 1H),
7.15 (s, 1H), 3.97 (s, 3H), 3.92 (s, 3H), 3.71 (t, J = 7.1 Hz, 2H), 3.68−
3.60 (m, 2H), 3.31 (s, 6H), 3.23−3.16 (m, 2H), 3.10−3.01 (m, 2H),
2.21−2.09 (m, 2H), 2.07−1.96 (m, 2H), 1.87−1.75 (m, 4H), 1.56−
1.48 (m, 2H); 13C NMR (100 MHz, MeOH-d4) δ 160.39, 157.35,
153.70, 149.10, 137.07, 104.92, 103.55, 99.79, 56.93, 56.82, 56.13,
55.14 (two carbons), 42.57 (two carbons), 37.96, 29.36, 26.92, 25.23,
23.96 (two carbons). HPLC purity: >95%; tR = 3.04 min. MS (ESI):
388 [M + H]+.
6,7-Dimethoxy-2-(piperazin-1-yl)-N-(5-(pyrrolidin-1-yl)-
pentyl)quinazolin-4-amine (18). Boc-protected compound 18 was
prepared according to the procedure for making 1 from 2-chloro-6,7-
dimethoxy-N-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine (24, 56
mg, 0.11 mmol), 1-Boc-piperazine (commercially available, 82 mg,
0.44 mmol), N,N-diisopropylethylamine (57 μL, 0.33 mmol), and n-
butanol (0.7 mL). To the resulting mixture was added TFA, and the
mixture was stirred overnight at room temperature. LC−MS indicated
the completion of the reaction. After removal of the solvent by rotary
evaporation, the residue was purified by HPLC to give 40 mg of the
title compound 18 as a TFA salt, white solid (yield 55%, two steps).
1H NMR (400 MHz, MeOH-d4) δ 7.62 (s, 1H), 7.16 (s, 1H), 4.22−
N2-Cyclopentyl-6,7-dimethoxy-N4-(5-(pyrrolidin-1-yl)-
pentyl)quinazoline-2,4-diamine (22). Compound 22 was prepared
according to the procedure for making 1 from 2-chloro-6,7-dimethoxy-
N-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine (24, 56 mg, 0.11
mmol), cyclopentylamine (commercially available, 44 μL, 0.44
mmol), N,N-diisopropylethylamine (57 μL, 0.33 mmol), and n-
butanol (0.7 mL). The title compound 22 was obtained as a TFA salt,
light yellow solid (41 mg, yield 57%). 1H NMR (400 MHz, MeOH-d4)
δ 7.52 (s, 1H), 6.95 (s, 1H), 4.41−4.28 (m, 1H), 3.95 (s, 3H), 3.90 (s,
3H), 3.73−3.60 (m, 4H), 3.23−3.16 (m, 2H), 3.10−2.99 (m, 2H),
2.20−1.98 (m, 6H), 1.88−1.75 (m, 6H), 1.73−1.60 (m, 4H), 1.56−
1.46 (m, 2H). HPLC purity: >95%; tR = 3.58 min. MS (ESI): 428 [M
+ H]+.
N2-Cyclohexyl-6,7-dimethoxy-N4-(5-(pyrrolidin-1-yl)pentyl)-
quinazoline-2,4-diamine (23). Compound 23 was prepared
according to the procedure for making 1 from 2-chloro-6,7-
dimethoxy-N-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine (24, 56
mg, 0.11 mmol), N-cyclohexylamine (commercially available, 50 μL,
0.44 mmol), N,N-diisopropylethylamine (57 μL, 0.33 mmol), and n-
butanol (0.7 mL). The title compound 23 was obtained as a TFA salt,
brown semisolid (45 mg, yield 61%). 1H NMR (400 MHz, MeOH-d4)
δ 7.50 (s, 1H), 6.91 (s, 1H), 4.00−3.85 (m, 1H), 3.94 (s, 3H), 3.89 (s,
3H), 3.70−3.61 (m, 4H), 3.23−3.15 (m, 2H), 3.10−3.01 (m, 2H),
2.19−2.10 (m, 2H), 2.06−1.99 (m, 3H), 1.88−1.75 (m, 7H), 1.54−
1.28 (m, 8H). HPLC purity: >95%; tR = 3.69 min. MS (ESI): 442 [M
+ H]+.
4.14 (m, 4H), 3.96 (s, 3H), 3.93 (s, 3H), 3.71 (t, J = 7.0 Hz, 2H),
3.69−3.61 (m, 2H), 3.48−3.38 (m, 4H), 3.23−3.16 (m, 2H), 3.11−
3.01 (m, 2H), 2.20−2.09 (m, 2H), 2.07−1.96 (m, 2H), 1.86−1.73 (m,
4H), 1.57−1.48 (m, 2H). HPLC purity: >95%; tR = 1.76 min. MS
(ESI): 429 [M + H]+.
6,7-Dimethoxy-2-(4-methylpiperazin-1-yl)-N-(5-(pyrrolidin-
1-yl)pentyl)quinazolin-4-amine (19). Compound 19 was prepared
according to the procedure for making 1 from 2-chloro-6,7-dimethoxy-
N-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine (24, 56 mg, 0.11
mmol), 1-methylpiperazine (commercially available, 49 μL, 0.44
mmol), N,N-diisopropylethylamine (57 μL, 0.33 mmol), and n-
butanol (0.7 mL). The title compound 19 was obtained as a TFA salt,
gray solid (54 mg, yield 73%). 1H NMR (400 MHz, MeOH-d4) δ 7.62
(s, 1H), 7.16 (s, 1H), 3.96 (s, 3H), 3.93 (s, 3H), 3.90−3.24 (m, 12H),
3.22−3.16 (m, 2H), 3.10−3.02 (m, 2H), 2.99 (s, 3H), 2.19−2.10 (m,
2H), 2.07−1.96 (m, 2H), 1.86−1.75 (m, 4H), 1.56−1.47 (m, 2H).
HPLC purity: >95%; tR = 0.55 min. MS (ESI): 443 [M + H]+.
N2-Cyclopentyl-6,7-dimethoxy-N2-methyl-N4-(5-(pyrrolidin-
1-yl)pentyl)quinazoline-2,4-diamine (20). Compound 20 was
prepared according to the procedure for making 1 from 2-chloro-
6,7-dimethoxy-N-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine (24,
56 mg, 0.11 mmol), N-methylcyclopentanamine (commercially
available, 44 mg, 0.44 mmol), N,N-diisopropylethylamine (57 μL,
0.33 mmol), and n-butanol (0.7 mL). The title compound 20 was
2-Chloro-6,7-dimethoxy-N-(5-(pyrrolidin-1-yl)pentyl)-
quinazolin-4-amine (24). To the solution of 2,4-dichloro-6,7-
dimethoxyquinazoline (commercially available, 1.00 g, 3.86 mmol) in
THF (9.5 mL) was added 5-(pyrrolidin-1-yl)pentan-1-amine (com-
mercially available, 1.33 g, 8.49 mmol), followed by the addition of
N,N-diisopropylethylamine (612 μL, 3.51 mmol). And the resulting
mixture was stirred at room temperature for 6 h until TLC showed
that the starting material had disappeared. Water was added to the
reaction mixture, and the resulting solution was extracted with ethyl
acetate. The organic layer was washed with brine, dried, and
concentrated to give the crude product, which was purified on
ISCO using 24 g silica gel column, eluting with hexane−ethyl acetate
to give 754 mg of the title compound 24 as a yellow semisolid (yield
1
52%). H NMR (400 MHz, MeOH-d4) δ 7.61 (s, 1H), 6.99 (s, 1H),
3.98 (s, 3H), 3.96 (s, 3H), 3.73 (t, J = 7.2 Hz, 2H), 3.69−3.61 (m,
2H), 3.24−3.16 (m, 2H), 3.11−3.01 (m, 2H), 2.20−2.09 (m, 2H),
2.07−1.96 (m, 2H), 1.87−1.76 (m, 4H), 1.57−1.47 (m, 2H); 13C
NMR (100 MHz, MeOH-d4) δ 161.38, 157.90, 152.68, 151.65, 141.15,
107.16, 103.64, 102.16, 57.02, 56.99, 56.08, 55.12 (two carbons),
42.73, 29.27, 26.64, 24.82, 23.95 (two carbons). HPLC purity: >95%;
tR = 3.60 min. MS (ESI): 379 [M + H]+.
Radioactive Assay (Also Known as Scintillation Proximity
Assay). SETD8 catalytic domain was expressed in E. coli and purified
as reported.52 Radioactive assay was developed to screen our chemical
library for small molecule inhibitors. Methylation (10 μL) reactions
were carried out in a buffer containing 50 mM Tris-HCl (pH 8.0), 10
mM GSH, 0.1%Triton X-100, at room temperature using 50 nM
SETD8, 1.5 μM tritium labeled SAM (catalog no. NET155V250UC,
PerkinElmer), and 5 μM biotinylated H4 (1−24) peptide substrate
(SGRGKGGKGLGKGGAKRHRKVLRDK-biotin) in 384-well plates
in the presence of 50 μM compounds. The reactions were then
quenched by addition of equal volume of 7.5 M guanidine
hydrochloride after a 1 h incubation. Then 40 μL of buffer (20 mM
Tris-HCl, pH 8.0) was added into the quenched samples, and all
samples were then transferred into a streptavidin/scintillant-coated
microplate (catalog no. SMP410, PerkinElmer). The amount of
1
obtained as a TFA salt, yellow solid (40 mg, yield 54%). H NMR
(400 MHz, MeOH-d4) δ 7.57 (s, 1H), 7.18 (s, 1H), 5.15−5.01 (m,
1H), 3.96 (s, 3H), 3.92 (s, 3H), 3.72−3.61 (m, 4H), 3.23−3.16 (m,
2H), 3.14 (s, 3H), 3.10−3.01 (m, 2H), 2.19−2.10 (m, 2H), 2.05−1.93
(m, 4H), 1.89−1.68 (m, 10H), 1.56−1.47 (m, 2H); 13C NMR (100
MHz, MeOH-d4) δ 160.35, 157.29, 153.54, 149.07, 137.09, 104.90,
103.75, 99.90, 58.92, 56.92, 56.80, 56.10, 55.10 (three carbons), 42.62,
30.41, 29.65 (two carbons), 29.39, 26.93, 25.28, 25.25, 23.95 (two
carbons). HPLC purity: >95%; tR = 3.83 min. MS (ESI): 442 [M +
H]+.
N2-Cyclohexyl-6,7-dimethoxy-N2-methyl-N4-(5-(pyrrolidin-1-
yl)pentyl)quinazoline-2,4-diamine (21). Compound 21 was
prepared according to the procedure for making 1 from 2-chloro-
6,7-dimethoxy-N-(5-(pyrrolidin-1-yl)pentyl)quinazolin-4-amine (24,
56 mg, 0.11 mmol), N-methylcyclohexylamine (commercially
available, 44 mg, 0.44 mmol), N,N-diisopropylethylamine (57 μL,
0.33 mmol), and n-butanol (0.7 mL). The title compound 21 was
1
obtained as a TFA salt, brown solid (47 mg, yield 62%). H NMR
(400 MHz, MeOH-d4) δ 7.56 (s, 1H), 7.18 (s, 1H), 4.65−4.49 (m,
1H), 3.95 (s, 3H), 3.92 (s, 3H), 3.71−3.61 (m, 4H), 3.23−3.16 (m,
6829
dx.doi.org/10.1021/jm500871s | J. Med. Chem. 2014, 57, 6822−6833

Journal of Medicinal Chemistry
Article
methylated peptide was quantified by tracing the radioactivity (counts
per minute) as measured after 1 h using a TopCount plate reader
(PerkinElmer). For IC50 values determination, the compounds were
serially diluted 2-fold in DMSO for a total of 11 concentrations,
beginning at 0.25 mM and tested in the same condition.
Microfluidic Capillary Electrophoresis Assay. Inhibition of
SETD8 methyltransferase activity was analyzed by monitoring
decrease in methylation of the fluorescein labeled peptide, TW21
(NH2-LGKGGAKRHRKVLRDNIQGITK(5Fam)-OH), essentially as
described previously.50
MOA Studies. IC50 values were determined for compound 1 at
varying concentrations of SAM, 50 nM SETD8, 200 μM peptide H4
(1−24) or at varying concentrations of substrate H4 (1−24) peptide,
50 nM of SETD8, 250 μM SAM. The reaction mixtures were
incubated 15 min at 23 °C. To stop the enzymatic reactions, an equal
volume of 7.5 M guanidine hydrochloride was added and mixed. Then
10 μL of mixture was spotted onto a square of SAM2 biotin capture
membrane (catalog no. V2861, Promega), allowed absorption for 5
min at room temperature, washed with 2 M of NaCl solution several
times followed by two deionized water wash, and dried, and
scintillation liquid was added and CPM (counts per minute) were
read using the scintillation counter.
Peptide Displacement Assay. H4K20me (1−24) peptide
(SGRGKGGKGLGKGGAKRHRKme1VLRD) with N-terminus la-
belled by FITC was ordered from Tufts University Core Services
(Boston, MA). The sample was prepared in a buffer containing 50 mM
Tris-HCl (pH 8.0), 10 mM GSH, 0.01% Triton X-100. 50 nM peptide
was incubated with 20 μM SETD8 protein, 1 mM S-adenosyl-L-
homocysteine (SAH), and different concentrations of compounds.
The final volume was 10 μL with less than 5% DMSO. The FP
measurement was performed in black, 384-well PCR plate (catalog no.
47744-828, VWR), and signal was read with a Synergy H4 microplate
reader (BioTek). The polarization values in millipolarization units
were measured at an excitation wavelength of 485 nm and an emission
wavelength of 528 nm.
The test compounds were solubilized in 100% DMSO to 10 mM
and then plated in Greiner 384-well polypropylene plates using 3-fold
dilution scheme over 10 points spanning the concentration range from
3 mM to 0.15 μM using TECAN Genesis liquid handler. Then 1 μL of
the serial dilution was transferred into compound dilution plate using
Nanoscreen MultiMek liquid handling robot. Prior to performing the
assay the compounds were diluted 10-fold in 1× assay buffer (20 mM
Tris, pH 8.0, 25 mM NaCl, 2 mM DTT, and 0.05% Tween-20), and
an amount of 2.5 μL of the resulting dilution was transferred into assay
plate by Nanoscreen MultiMek liquid handling robot. To this plate 20
μL of 50 nM SETD8 and 2 μM TW21 peptide cocktail in 1× assay
buffer were added using multidrop liquid dispenser. Following a 10
min incubation of the compounds with the enzyme/peptide mix, the
reaction was initiated by adding 2.5 μL of 150 μM SAM in 1× buffer.
For 100% inhibition controls 1× buffer was added instead of SAM.
The reaction was allowed to proceed at room temperature for 120
min, and then the reaction was terminated by adding 35 μL of 0.08
ng/μL Endo-LysC protease solution. Following an additional 1 h
incubation the plate was read on a Caliper Life Sciences EZ reader II
using upstream voltage −500 V, downstream voltage −1800 V, and
pressure of −1.5 psi. The IC50 values were determined using
Screenable Solutions software.
Isothermal Titration Calorimetry. All ITC measurements were
performed at 25 °C using an AutoITC200 microcalorimeter
(MicroCal/GE Healthcare). The calorimeter cell (volume 200 μL)
was loaded with SETD8 protein in the full salt dialysis buffer (150 mM
NaCl) at a concentration of 100 μM. The syringe was loaded with
compound 1 (dissolved in the same buffer) at a concentration of 1
mM. A typical injection protocol included a single 0.2 μL first injection
followed by 26 1.5 μL injections of the compound into the calorimeter
cell. The spacing between injections was kept at 180 s and the
reference power at 8 μcal/s. A control experiment was performed by
titrating compound 1 into buffer under identical settings to determine
the heat signals that arose from compound dilution; these were
subtracted from the heat signals of protein−compound interaction.
The data were analyzed using Origin for ITC, version 7.0, software
supplied by the manufacturer and fitted well to a one-site binding
model.
Surface Plasmon Resonance. The interaction between com-
pound 1 and protein SETD8 was further explored using a ProteOn
XPR36 biosensor (Bio-Rad Laboratories, Inc.) at 25 °C. PBS buffer
(phosphate buffered saline, pH 7.4) supplemented with 0.005%
Tween-20 was used as the running buffer. A GLH (catalog no. 176-
5013, Bio-Rad Laboratories, Inc.) sensor chip was first activated by
flowing a mixture of 20 mM sulfo-NHS and 20 mM EDC over the
chip surface for 5 min at a flow rate of 30 μL/min. SETD8 was then
diluted to 20 and 10 μg/mL in 5 mM NaOAc, pH 5.0, and
immobilized onto two ligand channels (30 μL/min for 2 min). The
surface was then deactivated by flowing 1 M ethanolamine for 5 min at
a flow rate 60 μL/min. A blank injection of the running buffer was
made, after which four concentrations of the compound in the running
buffer (100, 33.3, 11.1, and 3.7 μM) and a running buffer were injected
simultaneously at a flow rate of 50 μL/min for 60 s. The sensorgrams
obtained at the four concentrations of the compound were fit
simultaneously after subtracting a ligand reference (inner spot) and a
double compound reference (buffer) using a Langmuir model to
obtain on (ka) and off (kd) rates. The kinetic KD was calculated based
on the on and off rates for three replicates. An equilibrium analysis of
the data was also performed to calculate the KD.
Selectivity Assay. Selectivity of compound 1 against a panel of
methyltransferases was assessed as previously reported.24,36,53 In brief,
the effect of compound 1 on activity of G9a, SETDB1, GLP,
SUV39H2, SETD7, PRMT3, PRMT5-MEP50 complex, PRMT1,
SUV420H1, SUV420H2, SMYD2, DNMT1, PRC2 complex, MLL1
complex, and DOT1L was assessed by monitoring the incorporation of
tritium-labeled methyl group to lysine or arginine residues of peptide
substrates using radioactive assay. Assays were performed in a 20 μL
3
reaction mixture containing H-SAM (catalog no. NET155V250UC,
Perkin Elmer) at substrate concentrations close to Km values for each
enzyme. Compound concentrations from 100 nM to 100 μM were
used in all selectivity assays. To stop the enzymatic reactions, 7.5 M
guanidine hydrochloride was added, followed by 180 μL of buffer (20
mM Tris, pH 8.0), mixed, and then transferred to a 96-well FlashPlate
(catalog no. SMP103, PerkinElmer). After mixing, the reaction
mixtures in FlashPlates were incubated for 1 h and the CPM were
measured using TopCount plate reader (PerkinElmer). The CPM in
the absence of compound for each data set were defined as 100%
activity. In the absence of the enzyme, the CPM in each data set were
defined as background (0%). Data were plotted using SigmaPlot
software. For DNMT1 the dsDNA substrate was prepared by
annealing two complementary strands (biotintlated forward strand
B-GAGCCCGTAAGCCCGTTCAGGTCG and reverse strand
CGACCTGAACGGGCTTACGGGCTC), synthesized by Eurofins
MWG Operon. For DOT1L, a filter-based assay was used. In this
assay, 20 μL of reaction mixtures was incubated at room temperature
for 1 h, 100 μL of 10% trichloroacetic acid (TCA) was added, mixed,
and transferred to filter plates (catalog no. MSFBN6B10, Millipore).
Plates were centrifuged at 2000 rpm (Allegra X-15R; Beckman
Coulter, Inc.) for 2 min followed by two additional 10% TCA washes
and one ethanol wash (180 μL) followed by centrifugation. Plates were
dried, and 100 μL of MicroScint-O (catalog no. 6013611,
PerkinElmer) was added to each well, centrifuged, and removed.
Then 70 μL of MicroScint-O was added again, and CPM were
measured using TopCount plate reader.
ASSOCIATED CONTENT
■
S
* Supporting Information
1H and 13C NMR spectra of compound 1. This material is
available free of charge via the Internet at http://pubs.acs.org.
6830
dx.doi.org/10.1021/jm500871s | J. Med. Chem. 2014, 57, 6822−6833

Journal of Medicinal Chemistry
Article
(9) Kubicek, S.; O’Sullivan, R. J.; August, E. M.; Hickey, E. R.; Zhang,
Q.; Teodoro, M. L.; Rea, S.; Mechtler, K.; Kowalski, J. A.; Homon, C.
A.; Kelly, T. A.; Jenuwein, T. Reversal of H3K9me2 by a small-
molecule inhibitor for the G9a histone methyltransferase. Mol. Cell
2007, 25, 473−481.
(10) Liu, F.; Chen, X.; Allali-Hassani, A.; Quinn, A. M.; Wasney, G.
A.; Dong, A.; Barsyte, D.; Kozieradzki, I.; Senisterra, G.; Chau, I.;
Siarheyeva, A.; Kireev, D. B.; Jadhav, A.; Herold, J. M.; Frye, S. V.;
Arrowsmith, C. H.; Brown, P. J.; Simeonov, A.; Vedadi, M.; Jin, J.
Discovery of a 2,4-diamino-7-aminoalkoxyquinazoline as a potent and
selective inhibitor of histone lysine methyltransferase G9a. J. Med.
Chem. 2009, 52, 7950−7953.
AUTHOR INFORMATION
Corresponding Author
*Phone: 919-843-8459. Fax: 919-843-8465. E-mail: jianjin@
unc.edu.
■
Author Contributions
∞A.M. and W.Y. contributed equally to this work.
Notes
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
■
(11) Chang, Y.; Ganesh, T.; Horton, J. R.; Spannhoff, A.; Liu, J.; Sun,
A.; Zhang, X.; Bedford, M. T.; Shinkai, Y.; Snyder, J. P.; Cheng, X.
Adding a lysine mimic in the design of potent inhibitors of histone
lysine methyltransferases. J. Mol. Biol. 2010, 400, 1−7.
We thank Dr. Raymond C. Trievel at University of Michigan
for providing the SETD8 vector, Jacob Stuckey for assisting
with ITC studies, and Catherine Simpson for assisting with
MCE assay studies. The research described here was supported
by Grant R01GM103893 from the National Institute of
General Medical Sciences of the National Institutes of Health,
the University Cancer Research Fund from University of North
Carolina at Chapel Hill, the V Foundation for Cancer Research,
and the Structural Genomics Consortium, a registered charity
(No. 1097737) that receives funds from the Canada
Foundation for Innovation, Eli Lilly Canada, GlaxoSmithKline,
the Ontario Ministry of Economic Development and
Innovation, the Novartis Research Foundation, Pfizer, AbbVie,
Takeda, Janssen, Boehringer Ingelheim, Bayer, and the
Wellcome Trust.
(12) Liu, F.; Chen, X.; Allali-Hassani, A.; Quinn, A. M.; Wigle, T. J.;
Wasney, G. A.; Dong, A.; Senisterra, G.; Chau, I.; Siarheyeva, A.;
Norris, J. L.; Kireev, D. B.; Jadhav, A.; Herold, J. M.; Janzen, W. P.;
Arrowsmith, C. H.; Frye, S. V.; Brown, P. J.; Simeonov, A.; Vedadi, M.;
Jin, J. Protein lysine methyltransferase G9a inhibitors: design,
synthesis, and structure activity relationships of 2,4-diamino-7-
aminoalkoxy-quinazolines. J. Med. Chem. 2010, 53, 5844−5857.
(13) Vedadi, M.; Barsyte-Lovejoy, D.; Liu, F.; Rival-Gervier, S.; Allali-
Hassani, A.; Labrie, V.; Wigle, T. J.; DiMaggio, P. A.; Wasney, G. A.;
Siarheyeva, A.; Dong, A.; Tempel, W.; Wang, S.-C.; Chen, X.; Chau, I.;
Mangano, T.; Huang, X.-P.; Simpson, C. D.; Pattenden, S. G.; Norris,
J. L.; Kireev, D. B.; Tripathy, A.; Edwards, A.; Roth, B. L.; Janzen, W.
P.; Garcia, B. A.; Petronis, A.; Ellis, J.; Brown, P. J.; Frye, S. V.;
Arrowsmith, C. H.; Jin, J. A chemical probe selectively inhibits G9a
and GLP methyltransferase activity in cells. Nat. Chem. Biol. 2011, 7,
566−574.
(14) Liu, F.; Barsyte-Lovejoy, D.; Allali-Hassani, A.; He, Y.; Herold, J.
M.; Chen, X.; Yates, C. M.; Frye, S. V.; Brown, P. J.; Huang, J.; Vedadi,
M.; Arrowsmith, C. H.; Jin, J. Optimization of cellular activity of G9a
inhibitors 7-aminoalkoxy-quinazolines. J. Med. Chem. 2011, 54, 6139−
6150.
(15) Ferguson, A. D.; Larsen, N. A.; Howard, T.; Pollard, H.; Green,
I.; Grande, C.; Cheung, T.; Garcia-Arenas, R.; Cowen, S.; Wu, J.;
Godin, R.; Chen, H.; Keen, N. Structural basis of substrate methylation
and inhibition of SMYD2. Structure 2011, 19, 1262−1273.
(16) Daigle, S. R.; Olhava, E. J.; Therkelsen, C. A.; Majer, C. R.;
Sneeringer, C. J.; Song, J.; Johnston, L. D.; Scott, M. P.; Smith, J. J.;
Xiao, Y.; Jin, L.; Kuntz, K. W.; Chesworth, R.; Moyer, M. P.; Bernt, K.
M.; Tseng, J. C.; Kung, A. L.; Armstrong, S. A.; Copeland, R. A.;
Richon, V. M.; Pollock, R. M. Selective killing of mixed lineage
leukemia cells by a potent small-molecule DOT1L inhibitor. Cancer
Cell 2011, 20, 53−65.
ABBREVIATIONS USED
■
H4K20, histone H4 lysine 20; H4K20me, histone H4 lysine 20
monomethylation; PCNA, proliferating cell nuclear antigen;
MOA, mechanism of action; ITC, isothermal titration
calorimetry; SPR, surface plasmon resonance; SAR, struc-
ture−activity relationship; PKMT, protein lysine methyltrans-
ferase; HKMT, histone lysine methyltransferase; SAM, S-
adenosyl-L-methionine; SET, Su(var), E(z), and Trithorax;
PRMT, protein arginine methyltransferase; KMT5A, lysine
methyltransferase 5A; EMT, epithelial−mesenchymal transi-
tion; p53K382me1, monomethylation of p53 at lysine 382;
PCNA, proliferating cell nuclear antigen; PCNAK248me1,
monomethylation of proliferating cell nuclear antigen at lysine
248; MCE, microfluidic capillary electrophoresis; FP, fluo-
rescence polarization; FITC, fluorescein isothiocyanate; PRC2,
polycomb repressive complex 2
(17) Yao, Y.; Chen, P.; Diao, J.; Cheng, G.; Deng, L.; Anglin, J. L.;
Prasad, B. V. V; Song, Y. Selective inhibitors of histone
methyltransferase DOT1L: design, synthesis and crystallographic
studies. J. Am. Chem. Soc. 2011, No. 133, 16746−16749.
REFERENCES
■
(1) Copeland, R. A.; Solomon, M. E.; Richon, V. M. Protein
methyltransferases as a target class for drug discovery. Nat. Rev. Drug
Discovery 2009, 8, 724−732.
(18) Yuan, Y.; Wang, Q.; Paulk, J.; Kubicek, S.; Kemp, M. M.; Adams,
D. J.; Shamji, A. F.; Wagner, B. K.; Schreiber, S. L. A small-molecule
probe of the histone methyltransferase G9a induces cellular senescence
in pancreatic adenocarcinoma. ACS Chem. Biol. 2012, 7, 1152−1157.
(19) Knutson, S. K.; Wigle, T. J.; Warholic, N. M.; Sneeringer, C. J.;
Allain, C. J.; Klaus, C. R.; Sacks, J. D.; Raimondi, A.; Majer, C. R.;
Song, J.; Scott, M. P.; Jin, L.; Smith, J. J.; Olhava, E. J.; Chesworth, R.;
Moyer, M. P.; Richon, V. M.; Copeland, R. A.; Keilhack, H.; Pollock,
R. M.; Kuntz, K. W. A selective inhibitor of EZH2 blocks H3K27
methylation and kills mutant lymphoma cells. Nat. Chem. Biol. 2012, 8,
890−896.
(20) McCabe, M. T.; Ott, H. M.; Ganji, G.; Korenchuk, S.;
Thompson, C.; Van Aller, G. S.; Liu, Y.; Graves, A. P.; Della Pietra, A.,
III; Diaz, E.; Lafrance, L. V.; Mellinger, M.; Duquenne, C.; Tian, X.;
Kruger, R. G.; McHugh, C. F.; Brandt, M.; Miller, W. H.; Dhanak, D.;
Verma, S. K.; Tummino, P. J.; Creasy, C. L. EZH2 inhibition as a
(2) Arrowsmith, C. H.; Bountra, C.; Fish, P. V.; Lee, K.; Schapira, M.
Epigenetic protein families: a new frontier for drug discovery. Nat. Rev.
Drug Discovery 2012, 11, 384−400.
(3) Helin, K.; Dhanak, D. Chromatin proteins and modifications as
drug targets. Nature 2013, 502, 480−488.
(4) Bernstein, B. E.; Meissner, A.; Lander, E. S. The mammalian
epigenome. Cell 2007, 128, 669−681.
(5) Kouzarides, T. Chromatin modifications and their function. Cell
2007, 128, 693−705.
(6) Martin, C.; Zhang, Y. The diverse functions of histone lysine
methylation. Nat. Rev. Mol. Cell Biol. 2005, 6, 838−849.
(7) Jenuwein, T.; Laible, G.; Dorn, R.; Reuter, G. SET domain
proteins modulate chromatin domains in eu- and heterochromatin.
Cell. Mol. Life Sci. 1998, 54, 80−93.
(8) Xiao, B.; Wilson, J. R.; Gamblin, S. J. SET domains and histone
methylation. Curr. Opin. Struct. Biol. 2003, 13, 699−705.
6831
dx.doi.org/10.1021/jm500871s | J. Med. Chem. 2014, 57, 6822−6833

Journal of Medicinal Chemistry
Article
therapeutic strategy for lymphoma with EZH2-activating mutations.
Nature 2012, 492, 108−112.
potent and selective inhibitors of histone methyltransferase G9a. ACS
Med. Chem. Lett. 2014, 5, 205−209.
(21) Verma, S. K.; Tian, X.; LaFrance, L. V.; Duquenne, C.; Suarez,
D. P.; Newlander, K. A.; Romeril, S. P.; Burgess, J. L.; Grant, S. W.;
Brackley, J. A.; Graves, A. P.; Scherzer, D. A.; Shu, A.; Thompson, C.;
Ott, H. M.; Aller, G. S. V.; Machutta, C. A.; Diaz, E.; Jiang, Y.;
Johnson, N. W.; Knight, S. D.; Kruger, R. G.; McCabe, M. T.; Dhanak,
D.; Tummino, P. J.; Creasy, C. L.; Miller, W. H. Identification of
potent, selective, cell-active inhibitors of the histone lysine
methyltransferase EZH2. ACS Med. Chem. Lett. 2012, 3, 1091−1096.
(32) Garapaty-Rao, S.; Nasveschuk, C.; Gagnon, A.; Chan, E. Y.;
Sandy, P.; Busby, J.; Balasubramanian, S.; Campbell, R.; Zhao, F.;
Bergeron, L.; Audia, J. E.; Albrecht, B. K.; Harmange, J. C.; Cummings,
R.; Trojer, P. Identification of EZH2 and EZH1 small molecule
inhibitors with selective impact on diffuse large B cell lymphoma cell
growth. Chem. Biol. 2013, 20, 1329−1339.
(33) Daigle, S. R.; Olhava, E. J.; Therkelsen, C. A.; Basavapathruni,
A.; Jin, L.; Boriack-Sjodin, P. A.; Allain, C. J.; Klaus, C. R.; Raimondi,
A.; Scott, M. P.; Waters, N. J.; Chesworth, R.; Moyer, M. P.; Copeland,
R. A.; Richon, V. M.; Pollock, R. M. Potent inhibition of DOT1L as
treatment of MLL-fusion leukemia. Blood 2013, 122, 1017−1025.
(34) Nasveschuk, C. G.; Gagnon, A.; Garapaty-Rao, S.;
Balasubramanian, S.; Campbell, R.; Lee, C.; Zhao, F.; Bergeron, L.;
Cummings, R.; Trojer, P.; Audia, J. E.; Albrecht, B. K.; Harmange, J.-C.
P. Discovery and optimization of tetramethylpiperidinyl benzamides as
inhibitors of EZH2. ACS Med. Chem. Lett. 2014, 5, 378−383.
(35) He, Y.; Korboukh, I.; Jin, J.; Huang, J. Targeting protein lysine
methylation and demethylation in cancers. Acta Biochim. Biophys. Sin.
2012, 44, 70−79.
(36) Siarheyeva, A.; Senisterra, G.; Allali-Hassani, A.; Dong, A.;
Dobrovetsky, E.; Wasney, G. A.; Chau, I.; Marcellus, R.; Hajian, T.;
Liu, F.; Korboukh, I.; Smil, D.; Bolshan, Y.; Min, J.; Wu, H.; Zeng, H.;
Loppnau, P.; Poda, G.; Griffin, C.; Aman, A.; Brown, P. J.; Jin, J.; Al-
awar, R.; Arrowsmith, C. H.; Schapira, M.; Vedadi, M. An allosteric
inhibitor of protein arginine methyltransferase 3. Structure 2012, 20,
1425−1435.
(37) Liu, F.; Li, F.; Ma, A.; Dobrovetsky, E.; Dong, A.; Gao, C.;
Korboukh, I.; Liu, J.; Smil, D.; Brown, P. J.; Frye, S. V.; Arrowsmith, C.
H.; Schapira, M.; Vedadi, M.; Jin, J. Exploiting an allosteric binding site
of PRMT3 yields potent and selective inhibitors. J. Med. Chem. 2013,
56, 2110−2124.
(38) Yost, J. M.; Korboukh, I.; Liu, F.; Gao, C.; Jin, J. Targets in
epigenetics: inhibiting the methyl writers of the histone code. Curr.
Chem. Genomics 2011, 5, 72−84.
(39) Lehnertz, B.; Pabst, C.; Su, L.; Miller, M.; Liu, F.; Yi, L.; Zhang,
R.; Krosl, J.; Yung, E.; Kirschner, J.; Rosten, P.; Underhill, T. M.; Jin,
J.; Hebert, J.; Sauvageau, G.; Humphries, R. K.; Rossi, F. M. The
methyltransferase G9a regulates HoxA9-dependent transcription in
AML. Genes Dev. 2014, 28, 317−327.
(40) Chen, X.; Skutt-Kakaria, K.; Davison, J.; Ou, Y. L.; Choi, E.;
Malik, P.; Loeb, K.; Wood, B.; Georges, G.; Torok-Storb, B.; Paddison,
P. J. G9a/GLP-dependent histone H3K9me2 patterning during human
hematopoietic stem cell lineage commitment. Genes Dev. 2012, 26,
2499−2511.
(41) Antignano, F.; Burrows, K.; Hughes, M. R.; Han, J. M.; Kron, K.
J.; Penrod, N. M.; Oudhoff, M. J.; Wang, S. K.; Min, P. H.; Gold, M. J.;
Chenery, A. L.; Braam, M. J.; Fung, T. C.; Rossi, F. M.; McNagny, K.
M.; Arrowsmith, C. H.; Lupien, M.; Levings, M. K.; Zaph, C.
Methyltransferase G9A regulates T cell differentiation during murine
intestinal inflammation. J. Clin. Invest. 2014, 124, 1945−1955.
(42) Konze, K. D.; Pattenden, S. G.; Liu, F.; Barsyte-Lovejoy, D.; Li,
F.; Simon, J. M.; Davis, I. J.; Vedadi, M.; Jin, J. A chemical tool for in
vitro and in vivo precipitation of lysine methyltransferase g9a.
ChemMedChem 2014, 9, 549−553.
́
(22) Zheng, W.; Ibanez, G.; Wu, H.; Blum, G.; Zeng, H.; Dong, A.;
̃
Li, F.; Hajian, T.; Allali-Hassani, A.; Amaya, M. F.; Siarheyeva, A.; Yu,
W.; Brown, P. J.; Schapira, M.; Vedadi, M.; Min, J.; Luo, M. Sinefungin
derivatives as inhibitors and structure probes of protein lysine
methyltransferase SETD2. J. Am. Chem. Soc. 2012, 134, 18004−18014.
(23) Qi, W.; Chan, H.; Teng, L.; Li, L.; Chuai, S.; Zhang, R.; Zeng, J.;
Li, M.; Fan, H.; Lin, Y.; Gu, J.; Ardayfio, O.; Zhang, J.-H.; Yan, X.;
Fang, J.; Mi, Y.; Zhang, M.; Zhou, T.; Feng, G.; Chen, Z.; Li, G.; Yang,
T.; Zhao, K.; Liu, X.; Yu, Z.; Lu, C. X.; Atadja, P.; Li, E. Selective
inhibition of Ezh2 by a small molecule inhibitor blocks tumor cells
proliferation. Proc. Natl. Acad. Sci. U.S.A. 2012, 109, 21360−21365.
(24) Yu, W.; Chory, E. J.; Wernimont, A. K.; Tempel, W.; Scopton,
A.; Federation, A.; Marineau, J. J.; Qi, J.; Barsyte-Lovejoy, D.; Yi, J.;
Marcellus, R.; Iacob, R. E.; Engen, J. R.; Griffin, C.; Aman, A.;
Wienholds, E.; Li, F.; Pineda, J.; Estiu, G.; Shatseva, T.; Hajian, T.; Al-
awar, R.; Dick, J. E.; Vedadi, M.; Brown, P. J.; Arrowsmith, C. H.;
Bradner, J. E.; Schapira, M. Catalytic site remodelling of the DOT1L
methyltransferase by selective inhibitors. Nat. Commun. 2012, 3, 1288.
(25) Williams, D. E.; Dalisay, D. S.; Li, F.; Amphlett, J.; Maneerat,
W.; Chavez, M. A. G.; Wang, Y. A.; Matainaho, T.; Yu, W.; Brown, P.
J.; Arrowsmith, C. H.; Vedadi, M.; Andersen, R. J. Nahuoic acid A
produced by a streptomyces sp. isolated from a marine sediment is a
selective SAM-competitive inhibitor of the histone methyltransferase
SETD8. Org. Lett. 2013, 15, 414−417.
(26) Anglin, J. L.; Deng, L.; Yao, Y.; Cai, G.; Liu, Z.; Jiang, H.;
Cheng, G.; Chen, P.; Dong, S.; Song, Y. Synthesis and structure−
activity relationship investigation of adenosine-containing inhibitors of
histone methyltransferase DOT1L. J. Med. Chem. 2012, 55, 8066−
8074.
(27) Konze, K. D.; Ma, A.; Li, F.; Barsyte-Lovejoy, D.; Parton, T.;
MacNevin, C. J.; Liu, F.; Gao, C.; Huang, X. P.; Kuznetsova, E.;
Rougie, M.; Jiang, A.; Pattenden, S. G.; Norris, J. L.; James, L. I.; Roth,
B. L.; Brown, P. J.; Frye, S. V.; Arrowsmith, C. H.; Hahn, K. M.; Wang,
G. G.; Vedadi, M.; Jin, J. An orally bioavailable chemical probe of the
lysine methyltransferases EZH2 and EZH1. ACS Chem. Biol. 2013, 8,
1324−1334.
(28) Knutson, S. K.; Warholic, N. M.; Wigle, T. J.; Klaus, C. R.;
Allain, C. J.; Raimondi, A.; Porter Scott, M.; Chesworth, R.; Moyer, M.
P.; Copeland, R. A.; Richon, V. M.; Pollock, R. M.; Kuntz, K. W.;
Keilhack, H. Durable tumor regression in genetically altered malignant
rhabdoid tumors by inhibition of methyltransferase EZH2. Proc. Natl.
Acad. Sci. U.S.A. 2013, 110, 7922−7927.
(29) Beguelin, W.; Popovic, R.; Teater, M.; Jiang, Y.; Bunting, K. L.;
Rosen, M.; Shen, H.; Yang, S. N.; Wang, L.; Ezponda, T.; Martinez-
Garcia, E.; Zhang, H.; Zheng, Y.; Verma, S. K.; McCabe, M. T.; Ott, H.
M.; Van Aller, G. S.; Kruger, R. G.; Liu, Y.; McHugh, C. F.; Scott, D.
W.; Chung, Y. R.; Kelleher, N.; Shaknovich, R.; Creasy, C. L.;
Gascoyne, R. D.; Wong, K. K.; Cerchietti, L.; Levine, R. L.; Abdel-
Wahab, O.; Licht, J. D.; Elemento, O.; Melnick, A. M. EZH2 is
required for germinal center formation and somatic EZH2 mutations
promote lymphoid transformation. Cancer Cell 2013, 23, 677−692.
(30) Liu, F.; Barsyte-Lovejoy, D.; Li, F.; Xiong, Y.; Korboukh, V.;
Huang, X. P.; Allali-Hassani, A.; Janzen, W. P.; Roth, B. L.; Frye, S. V.;
Arrowsmith, C. H.; Brown, P. J.; Vedadi, M.; Jin, J. Discovery of an in
vivo chemical probe of the lysine methyltransferases G9a and GLP. J.
Med. Chem. 2013, 56, 8931−8942.
(43) Nishioka, K.; Rice, J. C.; Sarma, K.; Erdjument-Bromage, H.;
Werner, J.; Wang, Y.; Chuikov, S.; Valenzuela, P.; Tempst, P.; Steward,
R.; Lis, J. T.; Allis, C. D.; Reinberg, D. PR-Set7 is a nucleosome-
specific methyltransferase that modifies lysine 20 of histone H4 and is
associated with silent chromatin. Mol. Cell 2002, 9, 1201−1213.
(44) Fang, J.; Feng, Q.; Ketel, C. S.; Wang, H.; Cao, R.; Xia, L.;
Erdjument-Bromage, H.; Tempst, P.; Simon, J. A.; Zhang, Y.
Purification and functional characterization of SET8, a nucleosomal
histone H4-lysine 20-specific methyltransferase. Curr. Biol. 2002, 12,
1086−1099.
(31) Sweis, R. F.; Pliushchev, M.; Brown, P. J.; Guo, J.; Li, F. L.;
Maag, D.; Petros, A. M.; Soni, N. B.; Tse, C.; Vedadi, M.; Michaelides,
M. R.; Chiang, G. G.; Pappano, W. N. Discovery and development of
(45) Beck, D. B.; Oda, H.; Shen, S. S.; Reinberg, D. PR-Set7 and
H4K20me1: at the crossroads of genome integrity, cell cycle,
6832
dx.doi.org/10.1021/jm500871s | J. Med. Chem. 2014, 57, 6822−6833

Journal of Medicinal Chemistry
Article
chromosome condensation, and transcription. Genes Dev. 2012, 26,
325−337.
(46) Yang, F.; Sun, L.; Li, Q.; Han, X.; Lei, L.; Zhang, H.; Shang, Y.
SET8 promotes epithelial−mesenchymal transition and confers
TWIST dual transcriptional activities. EMBO J. 2012, 31, 110−123.
(47) Shi, X.; Kachirskaia, I.; Yamaguchi, H.; West, L. E.; Wen, H.;
Wang, E. W.; Dutta, S.; Appella, E.; Gozani, O. Modulation of p53
function by SET8-mediated methylation at lysine 382. Mol. Cell 2007,
27, 636−646.
(48) Takawa, M.; Cho, H. S.; Hayami, S.; Toyokawa, G.; Kogure, M.;
Yamane, Y.; Iwai, Y.; Maejima, K.; Ueda, K.; Masuda, A.; Dohmae, N.;
Field, H. I.; Tsunoda, T.; Kobayashi, T.; Akasu, T.; Sugiyama, M.;
Ohnuma, S.; Atomi, Y.; Ponder, B. A.; Nakamura, Y.; Hamamoto, R.
Histone lysine methyltransferase SETD8 promotes carcinogenesis by
deregulating PCNA expression. Cancer Res. 2012, 72, 3217−3227.
(49) Min, J.; Allali-Hassani, A.; Nady, N.; Qi, C.; Ouyang, H.; Liu, Y.;
MacKenzie, F.; Vedadi, M.; Arrowsmith, C. H. L3MBTL1 recognition
of mono- and dimethylated histones. Nat. Struct. Mol. Biol. 2007, 14,
1229−1230.
(50) Wigle, T. J.; Provencher, L. M.; Norris, J. L.; Jin, J.; Brown, P. J.;
Frye, S. V.; Janzen, W. P. Accessing protein methyltransferase and
demethylase enzymology using microfluidic capillary electrophoresis.
Chem. Biol. 2010, 17, 695−704.
(51) Choi, J. Y.; Seo, H. N.; Lee, M. J.; Park, S. J.; Jeon, J. Y.; Kang, J.
H.; Pae, A. N.; Rhim, H.; Lee, J. Y. Synthesis and biological evaluation
of novel T-type calcium channel blockers. Bioorg. Med. Chem. Lett.
2007, 17, 471−475.
(52) Couture, J. F.; Collazo, E.; Brunzelle, J. S.; Trievel, R. C.
Structural and functional analysis of SET8, a histone H4 Lys-20
methyltransferase. Genes Dev. 2005, 19, 1455−1465.
(53) Senisterra, G.; Wu, H.; Allali-Hassani, A.; Wasney, G. A.;
Barsyte-Lovejoy, D.; Dombrovski, L.; Dong, A.; Nguyen, K. T.; Smil,
D.; Bolshan, Y.; Hajian, T.; He, H.; Seitova, A.; Chau, I.; Li, F.; Poda,
G.; Couture, J. F.; Brown, P. J.; Al-Awar, R.; Schapira, M.; Arrowsmith,
C. H.; Vedadi, M. Small-molecule inhibition of MLL activity by
disruption of its interaction with WDR5. Biochem. J. 2013, 449, 151−
159.
6833
dx.doi.org/10.1021/jm500871s | J. Med. Chem. 2014, 57, 6822−6833