Synthesis and hybridization properties of DNA-PNA chimeras carrying 5- bromouracil and 5-methylcytosine

Article abstract of DOI:10.1016/S0968-0896(99)00308-9

The preparation of 5-bromouracil and 5-methylcytosine peptide nucleic acid (PNA) monomers is described. These PNA monomers were used for the preparation of several DNA-PNA chimeras and their hybridization properties are described. The substitution of cyto

Full text of DOI:10.1016/S0968-0896(99)00308-9

Bioorganic & Medicinal Chemistry 8 (2000) 291±297
Synthesis and Hybridization Properties of DNA±PNA Chimeras
Carrying 5-Bromouracil and 5-Methylcytosine
Elisenda Ferrer, Anna Shevchenko and Ramon Eritja*
European Molecular Biology Laboratory, Meyerhofstrasse 1, D-69117 Heidelberg. Germany
Received 22 June 1999; accepted 8 September 1999
AbstractÐThe preparation of 5-bromouracil and 5-methylcytosine peptide nucleic acid (PNA) monomers is described. These PNA
monomers were used for the preparation of several DNA±PNA chimeras and their hybridization properties are described. The
substitution of cytosine by 5-methylcytosine in DNA±PNA chimeras increased duplex stability while substitution of thymine by 5-
bromouracil maintained it. Moreover, binding of DNA±PNA chimeras to double-stranded DNA to form triple helices was studied.
In contrast to DNA, the presence of 5-methylcytosine and 5-bromouracil in DNA±PNA chimeras destabilized triple helix. # 2000
Elsevier Science Ltd. All rights reserved.
Introduction
activate RNase H and retain some of the enhanced
binding and nuclease resistance properties of PNA.5±12
Peptide nucleic acids (PNA) are oligonucleotide ana-
logues in which the sugar-phosphate backbone has been
replaced by N-(2-aminoethyl)glycine units.1 In spite of
the change in the backbone structure, PNA molecules
bind strongly to complementary DNA and RNA
sequences,2 and they are achiral and uncharged. For
these reasons PNA oligomers have a strong potential as
therapeutic agents, diagnostic tools and probes in
molecular biology.3
The preparation of DNA±PNA chimeras has been
described by several authors.5±12 The most common
strategy is to use the MMT group for the temporary
protection of the backbone amino function, and acyl
groups for the exocyclic amino functions of the nucleo-
bases.5±8 The MMT is removed under mild conditions
(3% TCA in DCM), and the nucleobase-protecting
groups are removed using concentrated aqueous
ammonia. These conditions are similar to those used in
DNA synthesis allowing the preparation of PNA±DNA
chimeras.5±12
Although PNA oligomers have excellent binding prop-
erties, they show poor solubility and a tendency to self-
aggregation.4 Some of these problems have been solved
by preparing DNA±PNA chimeras. These chimeras are
more water soluble, maintain the ability of DNA to
We report the preparation of DNA±PNA chimeras
carrying 5-bromouracil and 5-methylcytosine. Substitu-
tion of cytosine by 5-methylcytosine in oligonucleotides
increases the stability of both double13,14 and triple15,16
helices. Oligonucleotides carrying 5-bromouracil are
used in photo-cross-linking experiments,17 in X-ray dif-
fraction studies,18 as non-radioactive labels19 and for
triple-helix stabilization.16,20 The e€ect of the incorpora-
tion of 5-bromouracil and 5-methylcytosine in PNA oli-
gomers or DNA±PNA chimeras on these properties
remains to be determined. A PNA oligomer carrying 5-
bromouracil has been prepared21 using Boc-chemistry,
which is, however, incompatible with the synthesis of
DNA±PNA chimeras.
Keywords: 5-bromouracil; duplex stability; 5-methylcytosine; PNA;
PNA±DNA chimeras.
Abbreviations: ACN: acetonitrile; AcOEt: ethyl acetate; AcOH: acetic
acid; Boc: tert-butoxycarbonyl; DBU: 1,8-diazabicyclo[5.4.0]undec-7-
ene; DCM: dichloromethane; DIP: diisopropylcarbodiimide; DIPEA:
diisopropylethylamine; DMAP: 4-N,N-(dimethylamino)pyridine;
DMF: N,N-dimethylformamide; DMT: dimethoxytrityl; Et3N: trie-
thylamine; HATU: N-[(dimethylamino)-1H; 1,2,3-triazolo-[4,5-b]pyr-
idin-1-yl-methylene]-N-methylmethanaminium hexa¯uorophosphate
N-oxide; HOOBt: 3,4-dihydro-3-hydroxy-4-oxo-1,2,3-benzotriazine;
MMT: monomethoxytrityl; MeOH: methanol; PEG-PS: poly-
ethyleneglycol-polystyrene; PNA: peptide nucleic acid; TCA: tri-
chloroacetic acid; TFA: tri¯uoroacetic acid; THF: tetrahydrofuran; .
*Corresponding author at present address: Centro de Investigacion
y
Desarrollo, C.S.I.C., Jordi Girona 18-26, E-08034 Barcelona,
Recently, a new strategy has been developed for the
preparation of MMT-protected PNA monomers which
Spain. Tel.: +34-93-4006145; fax: +34-93-2045904; e-mail: recgma@
cid.csic.es
0968-0896/00/$ - see front matter # 2000 Elsevier Science Ltd. All rights reserved.
PII: S0968-0896(99)00308-9

292
E. Ferrer et al. / Bioorg. Med. Chem. 8 (2000) 291±297
uses the 2-cyanoethyl group for the protection of the
carboxylic function.22 This group is removed by b-elim-
ination with a strong but non-nucleophillic base in con-
ditions that are compatible with acid labile (DMT and
Boc) protecting groups and acyl protecting groups.22 In
this paper we used this method to prepare MMT-pro-
tected PNA monomers of 5-bromouracil and 5-methyl-
cytosine. These monomers were used for the synthesis of
several DNA±PNA chimeras carrying 5-bromouracil
and 5-methylcytosine. Base-pairing properties of the
modi®ed DNA±PNA chimeras are described.
the introduction of the carboxymethyl group, and the
protection of the 4-amino function. The synthesis
scheme is illustrated in Figure 2. First we introduced the
carboxymethyl group in thymine. Alkylation of thymine
was performed with t-butyl bromoacetate in the pre-
sence of DBU, yielding compound 4 in 81% yield. The
t-butyl ester was selected because it is stable to ammo-
nia, which was later used in the conversion of thymine
to 5-methylcytosine. The next step was the activation of
position 4 of thymine to introduce an amino group.
Compound 4 was activated with mesitylenesulfonic chlo-
ride followed by displacement of the mesitylenesulfonyl
group with o-nitrophenol. The o-nitrophenyl thymine
derivative (5) was isolated in 64% yield. Displacement of
the o-nitrophenyl group by ammonia yielded the desired
carboxymethyl derivative of 5-methylcytosine (6) in 68%
yield.
Results and Discussion
Synthesis of the PNA monomers
The preparation of the PNA monomer of 5-bromour-
acil is illustrated in Figure 1. First, the 5-bromouracil
acetic acid derivative (1) was prepared by direct alkyla-
tion of 5-bromouracil with bromoacetic acid as descri-
bed for the thymine derivative.23 Coupling of
compound 1 to N-MMT-2-aminoethyl-glycine 2-cya-
noethyl ester using DIP and HOOBt as condensing
agents in the presence of N-ethylmorpholine5 yielded
the CE-protected PNA monomer (2). Finally, com-
pound 2 was treated with DBU22 to give the desired 5-
bromouracil PNA monomer (3), which was isolated as
triethylammonium salt in 58% yield.
The introduction of the protecting group for the exo-
cyclic 4-amino function of 5-methylcytosine was trou-
blesome. First, the isobutyryl group was introduced by
reaction of compound 6 with isobutyryl anhydride. The
isobutyryl derivative was isolated in good yields but the
isobutyryl group did not resist the TFA treatment nee-
ded for the elimination of the t-butyl group (data not
shown). Then, the more stable benzoyl group was selec-
ted. Reaction of compound 6 with benzoic anhydride
yielded the benzoyl derivative 7 in 65% yield, which was
treated with TFA giving the desired protected derivative
The preparation of the PNA monomer of 5-methylcytosine
required the conversion of thymine to 5-methylcytosine,
Figure 2. Preparation of the PNA monomer of 5-methylcytosine. (a) t-
Butyl bromoacetate, DBU; (b) 2-mesitylenesulfonyl chloride, DMAP
followed by o-nitrophenol, 1,4-diazabicyclo[2.2.2]octane; (c) ammonia;
(d) benzoyl choride, pyridine; (e) TFA; (f) N-(2-(MMT-amino)ethyl)gly-
cine 2-cyanoethyl ester, DIP, HOOBt, N-ethylmorpholine; (g) DBU.
Figure 1. Preparation of the PNA monomer of 5-bromouracil. (a)
bromoacetic acid, NaOH; (b) N-(2-(MMT-amino)ethyl)glycine 2-cya-
noethyl ester, DIP, HOOBt, N-ethylmorpholine; (c) DBU.

E. Ferrer et al. / Bioorg. Med. Chem. 8 (2000) 291±297
293
of 5-methylcytosine (compound 8). This derivative was
reacted with the MMT, CE-protected N-(2-ami-
noethyl)glycine backbone to give compound 9, which
was converted to the desired 5-methylcytosine PNA
monomer 10.
Synthesis of DNA±PNA chimeras
Several DNA±PNA chimeric molecules carrying 5-bro-
mouracil (B) and 5-methylcytosine (M) were prepared
using solid-phase protocols. Polyethyleneglycol-poly-
styrene (PEG-PS) carrying an aminohexyl linker5 was
used as solid support. The sequences were: I 50
CTTCCTCCTCT-CONH-hexyl-OH, II 50 MTTCCM
MTCCTCT-CONH-hexyl-OH, III 50 CTTCCTMMT
MT-CONH-hexyl-OH, IV 50 MTTMMTMMTMT-
CONH-hexyl-OH and V 50 CTTCCTCCBCB-CONH-
hexyl-OH. The PNA part is written in italics. The last
PNA monomer (T) is a T linker carrying a hydroxyl
group protected with the MMT group to connect with
the oligonucleotide part.6,10 The addition of 5-methyl-C
in the DNA part was performed using the commercially
available phosphoramidite derivative in which the exo-
cyclic amino group is protected with the benzoyl group.
The PNA part was synthesized manually and the DNA
part using an automatic DNA synthesizer as described
previously.22 Coupling eciencies of the 5-bromouracil
and 5-methylcytosine PNA monomers were similar to
those of the natural bases.
Figure 3. MS analysis (electrospray) of puri®ed chimera V. The sam-
ple (PNA±DNA chimera V, 30 mg) was dissolved in 1 ml of 50%
water/methanol mixture. One microliter aliquot was taken up and
analyzed on a triple quadrupole mass spectrometer API III (PE Sciex,
Ontario) equipped with nanoelectrospray ion source developed in
EMBL. The ®gure presents an image deconvoluted using BioMulti-
view software (PE Sciex, Ontario) from the original spectrum con-
taining the series of multiply charged ions.
Table 1. Melting temperatures (Tm) of the duplexes containing
DNA±PNA chimeras (0.15 M NaCl, 0.05 M Tris±HCl pH 7.5). PNA
part in italics. M=5-methyl-C; B=5-bromo-U and T=T-hydro-
xyethylglycine as PNA±DNA linker
Compound
Sequence (50->30, N->C)
Tm (ꢀC)
DNA
CTTCCTCCTCTa
CTTCCTCCTCTa,b
MTTMMTCCTCTa,b
CTTCCTMMTMTa,b
MTTMMTMMTMTa,b
CTTCCTCCBCBa,b
42
37
40
39
45
37
Chimera I
Chimera II
Chimera III
Chimera IV
Chimera V
After the assembly of the sequences, supports were
treated with concentrated ammonium hydroxide. The
ammonia deprotection of DNA±PNA chimera contain-
ing 5-bromouracil (V) was performed at room tempera-
ture to avoid the degradation of 5-bromouracil
observed in oligonucleotides.20 The rest of the chimeras
were deprotected at 55 ꢀC. The resulting products were
puri®ed by reversed-phase HPLC. In all cases a major
peak was observed, which had the expected molecular
weight as measured by electrospray mass spectrometry
(see Fig. 3).
aComplementary strand 50 AGAGGAGGAAG 30.
bTerminal 6-(hydroxyhexyl)carboxamide.
DNA±PNA chimeras the duplex stability increased
from 37 ꢀC for chimera I (no substitution), to 39±40 ꢀC
for chimeras II and III (3 substitutions) and to 45 ꢀC for
chimera IV (6 substitutions). Introduction of a methyl
group in the cytosine had a bene®cial e€ect on duplex
stability in both DNA and PNA parts. By analogy with
DNA oligonucleotides13,14 and hexitol nucleic acids25
the stabilizing e€ect is most likely due to increased stack-
ing interactions or dehydration of the helix. This increase
is of special interest for the potential applications of PNA
and DNA±PNA chimeras.3,4
Hybridization properties of DNA±PNA chimeras
The in¯uence of 5-bromouracil and 5-methylcytosine on
duplex stability was evaluated in a polypurine-poly-
pyrimidine duplex in which thymine had been replaced
by 5-bromouracil and cytosine by 5-methylcytosine.
Melting temperatures at medium salt concentration are
shown in Table 1. The duplex constituted of DNA±
PNA chimera I (without any base substitution) and its
complementary DNA strand had a lower melting tem-
perature than a pure DNA duplex (37 versus 42 ꢀC).
This decrease is in agreement with previously reported
data10,12 and is attributed to the unfavorable geometry
of the DNA±PNA junction.10 Substitution of thymine
by 5-bromouracil in DNA±PNA chimeras had no in¯u-
ence on duplex stability (37 ꢀC for chimera V versus
37 ꢀC for chimera I). The same substitution in oligo-
deoxynucleotides led to a slight increase in duplex stabi-
lity24 but maintenance of duplex stability is enough for
most of the applications described for 5-bromouracil.17±
19 When cytosine was substituted by 5-methylcytosine in
The in¯uence of 5-bromouracil and 5-methylcytosine in
triple-helix formation was studied with the sequence
described by Xodo et al.15 Triple helices were formed by
mixing a hairpin molecule (26-mer) with di€erent all-
pyrimidine DNA±PNA chimeras (11-mer). The UV
absorbance at 270 nm was then followed as a function
of temperature at pH 5.5 and 6.0 and at two di€erent
salt concentrations (0.1 and 1 M NaCl in 0.1 M sodium
phosphate/citric acid bu€er). As described earlier, two
transitions were observed.15 The ®rst transition is due to
dissociation of the DNA±PNA chimera from the triplex
(triplex to duplex) and the second transition to the
denaturation of hairpin (duplex to single strand). Table

294
E. Ferrer et al. / Bioorg. Med. Chem. 8 (2000) 291±297
2 shows the melting temperatures for triple-helix dis-
sociation. In order to simplify the table, the melting
temperature of the duplex (around 75 ꢀC) was omitted.
Triplex dissociation of DNA±PNA chimeras was only
observed at pH 5.5 and medium salt conditions (0.1 M
NaCl), and melting temperatures were between 17 and
24 ꢀC. In contrast, the all-DNA oligomer had a melting
temperature for triplex dissociation of 38 ꢀC at 0.1 M
NaCl, and 43 ꢀC at 1 M NaCl (both at pH 5.5) and no
transition was observed for the all-PNA molecule either
at 0.1 or 1 M NaCl, or at pH 5.5 or 6.0. Most of the
triple helix stabilization properties of PNA are descri-
bed for PNAꢁ PNAꢁ DNA triple helices.3,4 PNA binding
to duplex DNA to form PNAꢁ DNAꢁ DNA triple helices
was described to be at least three orders of magnitude
less ecient.26 This is consistent with the absence of a
triplex melting curve for the all-PNA oligomer. There is
no previous data on the binding of DNA±PNA chi-
meras to duplex DNA. Our results indicate that DNA±
PNA chimeras bind to duplex DNA to form triple heli-
ces at low pH and at medium salt concentration (0.1 M
NaCl). These triple helices are less stable than all-DNA
triple helices, but more stable than triple helices formed
with PNA oligomers, which are not observed. Most
probably the binding to duplex DNA is given by the
DNA part of the chimeras but, on the other hand, triple
helices formed by DNA±PNA chimeras are only
observed at 0.1 M NaCl but not at 1 M NaCl. This is
probably due to the presence of the PNA part, since
pure DNA triplexes are stable at high concentrations of
monovalent cations because salts reduce the repulsion
of the phosphate groups of three strands.27
thus precluding their use for triple helix formation.
However, we believe that the results on triple helix for-
mation obtained with DNA±PNA chimeras are
encouraging since we have shown that DNA±PNA chi-
meras bind to duplex DNA better than PNA oligomers.
Although PNA oligomers can be designed to form a
stable PNAꢁ PNAꢁ DNA triplex via strand-displacement,
this process is slow and direct binding to the target
duplex DNA may be faster. A more detailed study is
needed to determine the structure of the triple helices
formed by DNA±PNA chimeras in order to propose
new modi®cations that may enhance the stability of
these triple helices.
Experimental
Materials
MMT-protected PNA monomers of natural bases (N4-p-
tert-butylbenzoyl-cytosine; N6-p-methoxybenzoyl-ade-
nine; N2-acetyl, O6-diphenylcarbamoyl-guanine and
thymine) and N-(2-(4-methoxyphenyl)diphenylmethy-
lamino)ethyl-glycine 2-cyanoethyl ester were prepared
as previously described.22 Amino-polyethyleneglycol-
polystyrene (PEG-PS) was obtained from PerSeptive
Biosystems (USA). Reagents for oligonucleotide synth-
esis were purchased from Perkin±Elmer-Applied Bio-
systems (USA) and PerSeptive Biosystems (USA). N-
Trityl-glycine was from Novabiochem (Switzerland).
Solvents were from Merck (Germany) and SDS
(France). Chemicals were from Aldrich (USA) and
Fluka (Switzerland).
Substitution of thymine by 5-bromouracil and cytosine
by 5-methylcytosine in DNA±PNA chimeras induced a
signi®cant decrease in the stability of triplex indicated
by lowering the melting temperatures (17±21 ꢀC for chi-
meras II±IV versus 24 ꢀC for chimera I). In contrast, the
same substitutions are reported to induce a strong sta-
bilization of triple helices in oligodeoxynucleotides,15,16,20
indicating that the structure of the triple helices formed
by DNA±PNA chimeras are di€erent from the triple
helices formed by all-DNA oligomers and for this rea-
son, the mechanisms for their stabilization are also di€er-
ent. The results obtained with DNA±PNA chimeras
carrying 5-bromouracil and 5-methylcytosine are negative,
General methods
Flash chromatography was performed using Silica gel
60 (particle size 35±70 mm, SDS, France). During the
puri®cation of products having MMT groups the col-
umns were packed with the appropriate mixture con-
taining 1% Et3N to neutralize the acidity of the silica
and the product was eluted with the same mixture
without Et3N. Thin layer chromatography was carried
out on aluminum sheets coated with silica gel 60 F254
(Merck). Amino compounds were stained with ninhydrin.
MALDI-TOF mass spectrometry measurements of
PNA monomers were performed in a Kratos Maldi
mass spectrometer using sinapinic acid as the matrix.
Electrospray and MALDI-TOF mass spectra of DNA±
PNA oligomers were obtained on a Perkin±Elmer AP
III SCIEX equipped with a triple-quadrupole detector.
Table 2. Melting temperatures (Tm) of the triplexes containing
DNA±PNA chimeras (100 mM NaCl, 100 mM sodium phosphate/
citric acid pH 5.5). PNA part in italics. M=5-methyl-C; B=5-bromo-
U and T=T-hydroxyethylglycine as PNA±DNA linker
Compound
Sequence (50->30, N->C)
Tm (ꢀC)
NMR spectra were recorded on a Bruker AM-250
spectrometer. HPLC chomatography was performed on
a Waters instrument. For the puri®cation of DNA±
PNA oligomers the following conditions were used.
Solvent A: 5% ACN in 100 mM triethylammonium
acetate (pH 6.5) and solvent B: 70% ACN in 100 mM
triethylammonium acetate pH 6.5. For analytical runs:
Column, Nucleosil 120C18, 250Â4 mm, ¯ow rate: 1 mL/
min. Conditions A) a 40 min linear gradient from 0 to
75%B. Conditions (B) a 20 min linear gradient from 0
DNA
CTTCCTCCTCTa
CTTCCTCCTCTa,c
MTTMMTCCTCTa,c
CTTCCTMMTMTa,c
MTTMMTMMTMTa,c
CTTCCTCCBCBa,c
Gly-CTTCCTCCTCTa,c
38b
24
18
17
Chimera I
Chimera II
Chimera III
Chimera IV
Chimera V
PNA
21
No transition
No transition
aHairpin duplex 50 GAAGGAGGAGATTTTTCTCCTCCTTC 30.
bTm=43 ꢀC, at 1M NaCl, 100 mM sodium phosphate/citric acid pH 5.5.
cTerminal 6-(hydroxyhexyl)carboxamide.

E. Ferrer et al. / Bioorg. Med. Chem. 8 (2000) 291±297
295
to 20% B. For preparative runs : Column, PRP-1
(Hamilton), 250Â10 mm. Flow rate: 3 mL/min. A 30 min
linear gradient from 10 to 80% B (DMT on), or a 30 min
linear gradient from 0 to 50% B (DMT o€). For the
analysis of the PNA monomers the following conditions
were used: Column, Nucleosil 120C18, 270Â4 mm, ¯ow
rate: 1 mL/min. A 30 min linear gradient from 60 to
100% methanol in 0.9% Tris±phosphoric acid pH 2.6.
gel. The column was packed with a 3% MeOH/DCM
solution containing 1% of triethylamine and the pro-
duct was eluted with a 3±8% MeOH gradient in DCM.
The desired product was obtained as triethylammonium
salt. Yield 1.79 g (58%). (HPLC>90%, 11.5 min). TLC
(5% MeOH in DCM) Rf 0.13. 1H NMR (CDCl3) d 1.24
(t, Et3N), 2.35 (2H, m), 2.97 (q, Et3N), 3.54 (2H, m),
3.95 (2H, s), 4.60 (2H, s), 3.78 (3H, s), 7.10±7.58 (14H,
m), 7.70 (1H, s). 13C NMR (CDCl3): d (major rotamer)
8.5 (Et3N), 41.8, 45.2 (Et3N), 47.8, 48.7, 52.2, 55.1, 70.3,
95.8, 113.0, 126.2, 127.7, 128.5, 129.7, 138.0, 144.8,
145.2, 150.4, 157.7, 159.8, 167.2, 173.7. MS (MALDI-
TOF): Found 620 (M); 273 (MMT+); (molecular mass
expected for C33H32N5O6Br 620.4)
5-Bromo-1-carboxymethyluracil (1). 5-Bromouracil (2 g,
10 mmol) was dissolved in a KOH solution of 2.23 g
(38 mmol) in 8 mL of water. The resulting solution was
heated to 40 ꢀC and 2.08 g (15 mmol) of bromoacetic
acid dissolved in 4 mL of water was added over a period
of 30 min. After the addition, the mixture was stirred at
room temperature for 30 min. Conc HCl was then
added to the mixture until the pH was 5.5 and the
resulting mixture was kept at 0 ꢀC for 2 h. The pre-
cipitate was ®ltered o€ and the pH of the solution was
adjusted to pH 2 with conc HCl. After 2 h at 0 ꢀC, a new
precipitate was collected, washed and dried. Yield 1.3 g
(50%). TLC (AcOEt: MeOH: AcOH 75:20:5) Rf 0.33.
Anal. calcd. for C6H5N2O4Br: C, 28.94; H, 2.02; N,
11.25. Found C, 28.82; H, 2.00; N, 11.09. 1H NMR (d6-
DMSO) d 4.40 (2H, s), 8.21 (1H, s), 11.89 (1H, s). 13C
NMR (d6-DMSO) d 48.8,94.6,145.7,150.4,159.7,169.3.
1-tert-Butoxycarbonylmethylthymine (4). Thymine (3 g,
23.8 mmol) was dissolved in 70 mL of DMF and 3.9 mL
of DBU was added. 3.5 mL (35.7 mmol) of ethyl bro-
moacetate dissolved in 3 mL of DMF was added drop-
wise to the solution. After stirring for 1 h at room
temperature, the solvents were evaporated and the resi-
due was dissolved in AcOEt. The organic phase was
washed twice with a phosphate solution pH 7 followed
by a saturated NaCl aqueous solution. The organic
phase was dried and concentrated to dryness. The
resulting product was puri®ed on silica gel using a 1±2%
MeOH gradient in DCM. Yield 4.64 (81%). TLC (4%
1
N-(2-(4-Methoxyphenyl)diphenylmethylamino)ethyl-N-
(1-(5-bromouracil) acetyl) glycine 2-cyanoethyl ester (2).
N-[2-(4-Methoxyphenyl)diphenylmethylamino]ethyl-gly-
cine 2-cyanoethyl ester (3.3 g, 7.4 mmol) was dissolved
in DMF (15 mL) and 1.87 mL (14.7 mmol) of N-ethyl-
morpholine and 1.19 g (7.4 mmol) of HOOBt were
added to the solution, followed by a solution of 1.83 g
(7.4 mmol) of 5-bromo-1-carboxymethyluracil in 10 mL
of DMF and 1.11 mL (8.8 mmol) of DIP. The resulting
mixture was stirred at room temperature for 20 h and
then concentrated to dryness. The residue was dissolved
in DCM and the solution was washed with water and
saturated NaCl aqueous solution. The organic phase
was dried and concentrated to dryness. The resulting
product was puri®ed on silica gel. The column was
packed with DCM containing 1% Et3N and eluted with
0±2% MeOH gradient in DCM. The desired product
was obtained as a yellowish oil (2.9 g, 68%) partially
contaminated with diisopropylurea (HPLC 85% pure,
14.3 min). TLC (3% MeOH in DCM) Rf 0.35 . 1H NMR
(CDCl3) d 2.37 (2H, m), 2.61 (2H, t, J=6.2 Hz), 3.54 (2H,
m), 3.81 (3H, s), 4.02 (2H, s), 4.23 (2H, t, J=6.2Hz), 6.80±
7.51 (14H, m), 7.87 (1H, s). 13C NMR (CDCl3) d 17.7,
41.9, 48.3, 48.7, 50.1, 55.2, 59.4, 70.6, 96.5, 113.2, 116.7,
126.3, 127.5, 128.3, 129.6, 137.5, 144.5, 145.7, 150.3,
158.0, 160.0, 167.2, 168.4. MS (MALDI-TOF): Found
675 (M+1); 273 (MMT+); (molecular mass expected
for C33H32N5O6Br 674.5).
MeOH in DCM) Rf 0.48. H NMR (CDCl3) d 1.1 (9H,
s), 1.8 (3H, s), 4.2 (2H, s), 7.4 (1H, s). 13C NMR (CDCl3):
d 12.3, 27.9, 49.1, 83.4, 110.9, 140.3, 150.9, 164.2, 166.6.
1-tert-Butoxycarbonylmethyl-O4-(o-nitrophenyl)thymine
(5). 1-tert-Butoxycarbonylmethylthymine (5.1 g, 21 mmol)
was dissolved in 100 mL of DMF. To the solution
15 mL (100 mmol) of Et3N, 6.9 g (31.5 mmol) of 2-mesi-
tylenesulfonyl chloride and 0.64 g (8.4 mmol) of DMAP
were added. After stirring for 3 h at room temperature
0.47 g (10.5 mmol) of 1,4-diazabicyclo[2.2.2]octane and
3.5 g (25.2 mmol) of o-nitrophenol were added and the
solution was stirred for 20 h. The reaction mixture was
then added to a 1M NaHCO3 aqueous solution
(300 mL) with stirring. The organic phase was collected,
dried and concentrated to dryness. The residue was dis-
solved in hot isopropanol and cooled. The white pre-
cipitate thus obtained was further puri®ed by silica gel
column chromatography using a 0±4% MeOH gradient
in DCM. Yield 4.6 g (64%). TLC (2% MeOH in DCM)
1
Rf 0.22. H NMR (CDCl3) d 1.12 (9H, s), 1.8 (3H, s),
4.11 (2H, s), 6.9±7.3 (4H, m), 7.8 (1H, d). 13C NMR
(CDCl3): d 12.1, 27.9, 50.9, 83.2, 104.3, 125.8, 126.6,
134.9, 141.5, 145.3, 146.5, 155.5, 166.6, 170.1.
1-tert-Butoxycarbonylmethyl-5-methylcytosine (6). Com-
pound 5 (8 g, 23.2 mmol) was dissolved in 300 mL of
THF. The solution was treated with an excess of liquid
ammonia (22 g, 1.29 mol) in a steel bomb. The stirred
(500 rpm) mixture was heated to 75 ꢀC for 4 days. The
mixture was concentrated to dryness. The residue was
puri®ed by silica gel chromatography. The column was
packed with 1% Et3N in a MeOH-DCM (3:97) mixture
and eluted with 3% MeOH in DCM. Yield 3.5 g (68%).
N-(2-(4-Methoxyphenyl)diphenylmethylamino)ethyl-N-
((5-bromouracil) acetyl) glycine (3). Compound 2 (2.9 g,
4.3 mmol) was treated with 52mL of a 0.5 M DBU solu-
tion (26 mmol) in acetonitrile at room temperature. After
5 min, TLC (5% MeOH/DCM) showed complete hydro-
lysis of the ester. The reaction mixture was concentrated
to dryness. The product was further puri®ed on silica
1
TLC (5% MeOH in DCM + 1% Et3N) Rf 0.19. H
NMR (d6-DMSO) d 0.98 (9H, s), 1.40 (3H, s), 3.87 (2H,

296
E. Ferrer et al. / Bioorg. Med. Chem. 8 (2000) 291±297
1
s), 6.95 (1H, s). 13C NMR (d6-DMSO): d 12.8, 27.7,
50.2, 81.1, 100.6, 143.8, 155.7, 165.8, 167.8.
MeOH in DCM). H NMR (CDCl3): d 1.21 (Et3N),
2.10 (3H, s), 2.37 (2H, t, J=5.5 Hz), 2.85 (Et3N), 3.56
(2H, t, J=5.5 Hz), 3.79 (3H, s), 3.93 (2H, s), 4.64 (2H,
s), 6.81±7.56 (14H, m), 8.34 (1H, s).13C NMR (CDCl3):
d (major rotamer) 8.9 (Et3N), 13.3, 41.9 , 45.2 (Et3N),
48.4, 49.3, 50.6, 55.1, 70.3, 110.8, 113.1, 126.4, 127.8,
120.0, 128.4, 128.5, 129.8, 132.2, 137.5, 142.9, 145.7,
157.9, 166.5, 173.5. MS (MALDI-TOF): found 659 (M),
388 (M-MMT+2H) (M), 273 (MMT+); (molecular
mass expected for C41H43N5O6 658.7).
N4-Benzoyl-1-tert-butoxycarbonylmethyl-5-methylcytosine
(7). Compound 6 (0.34 g, 1.5 mmol) was dissolved in
20 mL of pyridine and 0.41 g (1.82 mmol) of benzoic
anhydride were added. After magnetic stirring for 16 h
at room temperature 2 mL of water was added and the
mixture was concentrated to dryness. The residue was
dissolved in DCM and washed with 1 M NaHCO3
aqueous solution. The organic phase was dried and
concentrated to dryness. The residue was puri®ed by
silica gel chromatography and the product was eluted
with a 0±5% MeOH gradient in DCM. Yield 0.32 g
(65%). TLC (2% MeOH in DCM) Rf 0.37. Anal. calcd
for C18H21N3O4: C, 62.96; H, 6.16; N, 12.24. Found C,
62.64; H, 6.17; N, 11.86. 1H NMR (CDCl3) d 1.48 (9H, s),
2.11 (3H, s), 4.21 (2H, s), 7.09 (1H, s), 7.41±8.33 (5H, m).
13C NMR (CDCl3): d 13.2, 27.9, 49.8, 83.4, 111.7, 128.0,
129.8, 132.4, 137.1, 141.6, 148.4, 166.3, 179.5, 160.2.
Syntheses of DNA±PNA chimeras and PNA oligomer
DNA±PNA hybrids were synthesized on an MMT-NH-
hexyl-succinate-NH-PEG-PS-support as described in
ref 5. Sequences were I: 50 CTTCCTCCTCT-CONH-
hexyl-OH, II: 50 MTTCCMMTCCTCT-CONH-hexyl-
OH, III: 50 CTTCCTMMTMT-CONH-hexyl-OH, IV:
50 MTTMMTMMTMT-CONH-hexyl-OH and V: 50
CTTCCTCCBCB-CONH-hexyl-OH where M repre-
sents 5-methylcytosine, B is 5-bromouracil and T is a
PNA monomer carrying a hydroxyl group instead of an
amino group.6,10 The PNA part was synthesized at
10 mmol scale in a syringe equipped with a ®lter. The
PNA monomers were added manually in a 5-fold molar
excess. PNA monomer coupling was carried out by
adding equal amounts of 3 solutions : (a) 0.2 M PNA
monomer in ACN (T, G, A) or 0.1 M of the C mono-
mer in DCM (C), (b) 0.2 M HATU in ACN and (c) 0.2
M DIPEA in ACN and a coupling time of 15 min.
Capping was performed by a 1 min-treatment of the
supports with the acetic anhydride and N-methylimida-
zole solutions used on oligonucleotide synthesis. The
monomethoxytrityl groups were deprotected using 3%
TCA in DCM (10Â1 mL, 5 min) followed by thorough
washing with ACN, neutralization with 0.3 M DIPEA
in ACN and washing with ACN. The last PNA mono-
mer is a T-linker molecule carrying an OH protected
with the MMT group.6,10 The oligonucleotide part was
assembled on an automatic DNA synthesizer using
standard 2-cyanoethyl phosphoramidites and following
standard protocols (1 mmol scale, DMT on). After the
assembly of the sequences, oligonucleotide-supports
were treated with 32% aqueous ammonia at 55 ꢀC for
16 h except for sequence V, which was treated with
concentrated ammonia at room temperature for 24 h.
Ammonia solutions were concentrated to dryness and
the products were puri®ed by reversed phase HPLC
using DMT on and DMT o€ protocols. All puri®ed
products presented a major peak which was collected
and analyzed by mass spectrometry. Mass spectra
(electrospray) : sequence I: found 3146.3 (expected for
C116H157N40O55P5: 3146.2); sequence II: found 3188.5
(expected for C119H163N40O55P5: 3188.3); sequence III:
found 3188.0 (expected for C119H163N40O55P5: 3188.3);
sequence IV: found 3229.7 (expected for C122H169N40
055P5: 3230.4); sequence V: found 3276.5 (expected for
C114H151N40O55P5Br2: 3276.2). Yields (optical density
units at 260 nm after HPLC puri®cation, 1 mmol) were
between 20 and 30.
N4-Benzoyl-1-carboxymethyl-5-methylcytosine (8). Com-
pound 7 (0.32 g, 1.0 mmol) was treated with 5 mL of
TFA. After 40 min of magnetic stirring, the reaction
was completed by TLC. Ethyl ether (20 mL) was added
and the white precipitate was ®ltered and dried. Yield :
1
0.3 g (72%). TLC (5% MeOH in DCM) Rf 0.28. H
NMR (d6-DMSO) d 2.08 (3H, s), 4.60 (2H, s), 7.4±8.4
(6H, m). 13C NMR (CDCl3): d 12.8, 49.5, 108.9, 128.3,
129.2, 132.5, 136.1, 145.3, 149.0, 160.5, 169.1.
N-(2-(4-Methoxyphenyl)diphenylmethylamino)ethyl-N-
((N4-benzoyl-5-methylcytosin-1-yl)acetyl) glycine 2-cya-
noethyl ester (9). N-[2-(4-Methoxyphenyl)diphenyl-
methylamino]ethyl-glycine 2-cyanoethyl ester (1.1 g,
2.5 mmol) was reacted with N4-benzoyl-1-carboxymethyl-
5-methylcytosine (0.7g, 2.5 mmol) in the presence of N-
ethylmorpholine (0.64 mL, 5.1 mmol), HOOBt (0.4 g,
2.5 mmol) and DIP (0.38 mL, 3.1 mmol) as described for
compound 2. The resulting product was puri®ed on silica
gel. The column was packed with 1% Et3N in DCM and
the product was eluted with DCM and then with DCM:
AcOEt (4:1). The desired product was obtained as a
yellowish oil (1.3 g, 74%) partially contaminated with
diisopropylurea (HPLC 85% pure, 23.3 min). Rf=0.41
1
(DCM:AcOEt 3:1). H NMR (CDCl3): d 1.17 (3H, s),
2.38 (2H, m), 2.62 (2H, t, J=6.2 Hz), 3.60 (2H, m), 3.80
(3H, s), 4.10 (2H, s), 4.21 (2H, t, J=6.2 Hz), 5.20 (2H,
s), 6.83±7.53 (15H, m), 8.31 (1H, s). 13C NMR (CDCl3):
d 13.4, 17.8, 42.1, 48.7, 48.8, 50.3, 55.2, 59.4, 70.6, 111.7,
113.2, 126.4, 127.9, 128.0, 128.4, 128.6 129.7, 132.2,
137.5, 142.2, 145.7, 148.7, 158.1, 160.3, 166.4, 168.4. MS
(MALDI-TOF): Found 711 (M); 273 (MMT+); (mole-
cular mass expected for C41H40N6O6 712.8).
N-(2-(4-Methoxyphenyl)diphenylmethylamino)ethyl-N-
((N4-benzoyl-5-methylcytosin-1-yl)acetyl) glycine (10).
Compound 9 (1.3 g, 1.9 mmol) was treated with 22 mL
of a 0.5 M DBU solution in acetonitrile (11.2 mmol) at
room temperature for 5 min as described for compound
3. During the puri®cation of this compound the product
was eluted with 5±8% MeOH gradient in DCM. Yield
0.85 g (72%) (HPLC>98%, 21.4 min). Rf=0.25 (10%
The PNA oligomer Gly-CTTCCTCCTCT-CONH-
hexyl-OH was prepared as described above for the PNA

E. Ferrer et al. / Bioorg. Med. Chem. 8 (2000) 291±297
297
part of the DNA±PNA chimeras. After the assembly of
the PNA sequence N-trityl-glycine was coupled follow-
ing the protocol described for the PNA monomers
leaving the last trityl group on the sequence. Deprotec-
tion and puri®cation were carried out as described for
DNA±PNA chimeras. Mass spectra (electrospray):
found 3012.0 (expected for C123H166N52O40: 3012.9).
Freir, S. M.; Driver, D. A.; Bergh, R. H.; Kim, S. K.; Norden,
D.; Nielsen, P. E. Nature 1993, 365, 566.
3. Hyrup, B.; Nielsen, P. E. Bioorg. Med. Chem. 1996, 4, 5.
4. Uhlmann, E.; Peyman, A.; Breipohl, G.; Will, D. W. Angew.
Chem., Int. Ed. 1998, 37, 2796.
5. Will, D. W.; Breipohl, G.; Langner, D.; Knolle, J.; Uhl-
mann, E. Tetrahedron 1995, 51, 12069.
6. Breipohl, G.; Will, D. W.; Peyman, A.; Uhlmann, E. Tet-
rahedron 1997, 53, 14671.
7. Finn, P. J.; Gibson, N. J.; Fallon, R.; Hamilton, A.; Brown,
T. Nucleic Acids Res. 1996, 24, 3357.
Melting experiments
Melting experiments of duplexes were carried out by
mixing equimolar amounts of two complementary
strands dissolved in a solution containing 0.15 M NaCl,
0.05 N Tris±HCl bu€er pH 7.5. Duplexes were annealed
by slow cooling from 80 to 4 ꢀC. UV absorption spectra
and melting curves (absorbance versus temperature)
were recorded in 1-cm path-length cells using a Varian
Cary 13 spectophotometer having a temperature con-
troller with a programmed temperature increase of
0.5 ꢀC/min. Melts were run on duplex concentrations of
4 mM at 260 nm.
8. van der Laan, A. C.; Brill, R.; Kuimelis, R. G.; Kuyl-
Yeheskiely, E.; van Boom, J. H.; Andrus, A.; Vinayak, R.
Tetrahedron Lett. 1997, 38, 2249.
9. Uhlmann, E.; Will, D. W.; Breipohl, G.; Langner, D.; Ryte,
A. Angew. Chem., Int. Ed. Engl. 1996, 35, 2632.
10. Petersen, K. H.; Jensen, D. K.; Egholm, M.; Nielsen, P. E.;
Buchardt, O. Bioorg. Med. Chem. Lett. 1995, 5, 1119.
11. Stetsenko, D. A.; Lubyako, E. N.; Potapov, V. K.; Azhi-
kina, T. L.; Sverdlov, E. D.. Tetrahedron Lett. 1996, 37, .
12. Bergmann, F.; Bannwarth, W.; Tam, S. Tetrahedron Lett.
1995, 36, 6823.
13. Ono, A.; Ueda, T. Nucleic Acids Res. 1987, 15, 219.
14. Walker, G. T. Nucleic Acids Res. 1988, 16, 3091.
15. Xodo, L. E.; Manzini, G.; Quadrifolio, F.; van der Marel,
G. A.; van Boom, J. H. Nucleic Acids Res. 1991, 19, 5625.
16. Povsic, T. J.; Dervan, P. B. J. Am. Chem. Soc. 1989, 111,
3959.
17. Dong, Q.; Blatter, E.; Ebright, Y. W.; Bister, K.; Ebright,
R. H. EMBOJ 1994, 13, 200.
18. Dickerson, R. E. Methods in Enzymol. 1992, 211, 67.
19. Seliger, H.; Frolich; Groger, G.; Krist, B.; Montenarh, M.;
Rosch, H.; Rosch, R.; Ramalho Ortigao, F. Nucleic Acids Res.
Symp. Ser. 1991, 24, 193.
Melting experiments with triple helix were performed as
follows: solutions of equimolar amounts of the hairpin
oligonucleotide (h26) and the appropriate 11-mer were
mixed in the appropriate bu€er. The solutions were
heated to 80 ꢀC, allowed to cool slowly to room tem-
perature and then kept in the refrigerator overnight. UV
absorption spectra and melting experiments (absor-
bance versus temperature) were recorded in 1-cm path-
length cells using a spectrophotometer, which has a
temperature controller with a programmed temperature
increase of 0.5 ꢀC/min. Melts were run on triplex con-
centration of 4 mM at 270 nm.
20. Ferrer, E.; Fabrega, C.; Guimil Garcõa, R.; Azorõn, F.;
Eritja, R. Nucleosides Nucleotides 1996, 15, 907.
21. Rasmussen, H.; Kastrup, J. S.; Nielsen, J. N.; Nielsen, J.
M.; Nielsen, P. E. Nature Struct. Biol. 1997, 4, 98.
22. Ferrer, E.; Eisenhut, M.; Eritja, R. Letters in Pept. Sci.
1999, 6, 209.
Acknowledgements
23. Kosynkina, L.; Wang, W.; Liang, T. C. Tetrahedron Lett.
1994, 35, 5173.
We thank to Dr. M. Eisenhut for obtaining mass spec-
tra of PNA monomers.
24. Ferrer, E.; Wiersma, M.; Kazimierczak, B.; Muller, C. W.;
Eritja, R. Bioconjugate Chem. 1997, 8, 757.
25. Boudou, V.; Kerremans, L.; De Bouvere, B.; Lescrinier, E.;
Schepers, G.; Busson, R.; Van Aerschot, A.; Herdewijn, P.
Nucleic Acids Res. 1999, 27, 1450.
26. Grith, M. C.; Risen, L. S.; Greig, M. J.; Lesnik, E. A.;
Sprankle, K. G.; Gri€ey, R. H.; Kiely, J. S.; Freier, S. M. J.
Am. Chem. Soc. 1995, 117, 831.
References and Notes
1. Nielsen, P. E.; Egholm, M.; Berg, R. H.; Buchardt, O. Sci-
ence 1991, 254, 1497.
2. Engholm, M.; Buchardt, O.; Christensen, L.; Behrens, C.;
27. Soyfer, V.N.; Potaman, V.N. In Triple-Helical Nucleic
Acids; Springer-Verlag: New York, 1996; Chapter 5.