Discovery of caffeic acid phenethyl ester derivatives as novel myeloid differentiation protein 2 inhibitors for treatment of acute lung injury

European Journal of Medicinal Chemistry 143 (2018) 361e375

Contents lists available at ScienceDirect

European Journal of Medicinal Chemistry

journal homepage: h ttp://www.elsevier.com/locate/ejmech

Research paper

Discovery of caffeic acid phenethyl ester derivatives as novel myeloid

differentiation protein 2 inhibitors for treatment of acute lung injury

,

b

,

Lingfeng Chen ^{a 1}, Yiyi Jin ^{a 1}, Hongjin Chen ^{a 1}, Chuchu Sun ^{a 1}, Weitao Fu ^a,

Lulu Zheng ^a, Min Lu ^a, Pengqin Chen ^a, Gaozhi Chen ^a, Yali Zhang ^a, Zhiguo Liu ^a,

Yi Wang ^a, Zengqiang Song ^a^**, Guang Liang ^a

,

, b, *

^aChemical Biology Research Center, School of Pharmaceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang, 325035, China

^bSchool of Chemical Engineering, Nanjing University of Science and Technology, Nanjing, Jiangsu, 210094, China

a r t i c l e i n f o

a b s t r a c t

Article history:

Myeloid differentiation protein 2 (MD2) is an essential molecule which recognizes lipopolysaccharide

(LPS), leading to initiation of inﬂammation through the activation of Toll-like receptor 4 (TLR4) signaling.

Caffeic acid phenethyl ester (CAPE) from propolis of honeybee hives could interfere interactions between

LPS and the TLR4/MD2 complex, and thereby has promising anti-inﬂammatory properties. In this study,

we designed and synthesized 48 CAPE derivatives and evaluated their anti-inﬂammatory activities in

mouse primary peritoneal macrophages (MPMs) activated by LPS. The most active compound, 10s, was

found to bind with MD2 with high afﬁnity, which prevented formation of the LPS/MD2/TLR4 complex.

The binding mode of 10s revealed that the major interactions with MD2 were established via two key

hydrogen bonds and hydrophobic interactions. Furthermore, 10s showed remarkable protective effects

against LPS-caused ALI (acute lung injury) in vivo. Taken together, this work provides new lead structures

and candidates as MD2 inhibitors for the development of anti-inﬂammatory drugs.

Received 26 October 2017

Received in revised form

22 November 2017

Accepted 24 November 2017

Keywords:

Myeloid differentiation protein 2

Toll-like receptor 4

Caffeic acid phenethyl ester

Anti-inﬂammatory

Acute lung injury

1. Introduction

respiratory distress syndrome (ARDS), occur in 200,000 adults

annually in the US, with an estimated mortality rate of 40% [2,3].

Acute lung injury (ALI) is one of the most common causes of

respiratory failure characterized by acute onset, pulmonary

inﬂammation, oedema due to severe hypoxemia, and increased

vascular permeability [1]. ALI and its most severe form, acute

The lung injury is caused primarily by neutrophil- and platelet-

dependent damages to the alveolar and epithelial barriers of the

lung, leading to noncardiogenic pulmonary edema and ﬁbrosis and

consequent hypoxemic failure [2,4]. Current pharmacologic treat-

ments such as corticosteroids, surfactants, neutrophil elastase in-

hibitors, inhaled nitric oxide, albumin and furosemide are

disappointing when tested in large, randomized controlled trials

[5e7].

Abbreviations used: CAPE, caffeic acid phenethyl ester; ALI, acute lung injury;

ARDS, acute respiratory distress syndrome; MD2, myeloid differentiation 2; TLR4,

Bacterial infection is one of the most common causes of ALI and

ARDS [4]. And lipopolysaccharide (LPS), the main component of

Gram-negative bacteria, plays a signiﬁcant role in acute inﬂam-

matory diseases [8]. LPS activates the Toll-like receptor 4 (TLR4)

signaling pathway through an essential accessory protein, myeloid

differentiation protein 2 (MD2) [9,10]. MD2 directly recognizes the

lipid A domain of LPS and induces dimerization of the LPS-MD2-

TLR4 complex, leading to the production of pro-inﬂammatory

toll-like receptor 4; LPS, lipopolysaccharide; IL-6, interleukin-6; TNF-

crosis factor alpha; NPs, natural products; ELISA, enzyme linked immunosorbent

assay; SPR, surface plasmon resonance; SAR, structure-activity relationship; IC₅₀

half-maximal inhibitory concentration; FITC, ﬂuorescein isothiocyanate isomer I;

BALF, bronchoalveolar lavage ﬂuid; MPO, myeloperoxidase; EDC-HCl, 1-(3-(dime-

thylamino)propyl)-3-ethylcarbodiimide hydrochloride; HOBT, N-hydroxybenzo-

triazole; DIPEA, N,N-diisopropylethylamine.

* Corresponding author. Chemical Biology Research Center at School of Phar-

maceutical Sciences, Wenzhou Medical University, Wenzhou, Zhejiang 325035,

China.

a, tumor ne-

,

molecules, such as tumor necrosis factor

a (TNF-a), interleukin-1b

** Corresponding author.

(IL-1 ) and IL-6 [11,12]. HaCina et al. [13] reported that MD2-null

b

E-mail addresses: songzengqiang09@163.com (Z. Song), wzmcliangguang@163.

com (G. Liang).

mice are able to survive LPS-induced endotoxic shock, implicating

the importance of MD2 in TLR4-dependent inﬂammatory

1

These authors contributed equally to this work.

https://doi.org/10.1016/j.ejmech.2017.11.066

362

L. Chen et al. / European Journal of Medicinal Chemistry 143 (2018) 361e375

responses. Hence, small molecules targeting MD2 to block activa-

tion of TLR4 signaling are attractive therapeutic candidates for in-

ﬂammatory disorders [14e17].

were elucidated. Subsequently, the MD2 binding ability of the

active compounds was evaluated by a series of assays including

ﬂuorescent probe (Bis-ANS) competing assay, enzyme-linked

immunosorbent assay (ELISA), surface plasmon resonance (SPR),

ﬂow cytometric assay, and co-immunoprecipitation (co-IP). The

most potent MD2 inhibitor, 10s, was chosen for in vivo pharma-

cology evaluation in ALI mice model.

Most of the currently reported MD2 inhibitors can be classiﬁed

into E. coli lipid A mimetics or small molecule natural products

(NPs) (Fig. 1) [14,15]. Eritoran (1), a synthetic tetra-acylated lipid A,

prevents dimerization of the TLR4-MD2 complex through direct

binding to the hydrophobic pocket of MD2 [18,19]. However, a

phase 3 clinical trial of 1 (NCT00334828) failed to decrease sepsis-

induced 28-day mortality [20]. NPs provide a tremendous source of

leads in drug discovery programs [21,22]. Recently, an increasing

number of studies have identiﬁed various NPs as potential modu-

lators of TLR4 signaling through the interactions with MD2,

including celastrol [23] (2), 6-Shogaol [24] (3), xanthohumol [25]

(4), and caffeic acid phenethyl ester [26] (5, CAPE). Compound 5

is the active component from honeybee propolis, which has

received much attention in recent years for its anti-cancer [27],

anti-oxidative [28], anti-inﬂammatory [29] and immunomodula-

tory [30] effects. Several studies reported the protective effect of 5

in LPS-induced septic shock [31,32] and sepsis-induced ALI [33,34]

mice. Following these studies, Kim and colleagues [26] further

characterized the anti-inﬂammatory mechanism of 5 as interfer-

ence of LPS binding to MD2, thereby suppressing TLR4 activation.

However, the structure-activity relationship (SAR) for its anti-

inﬂammatory property remains unclear. The current activity and

stability of the natural molecule 5 may be not sufﬁcient to support

the high efﬁciency and clinic therapy on acute inﬂammatory dis-

eases. Finding structural analogs of 5 using medicinal chemistry

may provide better lead compounds or candidates. As a carboxylic

ester, several pharmacokinetic studies found that compound 5 is

easily hydrolyzed to caffeic acid by esterases in vivo, which leads to

an relatively low in vivo activity [35,36]. Previously, Ning et al.

[37,38] synthesized some 5 analogs with improved stability and

antioxidative effect using sulfonyl or ketone link, which encour-

aged us to design new 5 derivatives with stable carboxylic amide

moiety in the structure. Here, we designed and synthesized 48

derivatives of 5 as potential MD2 inhibitors with more potent anti-

inﬂammatory effects and analyzed their SAR. The anti-

inﬂammatory activity of these synthetic compounds was

screened and the systematic SARs of the ring A, B and the linkers

2. Results and discussion

2.1. Chemistry

The synthetic routes of 8a-z and 10a-v are outlined in Schemes 1

and 2, respectively. The a, b-unsaturated acids 7a-z used in this

method were either prepared from the corresponding commer-

cially available aldehydes (6a-u) via the Knoevenagel reaction

yielding 7a-u or were substituted by corresponding benzyl bro-

mides providing 7v-z from intermediates 7c and 7d. Target com-

pounds 8a-z were synthesized through one-step amidation using

7a-z and 2-phenylethan-1-amine under the catalytic of coupling

reagents EDC-HCl and HOBt. Similarly, (E)-2-cyano-3-(4-

methylthiazol-5-yl)acrylic acid (9a) condensed with 2-

phenylethan-1-amine provided compound 10a. Other target com-

pounds 10b-t were obtained by condensation of (E)-3-(4-

methylthiazol-5-yl)acrylic acid (7r) with various amines (9b-t).

Subsequently, the tert-butyl ester of 10r-s was completely

consumed in HCl/dioxane to obtain target compounds 10u-v. The

results of yields, melting points, ¹H NMR and ESI-MS of synthesized

compounds are described in Experimental Section. Analytical HPLC

analyses were performed to determine their purity (ꢀ95%) before

biological tests.

2.2. Anti-inﬂammatory screening and SAR study of CAPE derivatives

Compounds were tested for inhibition of cytokine TNF-

a in

mouse primary peritoneal macrophages (MPMs) using enzyme-

linked immunosorbent assay (ELISA) previously established [39].

MPMs were preincubated for 60 min with the test compounds at a

concentration of 10

mM. Compound 5 was used as the positive

control, and DMSO was used as the control medium. Subsequently,

Fig. 1. Left panel: Structure of the lipid A mimetic MD2 inhibitor, eritoran. Right panel: Structures of MD2 inhibitors derived from natural products; modiﬁcation sites are shown on

compound 5.

L. Chen et al. / European Journal of Medicinal Chemistry 143 (2018) 361e375

363

Scheme 1. General synthetic route of compounds 8a-z. Reagents and conditions: (a) malonic acid (2.0 equiv), pyridine, 90 ^ꢁC; (b) EDC/HOBT, CH₂Cl₂, ice bath to room temperature,

overnight; (c) substituted benzyl bromide (2.5 equiv), K₂CO₃(2.0 equiv), CH₃CN, room temperature, overnight; (d) 1M NaOH, MeOH/H₂O, room temperature, 2 h.

Scheme 2. General synthetic route of compounds 10a-v.

the cells were treated with LPS (0.5

m

g/mL) for 24 h at 37 ^ꢁC.

catechol-ring (Ring A) of 5. As shown in Fig. 2A, the amide bond was

an effective alternative for ester as observed for compounds 5 and

We built a small library of compounds 8a-z by modifying the

364

L. Chen et al. / European Journal of Medicinal Chemistry 143 (2018) 361e375

Fig. 2. Inhibition of TNF-

a

production by compounds. Mouse peritoneal macrophages (MPMs) were pretreated with compounds (10

m

M) for 30 min, incubated with LPS (0.5

secretion. (B) Effects of

a secretion. *p < 0.05 and **p < 0.01 vs. LPS alone.

mg/

mL) for 24 h, and conditioned media determined for cytokines; mean SEM are shown as experimental/LPS. (A) Effects of compounds 8a-z on TNF-

compounds 10a-v on TNF- secretion. (C) Effects of different concentration of compounds 5, 10s, and 10t on TNF-

a

8a. And analogs 8b-e, with one of the hydroxyl-substituent either

removed or replaced by methoxy group, were slightly less effective

inhibitors. Generally, analogs incorporated with electron-donating

methoxy groups at meta- or para-position (8f, 8g, 8i, 8j) barely

affected the inhibitory potency. However, introducing methoxy-

substituent at ortho-position (8h, 8k-m) led to a dramatic loss of

activity. In addition, azo heterocycles such as pyridine (8p) and

thiazol (8r) were more favored than thiophen (8q) and furan (8s).

Also, incorporating strong electron-withdrawing groups such as

the nitro (8n) and triﬂuoromethyl (8o) or bulky benzyloxy and

morpholin substitutions at the meta-position (8x-z) led to com-

plete loss in activity. Substitution of bulkier groups at the para-

position (8t-w) appeared to be tolerated.

lead compound, we further investigated the SAR of the linkers and

phenyl group (Ring B, Fig. 2B). Compound 10a, with a cyan-

substituted linker A, showed decreased activity. Moreover,

extending linker B (10b, 10c, 10h) or replacing the phenyl group

with long aliphatic chains (10d-g) or indole moiety (10p-q)

signiﬁcantly reduced the inhibition potency. This ﬁnding indicates

the utmost importance of the presence of the phenethyl moiety to

maintain anti-inﬂammatory activity. We next optimized the Ring B

(10i-o) to improve the inhibitory activity. Notably, compounds

incorporated with a hydroxy group (10i-j) displayed a signiﬁcantly

increased inhibition potency on LPS-stimulated expression of TNF-

a. Furthermore, the TNF-a inhibitory rate of compounds 10r-t,

which were incorporated with a tert-butyl and ethyl acetate side

Taking compound 8r (with 67.33% inhibition of TNF-

a

) as new

chains in the central region of molecule, was dramatically

L. Chen et al. / European Journal of Medicinal Chemistry 143 (2018) 361e375

365

improved, with 68.69%, 82.58% and 79.43% inhibitory rates,

2.4. In silico simulation of 10s and 10t bind to MD-2

respectively. Comparatively, their hydrolysis to carboxylic acids

10u-v led to decreased activity, indicating that a hydrophobic group

at this position was more preferred.

Collectively, the newly developed CAPE derivatives exhibit

exquisite SARs as shown in Fig. 3. According to these results,

compounds 10s and 10t were identiﬁed as the most effective in-

We performed molecular docking analysis to investigate the

binding mode between active compounds and MD2. In our simu-

lations, active compounds 10s and 10t ﬁtted into the MD2 pocket

and readily occupied a large portion of the LPS binding site

(Fig. 5AeB). Interestingly, the compounds bound to MD2 with a “Y

shaped” conﬁguration (Fig. 5C). Speciﬁcally, the methylthiazol

fragment stretcheds to the rim of MD2 pocket and formed a key

hydrogen bond with Lys-122 residue of MD2. And the 4-

hydroxyphenethyl group extended towards the MD2/TLR4* inter-

face, further forming a hydrogen bond with Glu-439 residue of

TLR4*. While the third part, the tert-butyl or ethyl acetate side

chain, inserted into the MD2 pocket, thereby interacting with the

inside hydrophobic residues such as Ile-153, Phe-151, and Ile-80.

hibitors against TNF-

a expression in LPS-challenged MPMs. We

further evaluated the dose-dependent effects of these compounds

using the same ELISA platform at different concentrations (0.5, 1.0,

2.5, 5.0 and 10

exhibited well-deﬁned dose-dependent inhibition and suppressed

LPS-induced TNF- release with low IC₅₀values (2.05 M and

3.19 M, respectively), verifying their anti-inﬂammatory potencies.

mM). As shown in Fig. 2C, compounds 10s and 10t

a

m

2.3. Interaction of active compound 10s with MD2

2.5. Compound 10s attenuated LPS-induced ALI in vivo

Several in vitro biochemical studies were performed to validate

the interaction between 10s and recombinant human MD2

(rhMD2) protein. The ﬂuorescent probe Bis-ANS is widely used for

the detection of hydrophobic binding sites of proteins including

MD2 [40]. Fig. 4A shows that the ﬂuorescence level of bis-ANS was

increased greatly when bound to rhMD2. However, co-incubation

The newly discovered MD2 inhibitor 10s and positive control 5

were next evaluated in the ALI rat model. C57/BL6 mice were

treated by intraperitoneal injection with 5 or 10s (15 mg/kg), and

after 30 min, were challenged with 5 mg/kg LPS by intratracheal

injection. As shown in Fig. 6A, LPS signiﬁcantly increased the total

cell count in the bronchoalveolar lavage ﬂuid (BALF) compared to

the control group, in which the administration of 10s effectively

prevented the increase. Moreover, compound 10s signiﬁcantly

inhibited LPS-induced increase in myeloperoxidase (MPO) activity

of lung tissue compared to LPS and 5-treated group, which indi-

cating lowered neutrophil inﬁltration in lung tissue (Fig. 6B).

with 10s (10

mM) potently inhibited the ﬂuorescence intensity

(48.0% inhibition) compared to 5 (25.3% inhibition), indicating the

displacement capacity of 10s in the rhMD2 pocket. Competition

between 10s and LPS in binding to rhMD2 was evaluated with a

biotin-streptavidin-based ELISA. As shown in Fig. 4B, co-incubation

with 10s dose-dependently reduced the amount of biotin-LPS

binding to MD2, suggesting that 10s successfully occupied the

MD2 binding sites of LPS. Subsequently, the interaction between

10s and rhMD2 protein was determined by surface plasmon reso-

nance (SPR) analysis. As shown in Fig. 4CeD, 10s exhibited speciﬁc

binding to rhMD2 protein in a dose-dependent manner with a low

Cytokines TNF-a and IL-6 are known critical factors in the early

phase of ALI, and contribute to the promotion of inﬂammation in

ALI [41]. Thus, the level of these pro-inﬂammatory cytokines were

measured to conﬁrm the efﬁcacy of 10s in vivo. As shown in

Fig. 6CeF, treatment with 10s at a dosage of 20 mg/kg suppressed

the LPS-induced cytokine levels signiﬁcantly both in the BALF and

plasma more effectively for the most part than treatment with 5.

LPS exposure also increased the mRNA expression of inﬂammatory

cytokines in lung tissues, and the administration with 10s pre-

vented the increased tissue mRNA (Fig. 6GeH).

Histological evaluation of the rat lungs challenged with LPS

revealed typical histopathological alterations of ALI, including

interstitial edema, pulmonary congestion, inﬂammatory inﬁltra-

tion, thicken alveolar septa, and lung tissue destruction [42]

(Fig. 6I). Moreover, lungs form LPS-challenged rats showed

K_Dvalue of 32 mM, but as expected, not with TLR4.

We further investigated the ability of 10s to compete off LPS

binding to MD2 at the cell level Macrophages were treated with

FITC-labeled LPS with or without 10s pretreatment and ﬂuorescent

cells analyzed by ﬂow cytometry. Pre-incubation with 10s signiﬁ-

cantly inhibited FITC-LPS binding to the cell surface (Fig. 4E). In

addition, co-immunoprecipitation analysis indicated that 10s

(10 mM) potently inhibited dimerization of the TLR4-MD2 complex

in LPS-activated macrophages (Fig. 4F), revealing that 10s potently

inhibited the interaction between LPS and secreted MD2 at the

cellular level.

increased immumohistochemical staining for TNF-a and CD68, the

latter a marker protein for macrophages (Fig. 6I). The treatment

with 10s markedly reduced these pathological changes associated

with ALI (Fig. 6I). Collectively, these results indicated that 10s was

protective against pulmonary inﬂammation in vivo, compared to

the lead compound 5, providing evidence that 10s is a promising

candidate with a novel chemical scaffold for treatment of ALI and

potentially other inﬂammatory injuries.

3. Conclusions

Acute inﬂammatory diseases remain the main cause of mortality

worldwide and lack an efﬁcient treatment in the clinical setting

[43]. Both pharmacological and genetic studies demonstrated that

MD2 inhibition could suppress LPS-induced inﬂammatory re-

sponses and the development of organ injury. Thus, small mole-

cules directly targeting MD2 to block the binding of LPS to MD2/

TLR4 complex is attractive as potential pharmacological therapy for

inﬂammatory disorders [44]. However, after the lipid-like TLR4/

MD2 antagonist eritoran failed in Phase 3 clinical study, there have

been no MD2 inhibitors currently entered in clinical trials for

Fig. 3. Structure activity relation analysis (SAR) summary. Shown is compound 10s

with arrows indicating modiﬁcation sites; relative activity of modiﬁcations is indicated

in light blue rectangles. (For interpretation of the references to colour in this ﬁgure

legend, the reader is referred to the web version of this article.)

366

L. Chen et al. / European Journal of Medicinal Chemistry 143 (2018) 361e375

Fig. 4. 10s inhibits LPS binding to MD2. (A) Effects of 5 or 10s on the binding of ﬂuorescent probe bis-ANS on MD2 (human recombinant MD2). (B) Effects of 10s on the in vitro

binding of biotin-conjugated LPS (biotin-LPS) on rhMD2; shown as mean SEM absorbance units. (C) Surface plasmon resonance (SPR) analysis (Materials and Methods) of the

binding kinetics of 10s with rhMD2 and with TLR4 (D). (E) Effects of 10s on binding of FITC-conjugated LPS (FITC-LPS) onto macrophage cell surface. Shown is representative ﬂow

cytometric analysis of ﬂuorescent cells. (F) Co-immunoprecipitation using anti-MD2 antibody on cell lysates from macrophages pretreated with 5 or 10s at 10

mM, followed by

stimulation with LPS (0.5

m

g/mL). Shown is representative Western blot detecting MD2 and TLR4; immunoprecipitated protein ¼ IP, immunoblotted protein ¼ IB.

treatment of acute inﬂammatory diseases.

host of biochemical experiments and molecular docking analysis

conﬁrmed the binding afﬁnity and active mode of 10s to MD2.

Particularly, novel MD2 inhibitor 10s showed more signiﬁcant

protective effect than lead compound 5 against LPS-induced ALI

in vivo. Taken together, this work provides new lead structures and

candidates as MD2 inhibitors for the development of anti-

inﬂammatory drugs.

An increasing number of reports during recent years reveal that

the biological activities of some non-lipid-like pure NPs are

attributed to speciﬁc interactions with MD2, providing a variety of

chemical scaffolds for developing new nontoxic MD2 inhibitors

[15]. Among them, Kim et al. [26] demonstrated that MD2 is a novel

anti-inﬂammatory target of compound 5, which is the main active

compound from propolis. In this study, we designed and modiﬁed

two series of compound 5 derivatives as MD2 inhibitors. Systematic

SAR studies in ring A, B and the linkers led to the most active

compound 10s, which displayed strong inhibitory efﬁcacy against

LPS-induced release of inﬂammatory cytokines. It is notable that

the tert-butyl acetate side chain of 10s provides crucial hydrophobic

interactions with MD2 pocket in the in silico simulation study. A

4. Experimental section

4.1. Chemistry

In general, commercial reagents, solvents, and other chemicals

were used without further puriﬁcation. Reagents for synthesis were

L. Chen et al. / European Journal of Medicinal Chemistry 143 (2018) 361e375

367

Fig. 5. Molecular docking analysis of 10s and 10t within the activity cavity of MD-2. (A) 10s and 10t overlapped with LPS in the of MD-2 cavity (PDB ID: 3FXI) (in boxed region).

(B) Enlarged view of the overlapped region of compounds (green or magenta) and LPS (gray). (C) The binding pose between compounds and MD-2 (pale cyan) at the MD2-TLR4

interface showing interactions with speciﬁc residues; hydrogen bond ¼ red dash line. (For interpretation of the references to colour in this ﬁgure legend, the reader is referred to the

web version of this article.)

purchased from Aladdin and Sigma-Aldrich, whereas compound 5

was obtained from Selleck. Reactions were monitored by thin-layer

chromatography (TLC) using Kieselgel 60 F254 plates. Melting

points were measured on a Fisher-Johns melting apparatus. ¹H

NMR and ¹³C NMR spectra were collected on a Bruker 500 MHz

instrument. Electronspray ionization mass spectra in positive mode

(ESI-MS) results were obtained with a Bruker Esquire 3000t spec-

trometer. Chromatographic puriﬁcation was carried out on Silica

Gel 60 (E.Merck, 70e230 mesh). Analytical HPLC analyses were

performed on Agilent 1260 liquid chromatograph ﬁtted with an

Inertex-C18 column, with the purity of compounds >95%.

4.1.2. General procedure for synthesis of target compounds 8a-z

The target compounds 8a-z were prepared by condensation of

the corresponding

a

,

b-unsaturated acids (7a-z) and 2-

phenylethan-1-amine with the presence of 1-(3-dimethylamino-

propyl)-3-ethylcarbodiimide hydrochloride (EDC) and 1-

hydroxybenzotriazole (HOBT) in CH₂Cl₂[39]. Brieﬂy, a solution of

a, b-unsaturated acid (1 mmol), EDC$HCl (1.2 mmol) and HOBT

(1.5 mmol) were stirred in ice-bath. After 20 min, the amine

(1 mmol) in CH₂Cl₂was added dropwise, the mixture was stirred in

ice-bath for 1 h, and reacted at room temperature overnight. Af-

terwards, the mixture was extracted with CH₂Cl₂(3 ꢂ 25 mL),

washed with saturated NaHCO₃, dried over anhydrous Na₂SO₄and

concentrated. The resulting solid was puriﬁed by chromatography

over silica gel to give target compounds.

4.1.1. Synthesis of a, b-unsaturated acids 7a-z

7a-u were prepared by Knoevenagel condensation [45]. Brieﬂy,

5 mmol of different aldehydes (6a-u) and 10 mmol malonic acid

(1.04 g) were stirred at 90 ^ꢁC in 2 mL pyridine solvent overnight.

When the reaction was ﬁnished as monitored by TLC, 3 M HCl was

slowly dropped into the mixture until precipitation was complete.

The formed precipitate was collected by ﬁltration, washed with

cold water and dried in vacuum, yielding compounds 7a-u. In-

termediates 7c and 7d (1 mmol) was further reacted with different

substituted benzyl bromides (2.5 mmol) in CH₃CN with the pres-

ence of K₂CO₃(2.0 equiv), followed by hydrolysis in 1M NaOH for

1 h to give intermediates 7v-z, which were used in the next step

without further puriﬁcation.

4.1.2.1. (E)-3-(3,4-dihydroxyphenyl)-N-phenethylacrylamide

White powder, 85.5% yield, mp 152.7e153.4 ^ꢁC. ¹H NMR (500 MHz,

DMSO-d₆)

(8a).

d

9.337 (s, 1H, OH), 9.104 (s, 1H, OH), 8.055 (t, J ¼ 5.5 Hz,

1H, NH), 7.191e7.317 (m, 6H, HAr, CH¼CH), 6.947 (d, J ¼ 2.0 Hz, 1H,

H2), 6.836 (d, J ¼ 8.5 Hz, 1H, H5), 6.749 (d, J ¼ 8.0 Hz, 1H, H6), 6.325

(d, J ¼ 15.5 Hz, 1H, CH¼CH), 3.346e3.417 (m, 2H, CH₂), 2.774 (t,

J ¼ 7.5 Hz, 2H, CH₂). ¹³C NMR (125 MHz, DMSO-d₆)

d 165.3, 147.2,

145.5, 139.5, 139.0, 128.6 ꢂ 2, 128.3 ꢂ 2, 126.4, 126.0, 120.3, 118.5,

115.7, 113.8, 40.3, 35.2. ESI-MS m/z: 284.2 (M þ H)þ, calcd for

C₁₇H₁₇NO₃: 283.12.

368

L. Chen et al. / European Journal of Medicinal Chemistry 143 (2018) 361e375

Fig. 6. 10s protects against LPS-induced acute lung injury. C57/BL6 mice were treated by intraperitoneal injection with 5 or 10s (15 mg/kg), and after 30 min, were challenged

with 5 mg/kg LPS by intratracheal injection. (A) Total cellcount in BALF reported as mean SEM counts/ml. (B) Myeloperoxidase (MPO) activity of lung tissue reported as

mean SEM U/g. Cytokine content in BALF determined by ELISA, values reported as mean SEM pg/ml: (C) IL-6 and (D) TNF- . Cytokine content in plasma determined by ELISA,

values reported as mean SEM pg/ml: (E) IL-6 and (F) TNF- . Lung tissue content of (G) IL-6 mRNA and (H) TNF- mRNA; values normalized to housekeeping gene -actin, and

a

b

shown as mean SEM relative to LPS. (I) Representative histopathology of lung tissue stained with H&E (top panel), immunolocalization of CD68 (brown), marker protein for

macrophages (middle panel), and immunolocalization of TNF-

*p < 0.05, **p < 0.01 and ***p < 0.001, vs. LPS alone group). (For interpretation of the references to colour in this ﬁgure legend, the reader is referred to the web version of this

a

(brown); AeH: n ¼ 4e7 independent experiments (^#p < 0.05, ^##p < 0.01 and ^###p < 0.001, vs. control group.

article.)

4.1.2.2. (E)-3-(4-hydroxyphenyl)-N-phenethylacrylamide

White powder, 88.2% yield, mp 119.4.25e120.3 ^ꢁC. ¹H NMR

(500 MHz, DMSO-d₆)

(8b).

NMR (125 MHz, DMSO-d₆)

128.6 ꢂ 2, 128.3 ꢂ 2, 126.0, 125.9, 118.7, 115.7 ꢂ 2, 40.3, 35.2. ESI-MS

m/z: 268.2 (M þ H)þ, calcd for C₁₇H₁₇NO₂: 267.13.

d

165.3, 158.8, 139.5, 138.6, 129.1 ꢂ 2,

d

9.813 (s, 1H, OH), 8.041 (t, J ¼ 5.5 Hz, 1H,

NH), 7.383 (d, J ¼ 8.0 Hz, 2H, H2, H6), 7.191e7.338 (m, 6H, HAr,

CH¼CH), 6.791 (d, J ¼ 8.0 Hz, 2H, H3, H5), 6.399 (d, J ¼ 16.0 Hz, 1H,

CH¼CH), 3.382e3.422 (m, 2H, CH₂), 2.776 (t, J ¼ 7.5 Hz, 2H, CH₂). ¹³

C

4.1.2.3. (E)-3-(4-hydroxy-3-methoxyphenyl)-N-phenethylacrylamide

(8c). White powder, 76.5% yield, mp 146.1e148.3 ^ꢁC. ¹H NMR

L. Chen et al. / European Journal of Medicinal Chemistry 143 (2018) 361e375

369

(500 MHz, DMSO-d₆)

d

9.420 (s, 1H, OH), 8.038 (t, J ¼ 5.5 Hz, 1H,

J ¼ 9.0 Hz,1H, H5), 6.938 (d, J ¼ 9.0 Hz,1H, H6), 6.449 (d, J ¼ 16.0 Hz,

1H, CH¼CH), 6.057 (s, 2H, CH₂), 3.378e3.419 (m, 2H, CH₂), 2.769 (t,

NH), 7.191e7.317 (m, 6H, HAr, CH¼CH), 6.947 (d, J ¼ 1.0 Hz, 1H, H2),

6.987 (d, J ¼ 8.5 Hz, 1H, H5), 6.792 (d, J ¼ 8.5 Hz, 1H, H6), 6.435 (d,

J ¼ 15.5 Hz, 1H, CH¼CH), 3.805 (s, 3H, OCH₃), 3.387e3.427 (m, 2H,

CH₂), 2.776 (t, J ¼ 7.5 Hz, 2H, CH₂). ¹³C NMR (125 MHz, DMSO-d₆)

J ¼ 7.5 Hz, 2H, CH₂). ¹³C NMR (125 MHz, DMSO-d₆)

d 165.0, 148.3,

147.8, 139.4, 138.3, 129.2, 128.5 ꢂ 2, 128.2 ꢂ 2, 126.0, 123.1, 120.3,

108.5, 106.1, 101.3, 40.2, 35.1. ESI-MS m/z: 296.1 (M þ H)þ, calcd for

d

165.3, 148.2, 147.8, 139.5, 138.9, 128.6 ꢂ 2, 128.3 ꢂ 2, 126.4, 126.0,

C₁₈H₁₇NO₃: 295.12.

121.5, 118.9, 115.6, 110.8, 55.5, 40.2, 35.2. ESI-MS m/z: 298.2

(M þ H)þ, calcd for C₁₈H₁₉NO₃: 297.14.

4.1.2.10. (E)-N-phenethyl-3-(3,4,5-trimethoxyphenyl)acrylamide

(8j). White powder, 75.5% yield, mp 128.7e130.1 ^ꢁC. ¹H NMR

4.1.2.4. (E)-3-(3-hydroxy-4-methoxyphenyl)-N-phenethylacrylamide

(500 MHz, DMSO-d₆)

d

8.104 (t, J ¼ 5.5 Hz, 1H, NH), 7.362 (d,

(8d). Yellow powder, 75.0% yield, mp 154.4e156.3 ^ꢁC. ¹H NMR

J ¼ 16.0 Hz, 1H, CH¼CH), 7.196e7.322 (m, 5H, HAr), 6.888 (s, 2H, H2,

H6), 6.569 (d, J ¼ 15.5 Hz, 1H, CH¼CH), 3.814 (s, 6H, OCH₃), 3.687 (s,

3H, OCH₃), 3.405e3.445 (m, 2H, CH₂), 2.786 (t, J ¼ 7.5 Hz, 2H, CH₂).

(500 MHz, DMSO-d₆)

d

9.173 (s, 1H, OH), 8.098 (t, J ¼ 5.5 Hz, 1H,

NH), 7.194e7.319 (m, 6H, HAr, CH¼CH), 6.977 (d, J ¼ 1.0 Hz, 1H, H2),

6.951 (d, J ¼ 8.5 Hz, 1H, H5), 6.942 (d, J ¼ 8.5 Hz, 1H, H6), 6.384 (d,

J ¼ 16.0 Hz, 1H, CH¼CH), 3.795 (s, 3H, OCH₃), 3.380e3.421 (m, 2H,

CH₂), 2.776 (t, J ¼ 7.5 Hz, 2H, CH₂). ¹³C NMR (125 MHz, DMSO-d₆)

¹³C NMR (125 MHz, DMSO-d₆)

d

165.0, 153.0 ꢂ 2, 139.4, 138.6, 138.6,

130.5, 128.6 ꢂ 2, 128.3 ꢂ 2, 126.1, 121.6, 104.9 ꢂ 2, 60.1, 55.9 ꢂ 2,

40.2, 35.1. ESI-MS m/z: 342.1 (M þ H)þ, calcd for C₂₀H₂₃NO₄: 341.16.

d

165.2, 149.1, 146.7, 139.5, 138.6, 128.6 ꢂ 2, 128.3 ꢂ 2, 127.8, 126.0,

120.2, 119.5, 113.3, 112.1, 55.6, 40.3, 35.2. ESI-MS m/z: 298.1

(M þ H)þ, calcd for C₁₈H₁₉NO₃: 297.14.

4.1.2.11. (E)-N-phenethyl-3-(2,3,4-trimethoxyphenyl)acrylamide

(8k). Yellow gum, 58.5% yield. ¹H NMR (500 MHz, DMSO-d₆)

d 8.130

(t, J ¼ 5.5 Hz, 1H, NH), 7.528 (d, J ¼ 15.5 Hz, 1H, CH¼CH),

7.196e7.322 (m, 6H, HAr), 6.871 (d, J ¼ 9.0 Hz, 1H, H2), 6.560 (d,

J ¼ 15.5 Hz, 1H, CH¼CH), 3.831 (s, 3H, OCH₃), 3.807 (s, 3H, OCH₃),

3.765 (s, 3H, OCH₃), 3.394e3.434 (m, 2H, CH₂), 2.787 (t, J ¼ 7.5 Hz,

4.1.2.5. (E)-3-(3-bromo-4-hydroxy-5-methoxyphenyl)-N-phenethy-

lacrylamide (8e). White powder, 69.5% yield, mp 188.2e189.6 ^ꢁC. ¹H

NMR (500 MHz, DMSO-d₆)

d

9.862 (s, 1H, OH), 8.027 (t, J ¼ 5.5 Hz,

1H, NH), 7.187e7.312 (m, 7H, HAr, CH¼CH), 6.792 (s, 1H, H6), 6.501

(d, J ¼ 15.5 Hz, 1H, CH¼CH), 3.858 (s, 3H, OCH₃), 3.329e3.425 (m,

2H, CH₂), 2.768 (t, J ¼ 7.5 Hz, 2H, CH₂). ¹³C NMR (125 MHz, DMSO-

2H, CH₂). ¹³C NMR (125 MHz, DMSO-d₆)

d 165.3, 154.5, 152.2, 141.9,

139.5, 133.2, 128.6 ꢂ 2, 128.3 ꢂ 2, 126.0, 122.3, 121.4, 121.2, 108.5,

61.1, 60.4, 55.9, 40.3, 35.2. ESI-MS m/z: 342.1 (M þ H)þ, calcd for

d₆)

d

165.0, 148.5, 145.0, 139.4, 137.5, 128.6 ꢂ 2, 128.3 ꢂ 2, 127.4,

C₂₀H₂₃NO₄: 341.16.

126.0, 124.1, 120.7, 109.8, 109.5, 56.2, 40.2, 35.1. ESI-MS m/z: 376.1

(M þ H)þ, calcd for C₁₈H₁₈BrNO₃: 375.05.

4.1.2.12. (E)-N-phenethyl-3-(2,4,6-trimethoxyphenyl)acrylamide

(8l). White powder, 88.2% yield, mp 119.8e121.5 ^ꢁC. ¹H NMR

4.1.2.6. (E)-3-(4-methoxyphenyl)-N-phenethylacrylamide

White powder, 73.0% yield, mp 126.3e127.8 ^ꢁC. ¹H NMR (500 MHz,

DMSO-d₆)

(8f).

(500 MHz, DMSO-d₆)

d

8.009 (t, J ¼ 5.5 Hz, 1H, NH), 7.693 (d,

J ¼ 15.5 Hz, 1H, CH¼CH), 7.196e7.322 (m, 5H, HAr), 6.763 (d,

J ¼ 15.5 Hz, 1H, CH¼CH), 6.275 (s, 2H, H3, H5), 3.844 (s, 6H, OCH₃),

3.826 (s, 3H, OCH₃), 3.364e3.404 (m, 2H, CH₂), 2.769 (t, J ¼ 7.5 Hz,

d

8.087 (t, J ¼ 5.5 Hz, 1H, NH), 7.503 (d, J ¼ 9.0 Hz, 2H, H2,

H6), 7.373 (d, J ¼ 15.5 Hz, 1H, CH¼CH), 7.194e7.319 (m, 5H, HAr),

7.503 (d, J ¼ 8.5 Hz, 2H, H3, H5), 6.477 (d, J ¼ 16.0 Hz, 1H, CH¼CH),

3.789 (s, 3H, OCH₃), 3.329e3.433 (m, 2H, CH₂), 2.783 (t, J ¼ 7.5 Hz,

2H, CH₂). ¹³C NMR (125 MHz, DMSO-d₆)

d

166.7, 161.7, 160.2 ꢂ 2,

139.6, 129.3, 128.6 ꢂ 2, 128.3 ꢂ 2, 126.0, 121.5, 105.1, 90.9 ꢂ 2,

55.8 ꢂ 2, 55.4, 40.3, 35.3. ESI-MS m/z: 342.1 (M þ H)þ, calcd for

2H, CH₂). ¹³C NMR (125 MHz, DMSO-d₆)

d 165.2, 160.2, 139.5, 138.2,

129.0 ꢂ 2, 128.6 ꢂ 2, 128.3 ꢂ 2, 127.5, 126.0, 119.7, 114.3 ꢂ 2, 55.2,

C₂₀H₂₃NO₄: 341.16.

40.3, 35.2. ESI-MS m/z: 282.1 (M þ H)þ, calcd for C₁₈H₁₉NO₂: 281.14.

4.1.2.13. (E)-N-phenethyl-3-(2,4,5-trimethoxyphenyl)acrylamide

4.1.2.7. (E)-3-(3,4-dimethoxyphenyl)-N-phenethylacrylamide (8g).

White powder, 70.2% yield, mp 119.8e121.3 ^ꢁC. ¹H NMR (500 MHz,

(8m). White powder, 54.0% yield, mp 129.5e130.3 ^ꢁC. ¹H NMR

(500 MHz, DMSO-d₆)

d

8.018 (t, J ¼ 5.5 Hz, 1H, NH), 7.613 (d,

DMSO-d₆)

d

8.066 (t, J ¼ 5.5 Hz, 1H, NH), 7.358 (d, J ¼ 16.0 Hz, 1H,

J ¼ 16.0 Hz, 1H, CH¼CH), 7.193e7.319 (m, 5H, HAr), 7.063 (s, 1H, H6),

6.720 (s, 1H, H3), 6.508 (d, J ¼ 16.0 Hz, 1H, CH¼CH), 3.851 (s, 3H,

OCH₃), 3.840 (s, 3H, OCH₃), 3.742 (s, 3H, OCH₃), 3.387e3.427 (m, 2H,

CH₂), 2.776 (t, J ¼ 7.5 Hz, 2H, CH₂). ¹³C NMR (125 MHz, DMSO-d₆)

CH¼CH), 7.196e7.342 (m, 5H, HAr), 7.149 (s, 1H, H2), 7.107 (d,

J ¼ 9.0 Hz,1H, H5), 6.981 (d, J ¼ 9.0 Hz,1H, H6), 6.494 (d, J ¼ 16.0 Hz,

1H, CH¼CH), 3.798 (s, 3H, OCH₃), 3.787 (s, 3H, OCH₃), 3.397e3.437

(m, 2H, CH₂), 2.783 (t, J ¼ 7.5 Hz, 2H, CH₂). ¹³C NMR (125 MHz,

d

166.1, 153.3, 151.7, 143.4, 140.0, 133.7, 129.1 ꢂ 2, 128.8 ꢂ 2, 126.5,

DMSO-d₆)

d

165.1, 150.0, 148.8, 139.4, 138.5, 128.5 ꢂ 2, 128.2 ꢂ 2,

120.3,115.1,111.3, 98.5, 56.8, 56.6, 56.3, 40.7, 35.7. ESI-MS m/z: 342.3

(M þ H)þ, calcd for C₂₀H₂₃NO₄: 341.16.

127.7, 126.0, 121.2, 119.9, 111.7, 110.0, 55.5, 55.4, 40.2, 35.1. ESI-MS m/

z: 312.1 (M þ H)þ, calcd for C₁₉H₂₁NO₃: 311.15.

4.1.2.14. (E)-3-(4-nitrophenyl)-N-phenethylacrylamide

Yellow powder, 58.0% yield, mp 183.5e185.1 ^ꢁC. ¹H NMR (500 MHz,

DMSO-d₆)

(8n).

4.1.2.8. (E)-3-(2,3-diethoxyphenyl)-N-phenethylacrylamide

White powder, 62.5% yield, mp 145.9e147.3 ^ꢁC. ¹H NMR (500 MHz,

DMSO-d₆)

(8h).

d

8.355 (t, J ¼ 5.5 Hz, 1H, NH), 8.256 (d, J ¼ 8.0 Hz, 2H, H3,

d

8.205 (t, J ¼ 5.5 Hz, 1H, NH), 7.628 (d, J ¼ 16.0 Hz, 1H,

H5), 7.829 (d, J ¼ 8.0 Hz, 2H, H2, H6), 7.531 (d, J ¼ 16.0 Hz, 1H,

CH¼CH), 7.198e7.323 (m, 5H, HAr), 6.813 (d, J ¼ 16.0 Hz, 1H,

CH¼CH), 3.422e3.463 (m, 2H, CH₂), 2.798 (t, J ¼ 7.5 Hz, 2H, CH₂).

CH¼CH), 7.062e7.323 (m, 8H, HAr), 6.638 (d, J ¼ 16.0 Hz, 1H,

CH¼CH), 3.827 (s, 3H, OCH₃), 3.749 (s, 3H, OCH₃), 3.401e3.441 (m,

2H, CH₂), 2.792 (t, J ¼ 7.5 Hz, 2H, CH₂). ¹³C NMR (125 MHz, DMSO-

¹³C NMR (125 MHz, DMSO-d₆)

d 164.2, 147.5, 141.5, 139.3, 136.2,

d₆)

d

165.0, 152.8, 147.4, 139.5, 132.9, 128.6 ꢂ 2, 128.5, 128.3 ꢂ 2,

128.6 ꢂ 2, 128.5 ꢂ 2, 128.3 ꢂ 2, 126.5, 126.1, 124.0 ꢂ 2, 40.4, 35.0.

126.1, 124.3, 123.4, 118.5, 113.8, 60.6, 55.8, 40.3, 35.1. ESI-MS m/z:

312.1 (M þ H)þ, calcd for C₁₉H₂₁NO₃: 311.15.

ESI-MS m/z: 297.1 (M þ H)þ, calcd for C₁₇H₁₆N₂O₃: 296.12.

4.1.2.15. (E)-N-phenethyl-3-(4-(triﬂuoromethyl)phenyl)acrylamide

(8o). White powder, 88.2% yield, mp 169.3e170.7 ^ꢁC. ¹H NMR

(500 MHz, DMSO-d₆)

4.1.2.9. (E)-3-(benzo[d][1,3]dioxol-5-yl)-N-phenethylacrylamide (8i).

White powder, 84.8% yield, mp 133.8e136.0 ^ꢁC. ¹H NMR (500 MHz,

d

8.299 (t, J ¼ 5.5 Hz, 1H, NH), 7.774 (d,

DMSO-d₆)

d

8.066 (t, J ¼ 5.5 Hz, 1H, NH), 7.328 (d, J ¼ 16.0 Hz, 1H,

J ¼ 8.0 Hz, 2H, H2, H6), 7.756 (d, J ¼ 8.0 Hz, 2H, H3, H5), 7.491 (d,

CH¼CH), 7.186e7.312 (m, 5H, HAr), 7.128 (s, 1H, H2), 7.052 (d,

J ¼ 16.0 Hz, 1H, CH¼CH), 7.199e7.324 (m, 5H, HAr), 6.758 (d,

370

L. Chen et al. / European Journal of Medicinal Chemistry 143 (2018) 361e375

J ¼ 15.5 Hz, 1H, CH¼CH), 3.417e3.458 (m, 2H, CH₂), 2.796 (t,

morpholin), 3.382e3.422 (m, 2H, CH₂), 3.179 (t, J ¼ 5.0 Hz, 4H,

morpholin), 2.775 (t, J ¼ 7.5 Hz, 2H, CH₂). ¹³C NMR (125 MHz,

J ¼ 7.5 Hz, 2H, CH₂). ¹³C NMR (125 MHz, DMSO-d₆)

d 164.4, 139.4,

139.0, 136.9, 128.6 ꢂ 2, 128.3 ꢂ 2, 128.1 ꢂ 2, 126.1, 125.8, 125.7,

125.0 ꢂ 2, 123.01, 40.3, 35.0. ESI-MS m/z: 319.9 (M þ H)þ, calcd for

DMSO-d₆)

d

165.4, 151.7, 139.5, 138.5, 128.6 ꢂ 2, 128.6 ꢂ 2, 128.3 ꢂ 2,

126.0, 125.3, 118.3, 114.5 ꢂ 2, 65.9 ꢂ 2, 47.6 ꢂ 2, 40.3, 35.2. ESI-MS

C

₁₈H₁₆F₃NO: 319.12.

m/z: 337.1 (M þ H)þ, calcd for C₂₁H₂₄N₂O₂: 336.18.

4.1.2.16. (E)-N-phenethyl-3-(pyridin-3-yl)acrylamide

White powder, 50.8% yield, mp 91.3e93.4 ^ꢁC. ¹H NMR (500 MHz,

DMSO-d₆)

(8p).

4.1.2.22. (E)-3-(4-(benzyloxy)-3-methoxyphenyl)-N-phenethylacry-

lamide (8v). White powder, 43.8% yield, mp 139.5e141.0 ^ꢁC. ¹H

d

8.752 (s, 1H, pyridine-H2), 8.549 (d, J ¼ 5.0 Hz, 1H,

NMR (500 MHz, DMSO-d₆)

d

8.052 (t, J ¼ 5.5 Hz, 1H, NH),

pyridine-H4), 8.271 (t, J ¼ 5.5 Hz, 1H, NH), 7.977 (d, J ¼ 8.0 Hz, 1H,

pyridine-H6), 7.463 (d, J ¼ 15.5 Hz, 1H, CH¼CH), 7.438 (t, J ¼ 5.0 Hz,

1H, pyridine-H5), 7.196e7.321 (m, 5H, HAr), 6.730 (d, J ¼ 16.0 Hz,

1H, CH¼CH), 3.412e3.453 (m, 2H, CH₂), 2.793 (t, J ¼ 7.5 Hz, 2H,

7.053e7.445 (m, 14H, HAr, CH¼CH), 6.508 (d, J ¼ 15.5 Hz, 1H,

CH¼CH), 5.125 (s, 2H, OCH₂), 3.818 (s, 3H, OCH₃), 3.402e3.427 (m,

2H, CH₂), 2.786 (t, J ¼ 7.5 Hz, 2H, CH₂). ¹³C NMR (125 MHz, DMSO-

d₆)

d

165.2, 149.3, 149.0, 139.5, 138.5, 136.9, 128.6 ꢂ 2, 128.4 ꢂ 2,

CH₂). ¹³C NMR (125 MHz, DMSO-d₆)

d 164.5, 150.0, 149.0, 139.4,

128.3 ꢂ 2, 128.1, 127.9, 127.7 ꢂ 2, 126.0, 121.1, 120.2, 113.5, 110.4,

135.2,133.9,130.7,128.6 ꢂ 2,128.3 ꢂ 2,126.1,124.2,123.9, 40.3, 35.1.

69.9, 55.5, 40.2, 35.2. ESI-MS m/z: 388.1 (M þ H)þ, calcd for

ESI-MS m/z: 252.7 (M þ H)þ, calcd for C₁₆H₁₆N₂O: 252.13.

C₂₅H₂₅NO₃: 387.18.

4.1.2.17. (E)-3-(5-methylthiophen-2-yl)-N-phenethylacrylamide (8q).

White powder, 62.2% yield,3 mp 143.9e145.5 ^ꢁC. ¹H NMR

4.1.2.23. (E)-3-(3-methoxy-4-((4-methylbenzyl)oxy)phenyl)-N-phe-

nethylacrylamide (8w). White powder, 49.0% yield, mp

(500 MHz, DMSO-d₆)

d

8.142 (t, J ¼ 5.5 Hz, 1H, NH), 7.478 (d,

152.3e154.3 ^ꢁC. ¹H NMR (500 MHz, DMSO-d₆)

d

8.074 (t, J ¼ 5.5 Hz,

J ¼ 15.5 Hz, 1H, CH¼CH), 7.151e7.315 (m, 5H, HAr), 7.154 (d,

J ¼ 3.0 Hz, 1H, thiophen-H3), 6.794 (d, J ¼ 3.0 Hz, 1H, thiophen-H4),

6.231 (d, J ¼ 15.0 Hz, 1H, CH¼CH), 3.372e3.413 (m, 2H, CH₂), 2.764

(t, J ¼ 7.5 Hz, 2H, CH₂), 2.453 (s, 3H, CH₃). ¹³C NMR (125 MHz,

1H, NH), 7.037e7.370 (m, 13H, HAr, CH¼CH), 6.502 (d, J ¼ 16.0 Hz,

1H, CH¼CH), 5.069 (s, 2H, OCH₂), 3.804 (s, 3H, OCH₃), 3.348e3.437

(m, 2H, CH₂), 2.782 (t, J ¼ 7.5 Hz, 2H, CH₂), 2.311 (s, 3H, CH₃). ¹³

C

NMR (125 MHz, DMSO-d₆)

d 165.2, 149.2, 149.0, 139.5, 138.5, 137.1,

DMSO-d₆)

d

164.7, 141.7, 139.4, 137.8, 131.9, 130.9, 128.6 ꢂ 2,

133.8, 128.9 ꢂ 2, 128.6 ꢂ 2, 128.3 ꢂ 2, 128.0, 127.9 ꢂ 2, 126.0, 121.2,

120.1, 113.4, 110.3, 69.7, 55.5, 40.2, 35.1, 20.7. ESI-MS m/z: 402.2

(M þ H)þ, calcd for C₂₆H₂₇NO₃: 401.20.

128.3 ꢂ 2, 126.7, 126.1, 119.6, 40.3, 35.1, 15.3. ESI-MS m/z: 271.8

(M þ H)þ, calcd for C₁₆H₁₇NOS: 271.10.

4.1.2.18. (E)-3-(4-methylthiazol-5-yl)-N-phenethylacrylamide (8r).

White powder, 75.8% yield, mp 109.4e111.2 ^ꢁC. ¹H NMR (500 MHz,

4.1.2.24. (E)-3-(3-(benzyloxy)-4-methoxyphenyl)-N-phenethylacry-

lamide (8x). White powder, 53.5% yield, mp 183.7e184.5 ^ꢁC. ¹H

DMSO-d₆)

d

8.998 (s, 1H, thiazol-H2), 8.230 (t, J ¼ 5.5 Hz, 1H, NH),

7.553 (d, J ¼ 15.5 Hz, 1H, CH¼CH), 7.192e7.316 (m, 5H, HAr), 6.331

(d, J ¼ 15.0 Hz, 1H, CH¼CH), 3.357e3.432 (m, 2H, CH₂), 2.771 (t,

J ¼ 7.5 Hz, 2H, CH₂), 2.493 (s, 3H, CH₃). ¹³C NMR (125 MHz, DMSO-

NMR (500 MHz, DMSO-d₆)

d

8.055 (t, J ¼ 5.5 Hz, 1H, NH),

7.006e7.479 (m, 14H, HAr, CH¼CH), 6.483 (d, J ¼ 15.5 Hz, 1H,

CH¼CH), 5.126 (s, 2H, OCH₂), 3.805 (s, 3H, OCH₃), 3.400e3.438 (m,

2H, CH₂), 2.786 (t, J ¼ 7.5 Hz, 2H, CH₂). ¹³C NMR (125 MHz, DMSO-

d₆)

d

164.3, 153.8, 153.2, 153.1, 139.4, 128.6 ꢂ 2, 128.3 ꢂ 2, 127.9,

126.1, 124.0, 40.3, 35.0, 15.2. ESI-MS m/z: 273.1 (M þ H)þ, calcd for

₁₅H₁₆N₂OS: 272.10.

d₆)

d

165.2, 150.4, 147.9, 139.5, 138.80, 138.5, 136.9, 128.6 ꢂ 2,

C

128.4 ꢂ 2, 128.3 ꢂ 2, 127.8 ꢂ 2, 127.7, 126.0, 121.6, 120.0, 112.2, 112.1,

69.9, 55.7, 40.3, 35.2. ESI-MS m/z: 388.1 (M þ H)þ, calcd for

4.1.2.19. (E)-3-(5-methylfuran-2-yl)-N-phenethylacrylamide

Yellow powder, 84.2% yield, mp 102.5e103.5 ^ꢁC. ¹H NMR (500 MHz,

DMSO-d₆)

(8s).

C₂₅H₂₅NO₃: 387.18.

d

8.152 (t, J ¼ 5.5 Hz, 1H, NH), 7.189e7.313 (m, 5H, HAr),

4.1.2.25. (E)-3-(4-methoxy-3-((4-methylbenzyl)oxy)phenyl)-N-phe-

nethylacrylamide (8y). White powder, 57.7% yield, mp

7.143 (d, J ¼ 15.5 Hz,1H, CH¼CH), 6.638 (d, J ¼ 3.0 Hz,1H, furan-H3),

6.317 (d, J ¼ 15.5 Hz,1H, CH¼CH), 6.206 (d, J ¼ 3.0 Hz,1H, furan-H4),

3.379e3.408 (m, 2H, CH₂), 2.759 (t, J ¼ 7.5 Hz, 2H, CH₂), 2.310 (s, 3H,

115.6e117.8 ^ꢁC. ¹H NMR (500 MHz, DMSO-d₆)

d

8.050 (t, J ¼ 5.5 Hz,

1H, NH), 7.203e7.356 (m, 11H, HAr, CH¼CH), 7.121 (d, J ¼ 9.0 Hz, 1H,

H5), 7.001 (d, J ¼ 8.5 Hz, 1H, H6), 6.480 (d, J ¼ 16.0 Hz, 1H, CH¼CH),

5.073 (s, 2H, OCH₂), 3.795 (s, 3H, OCH₃), 3.398e3.437 (m, 2H, CH₂),

2.786 (t, J ¼ 7.5 Hz, 2H, CH₂), 2.317 (s, 3H, CH₃). ¹³C NMR (125 MHz,

CH₃). ¹³C NMR (125 MHz, DMSO-d₆)

d 164.9, 153.9, 149.6, 139.4,

128.6 ꢂ 2, 128.3 ꢂ 2, 126.0, 125.9, 117.9, 115.0, 108.7, 40.3, 35.1, 13.4.

ESI-MS m/z: 256.1 (M þ H)þ, calcd for C₁₆H₁₇NO₂: 255.13.

DMSO-d₆)

d

165.2, 150.4, 147.9, 139.5, 138.5, 137.1, 133.9, 128.9 ꢂ 2,

4.1.2.20. (E)-3-(4-(allyloxy)phenyl)-N-phenethylacrylamide

White powder, 66.0% yield, mp 130.0e130.8 ^ꢁC. ¹H NMR (500 MHz,

DMSO-d₆)

(8t).

128.6 ꢂ 2, 128.3 ꢂ 2, 127.9 ꢂ 2, 127.7, 126.0, 122.8, 121.5, 120.0, 112.1,

69.8, 55.6, 40.2, 35.2, 20.7. ESI-MS m/z: 402.2 (M þ H)þ, calcd for

d

8.091 (t, J ¼ 5.5 Hz, 1H, NH), 7.492 (d, J ¼ 9.0 Hz, 2H, H2,

C₂₆H₂₇NO₃: 401.20.

H6), 7.373 (d, J ¼ 16.0 Hz, 1H, CH¼CH), 7.194e7.319 (m, 5H, HAr),

6.986 (d, J ¼ 9.0 Hz, 2H, H3, H5), 6.473 (d, J ¼ 16.0 Hz, 1H, CH¼CH),

6.009e6.065 (m, 1H, CH₂¼CH), 5.404 (d, J ¼ 17.0 Hz, 1H, CH₂¼CH),

5.273 (d, J ¼ 10.5 Hz, 1H, CH₂¼CH), 4.607 (d, J ¼ 5.5 Hz, 2H, OCH₂),

3.389e3.430 (m, 2H, CH₂), 2.781 (t, J ¼ 7.5 Hz, 2H, CH₂). ¹³C NMR

4.1.2.26. (E)-3-(3-((3,5-dimethoxybenzyl)oxy)-4-methoxyphenyl)-

N-phenethylacrylamide (8z). White powder, 37.6% yield, mp

168.5e170.2 ^ꢁC. ¹H NMR (500 MHz, DMSO-d₆)

d

8.044 (t, J ¼ 5.5 Hz,

(125 MHz, DMSO-d₆)

d

165.2, 159.2, 139.5, 138.1, 133.5, 129.0 ꢂ 2,

1H, NH), 7.196e7.348 (m, 7H, HAr, CH¼CH), 7.136 (d, J ¼ 8.5 Hz, 1H,

H5), 7.016 (d, J ¼ 8.5 Hz, 1H, H6), 6.624 (s, 2H, H⁰2, H⁰6), 6.483 (d,

J ¼ 15.5 Hz, 1H, CH¼CH), 6.466 (s, 1H, H⁰4), 5.063 (s, 2H, OCH₂),

3.815 (s, 3H, OCH₃), 3.751 (s, 6H, OCH₃), 3.398e3.434 (m, 2H, CH₂),

128.6 ꢂ 2, 128.3 ꢂ 2, 127.6, 126.0, 119.8, 117.6, 115.0 ꢂ 2, 68.2, 40.3,

35.2. ESI-MS m/z: 308.1 (M þ H)þ, calcd for C₂₀H₂₁NO₂: 307.16.

4.1.2.21. (E)-3-(4-morpholinophenyl)-N-phenethylacrylamide (8u).

Yellow powder, 55.6% yield, mp 173.7e175.2 ^ꢁC. ¹H NMR (500 MHz,

2.783 (t, J ¼ 7.5 Hz, 2H, CH₂). ¹³C NMR (125 MHz, DMSO-d₆)

d 165.2,

160.5 ꢂ 2, 150.5,147.8,139.5,139.3,138.4,128.6 ꢂ 2,128.3 ꢂ 2,127.7,

126.0, 121.5, 120.1, 112.3, 112.2, 105.6 ꢂ 2, 99.4, 69.8, 55.7, 55.2 ꢂ 2,

40.2, 35.2. ESI-MS m/z: 448.2 (M þ H)þ, calcd for C₂₇H₂₉NO₅:

447.20.

DMSO-d₆)

d

8.032 (t, J ¼ 5.5 Hz, 1H, NH), 7.416 (d, J ¼ 9.5 Hz, 2H, H2,

H6), 7.194e7.319 (m, 6H, HAr, CH¼CH), 6.955 (d, J ¼ 9.5 Hz, 2H, H3,

H5), 6.414 (d, J ¼ 15.5 Hz, 1H, CH¼CH), 3.736 (t, J ¼ 5.0 Hz, 4H,

L. Chen et al. / European Journal of Medicinal Chemistry 143 (2018) 361e375

371

4.1.3. Synthesis of (E)-2-cyano-3-(4-methylthiazol-5-yl)acrylic acid

(9a)

4.1.4.5. (E)-3-(4-methylthiazol-5-yl)-N-octylacrylamide

(10e).

White solid, 68.7% yield, mp 47.5e48.3 ^ꢁC. ¹H NMR (500 MHz,

Compound 9a was synthesized by following a Knoevenagel-

Doebner condensation [46]. (381 mg, 3 mmol) 4-methylthiazole-

5-carbaldehyde (6r) and cyanoacetic acid (516 mg, 6 mmol),

anhydrous pyridine (2 mL), piperidine (3 drops) were reﬂuxed

overnight. Then 3 M HCl was dropped into the mixture until pre-

cipitation was complete. The formed precipitate was collected by

ﬁltration, washed with cold water and dried in vacuum to provide

9a. Yellow powder, 89.5% yield. ¹H NMR (500 MHz, DMSO-d₆)

DMSO-d₆)

d

8.990 (s, 1H, thiazol-H2), 8.092 (t, J ¼ 5.0 Hz, 1H, NH),

7.544 (d, J ¼ 15.5 Hz,1H, CH¼CH), 6.344 (d, J ¼ 15.5 Hz,1H, CH¼CH),

3.123e3.162 (m, 2H, CH₂), 2.458 (s, 3H, CH₃), 1.413e1.439 (m, 2H,

CH₂), 1.201e1.266 (m, 10H, CH₂), 0.854 (t, J ¼ 7.0 Hz, 3H, CH₃). ¹³

C

NMR (125 MHz, DMSO-d₆)

d 164.1, 153.6, 153.1, 128.3, 127.7, 124.2,

38.6, 31.2, 29.0, 28.7, 28.6, 26.4, 22.0, 15.2, 13.9. ESI-MS m/z: 281.1

(M þ H)þ, calcd for C₁₅H₂₄N₂OS: 280.16.

d

9.412 (s, 1H), 8.397 (s, 1H), 2.630 (s, 3H). ¹³C NMR (125 MHz,

DMSO-d₆) 163.2, 162.9, 159.6, 143.6, 124.7, 115.7, 101.8, 15.9.

4.1.4.6. (E)-3-(4-methylthiazol-5-yl)-N-nonylacrylamide

White solid, 66.5% yield, mp 50.8e52.0 ^ꢁC. ¹H NMR (500 MHz,

DMSO-d₆)

(10f).

d

Chemical Formula: C₈H₆N₂O₂S.

d

8.996 (s, 1H, thiazol-H2), 8.100 (t, J ¼ 5.0 Hz, 1H, NH),

7.535 (d, J ¼ 15.5 Hz,1H, CH¼CH), 6.336 (d, J ¼ 15.5 Hz,1H, CH¼CH),

3.129e3.168 (m, 2H, CH₂), 2.464 (s, 3H, CH₃), 1.419e1.434 (m, 2H,

4.1.4. General procedure for synthesis of target compounds 10a-v

Similarly, (E)-2-cyano-3-(4-methylthiazol-5-yl)acrylic acid (9a)

was condensed with 2-phenylethan-1-amine, yielding target

compound 10a. While target compounds 10b-t were prepared by

condensation of (E)-3-(4-methylthiazol-5-yl)acrylic acid (7r) with

various amines (9b-t). Subsequently, hydrolysis of esters 10r-s in

MeOH (10 mL) with 0.5 mL 1M NaOH to yield target compounds

10u-v.The resulting mixture was extracted with CH₂Cl₂(3 ꢂ 25 mL),

washed with saturated NaHCO₃and puriﬁed by chromatography

over silica gel.

CH₂), 1.201e1.306 (m, 12H, CH₂), 0.854 (t, J ¼ 7.0 Hz, 3H, CH₃). ¹³

C

NMR (125 MHz, DMSO-d₆)

d 164.1, 153.6, 153.0, 128.3, 127.7, 124.2,

38.6, 31.2, 29.0, 28.9, 28.7, 28.6, 26.4, 22.0, 15.2, 13.9. ESI-MS m/z:

295.1 (M þ H)þ, calcd for C₁₆H₂₆N₂OS: 294.18.

4.1.4.7. (E)-N-decyl-3-(4-methylthiazol-5-yl)acrylamide

White solid, 48.7% yield, mp 56.9e57.8 ^ꢁC. ¹H NMR (500 MHz,

DMSO-d₆)

(10g).

d

8.998 (s, 1H, thiazol-H2), 8.099 (t, J ¼ 5.0 Hz, 1H, NH),

7.535 (d, J ¼ 15.5 Hz,1H, CH¼CH), 6.336 (d, J ¼ 15.0 Hz,1H, CH¼CH),

3.129e3.168 (m, 2H, CH₂), 2.465 (s, 3H, CH₃), 1.419e1.444 (m, 2H,

CH₂), 1.207e1.301 (m, 14H, CH₂), 0.853 (t, J ¼ 7.0 Hz, 3H, CH₃). ¹³

C

4.1.4.1. (E)-2-Cyano-3-(4-methylthiazol-5-yl)-N-phenethylacryla-

NMR (125 MHz, DMSO-d₆)

d 164.1, 153.6, 153.1, 128.3, 127.7, 124.2,

mide (10a). Yellow powder, 70.5% yield, mp 137.0e139.2 ^ꢁC. ¹H

38.6, 31.2, 29.0, 28.9, 28.9, 28.7, 28.6, 26.4, 22.0, 15.2, 13.9 ESI-MS m/

z: 309.5 (M þ H)þ, calcd for C₁₇H₂₈N₂OS: 308.48.

NMR (500 MHz, DMSO-d₆)

d 9.353 (s, 1H, thiazol-H2), 8.619 (t,

J ¼ 5.0 Hz, 1H, NH), 8.264 (s, 1H, CH¼C), 7.204e7.328 (m, 5H, HAr),

3.423e3.463 (m, 2H, CH₂), 2.827 (t, J ¼ 7.0 Hz, 2H, CH₂), 2.612 (s, 3H,

4.1.4.8. (E)-3-(4-methylthiazol-5-yl)-1-(4-phenylpiperidin-1-yl)

CH₃). ¹³C NMR (125 MHz, DMSO-d₆)

d 161.8, 160.6, 158.5, 139.8,

prop-2-en-1-one

(10h). White

solid,

43.5%

yield,

mp

139.2, 128.6 ꢂ 2, 128.3 ꢂ 2, 126.2, 124.8, 116.1, 104.7, 41.3, 34.8, 15.9.

128.6e130.4 ^ꢁC. ¹H NMR (500 MHz, DMSO-d₆)

d

9.025 (s, 1H,

ESI-MS m/z: 298.1 (M þ H)þ, calcd for C₁₆H₁₅N₃O_S: 297.09.

thiazol-H2), 7.669 (d, J ¼ 15.0 Hz, 1H, CH¼CH), 7.180e7.310 (m, 5H,

HAr), 6.908 (d, J ¼ 15.0 Hz, 1H, CH¼CH), 4.634 (d, J ¼ 10.5 Hz, 1H,

piperidin), 4.293 (d, J ¼ 12.0 Hz, 1H, piperidin), 3.164 (t, J ¼ 11.5 Hz,

1H, piperidin), 2.803 (t, J ¼ 12.0 Hz, 1H, piperidin), 2.728 (t,

J ¼ 12.0 Hz, 1H, piperidin), 2.479 (s, 3H, CH₃), 1.822e1.845 (m, 2H,

piperidin), 1.489e1.582 (m, 2H, piperidin). ¹³C NMR (125 MHz,

4.1.4.2. (E)-3-(4-methylthiazol-5-yl)-N-(3-phenylpropyl)acrylamide

(10b). Yellow gum, 52.2% yield. ¹H NMR (500 MHz, DMSO-d₆)

d

8.996 (s, 1H, thiazol-H2), 8.183 (t, J ¼ 5.0 Hz, 1H, NH), 7.553 (d,

J ¼ 15.0 Hz, 1H, CH¼CH), 7.157e7.292 (m, 5H, HAr), 6.355 (d,

J ¼ 15.5 Hz, 1H, CH¼CH), 3.160e3.199 (m, 2H, CH₂), 2.604 (t,

DMSO-d₆)

d

163.6, 154.0, 153.5, 145.6, 130.7, 128.6, 128.4 ꢂ 2,

J ¼ 7.0 Hz, 2H, CH₂), 2.462 (s, 3H, CH₃), 1.730e1.760 (m, 2H, CH₂). ¹³

C

126.7 ꢂ 2, 126.2, 120.1, 45.7, 42.3, 41.8, 33.7, 32.8, 15.2. ESI-MS m/z:

NMR (125 MHz, DMSO-d₆)

d 164.2, 153.7, 153.1, 141.6, 128.3,

313.4 (M þ H)þ, calcd for C₁₈H₂₀N₂OS: 312.43.

128.2 ꢂ 2, 128.1 ꢂ 2, 127.8, 125.7, 124.2, 38.3, 32.5, 30.8, 15.2. ESI-MS

m/z: 286.9 (M þ H)þ, calcd for C₁₆H₁₈N₂OS: 286.11.

4.1.4.9. (E)-N-(3,4-dihydroxyphenethyl)-3-(4-methylthiazol-5-yl)

acrylamide (10i). White powder,70.1% yield, mp 194.2e195.9 ^ꢁC. ¹H

4.1.4.3. (E)-3-(4-methylthiazol-5-yl)-N-(4-phenylbutyl)acrylamide

NMR (500 MHz, DMSO-d₆)

d 9.001 (s, 1H, thiazol-H2), 8.763 (s, 1H,

(10c). White solid, 58.4% yield, mp 72.6e73.5 ^ꢁC. ¹H NMR

-OH), 8.665 (s, 1H, -OH), 8.180 (t, J ¼ 5.5 Hz, 1H, NH), 7.545 (d,

J ¼ 15.5 Hz, 1H, CH¼CH), 6.640 (d, J ¼ 8.0 Hz, 1H, HAr), 6.594 (s, 1H,

HAr), 6.457 (d, J ¼ 8.0 Hz, 1H, HAr), 6.330 (d, J ¼ 15.0 Hz, 1H,

CH¼CH), 3.292e3.333 (m, 2H, CH₂), 2.572 (t, J ¼ 7.5 Hz, 2H, CH₂),

(500 MHz, DMSO-d₆)

d

8.996 (s, 1H, thiazol-H2), 8.125 (t, J ¼ 5.0 Hz,

1H, NH), 7.540 (d, J ¼ 15.5 Hz, 1H, CH¼CH), 7.153e7.288 (m, 5H,

HAr), 6.332 (d, J ¼ 15.5 Hz, 1H, CH¼CH), 3.173e3.212 (m, 2H, CH₂),

2.589 (t, J ¼ 8.0 Hz, 2H, CH₂), 2.463 (s, 3H, CH₃), 1.576e1.607 (m, 2H,

CH₂), 1.445e1.474 (m, 2H, CH₂). ¹³C NMR (125 MHz, DMSO-d₆)

2.467 (s, 3H, CH₃). ¹³C NMR (125 MHz, DMSO-d₆)

d 164.2, 153.7,

153.1, 145.0, 143.5, 130.1, 128.3, 127.8, 124.1, 119.2, 115.9, 115.5, 40.7,

34.5, 15.2. ESI-MS m/z: 305.1 (M þ H)þ, calcd for C₁₅H₁₆N₂O₃S:

304.09.

d

164.1, 153.7, 153.1, 142.0, 128.3, 128.2 ꢂ 2, 128.2 ꢂ 2, 127.8, 125.6,

124.2, 38.5, 34.8, 28.7, 28.4, 15.2. ESI-MS m/z: 301.0 (M þ H)þ, calcd

for C₁₇H₂₀N₂OS: 300.13.

4.1.4.10. (E)-N-(4-hydroxyphenethyl)-3-(4-methylthiazol-5-yl)acryl-

4.1.4.4. (E)-N-heptyl-3-(4-methylthiazol-5-yl)acrylamide

White solid, 47.4% yield, mp 65.2e66.3 ^ꢁC. ¹H NMR (500 MHz,

DMSO-d₆)

(10d).

amide (10j). White powder, 50.6% yield, mp 152.6e154.9 ^ꢁC. ¹H

NMR (500 MHz, DMSO-d₆)

d 9.165 (s, 1H, thiazol-H2), 8.991 (s, 1H,

d

8.996 (s, 1H, thiazol-H2), 8.101 (t, J ¼ 5.0 Hz, 1H, NH),

-OH), 8.168 (t, J ¼ 5.5 Hz, 1H, NH), 7.536 (d, J ¼ 15.5 Hz, 1H, CH¼CH),

7.002 (d, J ¼ 8.5 Hz, 2H, HAr), 6.674 (d, J ¼ 8.5 Hz, 2H, HAr), 6.323 (d,

J ¼ 15.0 Hz, 1H, CH¼CH), 3.310e3.351 (m, 2H, CH₂), 2.637 (t,

J ¼ 7.5 Hz, 2H, CH₂), 2.459 (s, 3H, CH₃). ¹³C NMR (125 MHz, DMSO-

7.538 (d, J ¼ 15.0 Hz, 1H, CH¼CH), 6.339 (d, J ¼ 15.0 Hz, 1H, CH¼CH),

3.132e3.171 (m, 2H, CH₂), 2.465 (s, 3H, CH₃), 1.422e1.448 (m, 2H,

CH₂), 1.205e1.275 (m, 8H, CH₂), 0.861 (t, J ¼ 7.0 Hz, 3H, CH₃). ¹³

C

NMR (125 MHz, DMSO-d₆)

d

164.1, 153.6, 153.0, 128.3, 127.7, 124.2,

d₆)

d

164.2, 155.6, 153.7, 153.1, 129.4 ꢂ 2, 129.4, 128.3, 127.8, 124.1,

38.7, 31.2, 29.0, 28.4, 26.4, 22.0, 15.2, 13.9. ESI-MS m/z: 267.4

(M þ H)þ, calcd for C₁₄H₂₂N₂OS: 266.40.

115.1 ꢂ 2, 40.6, 34.3, 15.2. ESI-MS m/z: 289.1 (M þ H)þ, calcd for

C₁₅H₁₆N₂O₂S: 288.09.

372

L. Chen et al. / European Journal of Medicinal Chemistry 143 (2018) 361e375

4.1.4.11. (E)-N-(3,4-dimethoxyphenethyl)-3-(4-methylthiazol-5-yl)

1H, indole-H), 7.212 (s, 1H, indole-H), 7.113 (t, J ¼ 8.0 Hz, 1H, indole-

H), 7.026 (t, J ¼ 8.0 Hz, 1H, indole-H), 6.398 (d, J ¼ 15.5 Hz, 1H,

CH¼CH), 3.497e3.537 (m, 2H, CH₂), 2.924 (t, J ¼ 7.5 Hz, 2H, CH₂),

acrylamide (10k). White powder, 44.9% yield, mp 137.8e143.0 ^ꢁC.

¹H NMR (500 MHz, DMSO-d₆)

d 9.008 (s, 1H, thiazol-H2), 8.176 (t,

J ¼ 5.5 Hz, 1H, NH), 7.550 (d, J ¼ 15.0 Hz, 1H, CH¼CH), 6.864 (d,

J ¼ 8.5 Hz, 1H, HAr), 6.823 (s, 1H, HAr), 6.729 (d, J ¼ 8.0 Hz, 1H, HAr),

6.335 (d, J ¼ 15.5 Hz, 1H, CH¼CH), 3.739 (s, 3H, OCH₃), 3.717 (s, 3H,

OCH₃), 3.333e3.410 (m, 2H, CH₂), 2.699 (t, J ¼ 7.5 Hz, 2H, CH₂),

2.517 (s, 3H, CH₃). ¹³C NMR (125 MHz, DMSO-d₆)

d 164.2, 153.7,

153.1, 136.2, 128.4, 127.8, 127.2, 124.2, 122.6, 120.9, 118.2, 118.2, 111.7,

111.3, 39.6, 25.2, 15.2. ESI-MS m/z: 312.2 (M þ H)þ, calcd for

C₁₇H₁₇N₃OS: 311.11.

2.468 (s, 3H, CH₃). ¹³C NMR (125 MHz, DMSO-d₆)

d 164.2, 153.7,

153.1, 148.6, 147.3, 131.8, 128.3, 127.9, 124.1, 120.4, 112.6, 112.0, 55.5,

4.1.4.17. (E)-N-(2-(6-methoxy-1H-indol-2-yl)ethyl)-3(4-

55.4, 40.4, 34.6, 15.2. ESI-MS m/z: 333.1 (M þ H)þ, calcd for

methylthiazol-5-yl)acrylamide (10q). White powder, 60.3% yield,

C

₁₇H₂₀N₂O₃S: 332.12.

mp 118.0e119.7 ^ꢁC. ¹H NMR (500 MHz, DMSO-d₆)

d 10.657 (s, 1H,

indole-NH), 8.999 (s, 1H, thiazol-H2), 8.261 (t, J ¼ 5.5 Hz, 1H, NH),

7.569 (d, J ¼ 15.5 Hz, 1H, CH¼CH), 7.225 (d, J ¼ 8.0 Hz,1H, indole-H),

7.123 (s, 1H, indole-H), 7.029 (s, 1H, indole-H), 6.713 (t, J ¼ 8.0 Hz,

1H, indole-H), 6.356 (d, J ¼ 15.5 Hz, 1H, CH¼CH), 3.750 (s, 3H,

OCH₃), 3.450e3.507 (m, 2H, CH₂), 2.846 (t, J ¼ 7.5 Hz, 2H, CH₂),

4.1.4.12. (E)-N-(2,5-dimethoxyphenethyl)-3-(4-methylthiazol-5-yl)

acrylamide (10l). White powder, 45.8% yield, mp 148.4e150.6 ^ꢁC.

¹H NMR (500 MHz, DMSO-d₆)

d 8.999 (s, 1H, thiazol-H2), 8.189 (t,

J ¼ 5.5 Hz, 1H, NH), 7.550 (d, J ¼ 15.5 Hz, 1H, CH¼CH), 6.886 (d,

J ¼ 8.5 Hz, 1H, HAr), 6.750 (d, J ¼ 8.5 Hz, 1H, HAr), 6.740 (s, 1H, HAr),

6.325 (d, J ¼ 15.0 Hz, 1H, CH¼CH), 3.736 (s, 3H, OCH₃), 3.682 (s, 3H,

OCH₃), 3.330e3.381 (m, 2H, CH₂), 2.719 (t, J ¼ 7.5 Hz, 2H, CH₂),

2.471 (s, 3H, CH₃). ¹³C NMR (125 MHz, DMSO-d₆)

d 164.2, 153.7,

153.1, 153.0, 131.4, 128.3, 127.8, 127.5, 124.3, 123.3, 112.0, 111.6, 111.0,

100.2, 55.3, 39.6, 25.2, 15.2. ESI-MS m/z: 342.1 (M þ H)þ, calcd for

2.468 (s, 3H, CH₃). ¹³C NMR (125 MHz, DMSO-d₆)

d

164.2, 153.7,

C₁₈H₁₉N₃O₂S: 341.12.

153.1, 153.0, 151.4, 128.3, 128.3, 127.8, 124.1, 116.2, 111.7, 111.6, 55.8,

55.2, 38.8, 29.9, 15.2. ESI-MS m/z: 333.1 (M þ H)þ, calcd for

4.1.4.18. tert-butyl

alaninate (10r). White oil, 51.2% yield. ¹H NMR (500 MHz, DMSO-

d₆)

J ¼ 15.5 Hz, 1H, CH¼CH), 7.199e7.305 (m, 5H, HAr), 6.441 (d,

J ¼ 15.5 Hz, 1H, CH¼CH), 4.505e4.549 (m, 1H, CH), 2.920e3.044 (m,

2H, CH₂), 2.457 (s, 3H, CH₃), 1.330 (s, 9H, tert-butyl). ¹³C NMR

(E)-(3-(4-methylthiazol-5-yl)acryloyl)phenyl-

C

₁₇H₂₀N₂O₃S: 332.12.

d

9.007 (s, 1H, thiazol-H2), 8.513 (d, J ¼ 8.0 Hz, 1H, NH), 7.559 (d,

4.1.4.13. (E)-N-(4-hydroxy-3-methoxyphenethyl)-3-(4-

methylthiazol-5-yl)acrylamide (10m). Yellow powder, 44.2% yield,

mp 122.2e124.5 ^ꢁC. ¹H NMR (500 MHz, DMSO-d₆)

d 9.001 (s, 1H,

thiazol-H2), 8.729 (s, 1H, OH), 8.179 (t, J ¼ 5.5 Hz, 1H, NH), 7.547 (d,

J ¼ 15.0 Hz, 1H, CH¼CH), 6.773 (s, 1H, HAr), 6.683 (d, J ¼ 8.5 Hz, 1H,

HAr), 6.599 (d, J ¼ 8.5 Hz, 1H, HAr), 6.315 (d, J ¼ 15.0 Hz, 1H,

CH¼CH), 3.745 (s, 3H, OCH₃), 3.352e3.384 (m, 2H, CH₂), 2.654 (t,

J ¼ 7.5 Hz, 2H, CH₂), 2.466 (s, 3H, CH₃). ¹³C NMR (125 MHz, DMSO-

(125 MHz, DMSO-d₆)

d

170.6, 164.2, 154.1, 153.3, 137.1, 129.1 ꢂ 2,

128.7, 128.2, 128.1 ꢂ 2, 126.5, 123.3, 80.7, 54.2, 37.1, 27.5 ꢂ 3, 15.2.

ESI-MS m/z: 373.2 (M þ H)þ, calcd for C₂₀H₂₄N₂O₃S: 372.15.

4.1.4.19. tert-butyl (E)-(3-(4-methylthiazol-5-yl)acryloyl)tyrosinate

d₆)

d

164.2, 153.7, 153.1, 147.4, 144.8, 130.1, 128.3, 127.8, 124.1, 120.7,

(10s). White solid, 47.5% yield, mp 51.8e53.2 ^ꢁC. ¹H NMR (500 MHz,

115.3,112.8, 55.5, 40.6, 34.6,15.2. ESI-MS m/z: 339.1 (M þ H)þ, calcd

DMSO-d₆) d 9.218 (s, 1H, OH), 9.006 (s, 1H, thiazol-H2), 8.419 (d,

for C₁₆H₁₈N₂O₃S: 318.10.

J ¼ 8.0 Hz, 1H, NH), 7.534 (d, J ¼ 15.5 Hz, 1H, CH¼CH), 7.015 (d,

J ¼ 8.0 Hz, 2H, HAr), 6.660 (d, J ¼ 8.0 Hz, 2H, HAr), 6.420 (d,

J ¼ 15.5 Hz, 1H, CH¼CH), 4.387e4.432 (m, 1H, CH), 2.727e2.907 (m,

2H, CH₂), 2.455 (s, 3H, CH₃), 1.334 (s, 9H, tert-butyl). ¹³C NMR

4.1.4.14. (E)-N-(3-bromo-4-methoxyphenethyl)-3-(4-methylthiazol-

5-yl)acrylamide (10n). White powder, 71.5% yield, mp

119.8e121.3 ^ꢁC. ¹H NMR (500 MHz, DMSO-d₆)

d

9.000 (s, 1H,

(125 MHz, DMSO-d₆)

128.6, 128.2, 127.1, 123.3, 115.0 ꢂ 2, 80.6, 54.6, 36.4, 27.6 ꢂ 3, 15.2.

ESI-MS m/z: 389.1 (M þ H)þ, calcd for C₂₀H₂₄N₂O₄S: 388.15.

d

170.7, 164.2, 156.0, 154.0, 153.4, 130.0 ꢂ 2,

thiazol-H2), 8.180 (t, J ¼ 5.5 Hz, 1H, NH), 7.541 (d, J ¼ 15.5 Hz, 1H,

CH¼CH), 7.447 (s, 1H, HAr), 7.197 (d, J ¼ 8.0 Hz, 1H, HAr), 7.040 (d,

J ¼ 8.5 Hz, 1H, HAr), 6.321 (d, J ¼ 15.5 Hz, 1H, CH¼CH), 3.814 (s, 3H,

OCH₃), 3.330e3.400 (m, 2H, CH₂), 2.708 (t, J ¼ 7.5 Hz, 2H, CH₂),

4.1.4.20. Ethyl (E)-(3-(4-methylthiazol-5-yl)acryloyl)tyrosinate (10t).

White solid, 45.3% yield, mp 78.4e79.5 ^ꢁC. ¹H NMR (500 MHz,

2.466 (s, 3H, CH₃). ¹³C NMR (125 MHz, DMSO-d₆)

d 164.3, 153.8,

153.8, 153.1, 133.2, 132.9, 129.1, 128.3, 127.9, 124.0, 112.6, 110.4, 56.1,

40.2, 33.6, 15.2. ESI-MS m/z: 381.0 (M

H)þ, calcd for

₁₆H₁₇BrN₂O₂S: 380.02.

DMSO-d₆) d 9.225 (s, 1H, OH), 9.011 (s, 1H, thiazol-H2), 8.510 (d,

þ

J ¼ 8.0 Hz, 1H, NH), 7.530 (d, J ¼ 15.0 Hz, 1H, CH¼CH), 7.010 (d,

J ¼ 8.0 Hz, 2H, HAr), 6.659 (d, J ¼ 8.0 Hz, 2H, HAr), 6.413 (d,

J ¼ 15.5 Hz, 1H, CH¼CH), 4.465e4.510 (m, 1H, CH), 4.031e4.074 (m,

2H, OCH₂), 2.799e2.947 (m, 2H, CH₂), 2.453 (s, 3H, CH₃), 1.122 (t,

C

4.1.4.15. (E)-N-(4-ﬂuorophenethyl)-3-(4-methylthiazol-5-yl)acryl-

amide (10o). White powder, 38.2% yield, mp 103.9e106.1 ^ꢁC. ¹H

J ¼ 7.0 Hz, 3H, CH₃). ¹³C NMR (125 MHz, DMSO-d₆)

d 171.6, 164.3,

NMR (500 MHz, DMSO-d₆)

d

9.001 (s, 1H, thiazol-H2), 8.204 (t,

156.0, 154.1, 153.4, 129.9 ꢂ 2, 128.8, 128.2, 127.0, 123.2, 115.0 ꢂ 2,

J ¼ 5.5 Hz, 1H, NH), 7.546 (d, J ¼ 15.0 Hz, 1H, CH¼CH), 7.261 (d,

J ¼ 8.5 Hz, 2H, HAr), 7.118 (d, J ¼ 8.5 Hz, 2H, HAr), 6.323 (d,

J ¼ 15.0 Hz, 1H, CH¼CH), 3.378e3.417 (m, 2H, CH₂), 2.760 (t,

J ¼ 7.5 Hz, 2H, CH₂), 2.466 (s, 3H, CH₃). ¹³C NMR (125 MHz, DMSO-

60.5, 54.1, 36.2, 15.2, 14.0. ESI-MS m/z: 361.1 (M þ H)þ, calcd for

C₁₈H₂₀N₂O₄S: 360.11.

4.1.4.21. (E)-(3-(4-methylthiazol-5-yl)acryloyl)phenylalanine (10u).

Compound 10r (37.2 mg, 0.1 mmol) was dissolved in 4 N HCl/

dioxane (1 mL) and stirred for 5 h at 25 ^ꢁC, after which the tert-

butyl ester was observed by TLC to have been completely

consumed. Concentration of the solvent gave 10u 24.8 mg. Yellow

d₆)

d

164.3, 161.8, 159.87, 153.1 (d, J_C-F¼ 310.5 Hz), 135.5 (d, J_C-

¼ 11.5 Hz), 130.3 (d, J_C-F¼ 32.0 Hz) ꢂ 2, 128.3,127.9, 124.0, 115.0 (d,

F

J_C-F¼ 83.5 Hz) ꢂ 2, 40.3, 34.1, 15.2. ESI-MS m/z: 291.1 (M þ H)þ,

calcd for C₁₅H₁₅FN₂OS: 290.09.

oil, 78.9% yield. ¹H NMR (500 MHz, DMSO-d₆)

d 9.017 (s, 1H, thiazol-

4.1.4.16. (E)-N-(2-(1H-indol-2-yl)ethyl)-3-(4-methylthiazol-5-yl)

H2), 8.486 (d, J ¼ 8.0 Hz, 1H, NH), 7.517 (d, J ¼ 15.5 Hz, 1H, CH¼CH),

7.191e7.300 (m, 5H, HAr), 6.420 (d, J ¼ 15.5 Hz, 1H, CH¼CH),

4.537e4.581 (m, 1H, CH), 2.880e3.137 (m, 2H, CH₂), 2.452 (s, 3H,

acrylamide (10p). White powder, 60.7% yield, mp 130.6e132.8 ^ꢁC.

¹H NMR (500 MHz, DMSO-d₆)

d 10.872 (s, 1H, indole-NH), 9.042 (s,

1H, thiazol-H2), 8.314 (t, J ¼ 5.5 Hz, 1H, NH), 7.618 (d, J ¼ 15.5 Hz,

CH₃). ¹³C NMR (125 MHz, DMSO-d₆)

d

172.8, 164.2, 154.0, 153.4,

1H, CH¼CH), 7.597 (d, J ¼ 8.0 Hz, 1H, indole-H), 7.385 (d, J ¼ 8.0 Hz,

137.5, 129.0 ꢂ 2, 128.6, 128.2, 128.2 ꢂ 2, 126.4, 123.4, 53.6, 36.8, 15.1.

L. Chen et al. / European Journal of Medicinal Chemistry 143 (2018) 361e375

373

ESI-MS m/z: 317.2 (M þ H)þ, calcd for C₁₆H₁₆N₂O₃S: 316.09.

4.1.4.22. (E)-(3-(4-methylthiazol-5-yl)acryloyl)tyrosine

Compound 10s (38.8 mg, 0.1 mmol) was dissolved in 4 N HCl/

dioxane (1 mL) and the mixture was allowed to stir for 5 h at 25 ^ꢁC,

after which the tert-butyl ester was observed by TLC to have been

completely consumed. Concentration of the solvent gave 10u

20.5 mg. Yellow solid, 61.7% yield, mp 71.2e73.4. ¹H NMR (500 MHz,

4.6. In vitro assay for LPS binding to MD2 (ELISA)

(10v).

Anti-human MD-2 antibody (eBioscience, Inc. San Diego, CA,

USA) in Tris-HCl buffer (pH 7.5) was coated in 96-well plates at 4 ^ꢁC

overnight. The plates were washed with PBST three times and

blocked by 3% BSA for 1.5 h. Subsequently, rhMD2 (4 mg/mL) in Tris-

HCl buffer was added to the pre-coated plate and incubated at room

temperature for 1.5 h. After being washed with PBST, a biotin-

labeled LPS (InvivoGen, San Diego, CA, USA) was added and incu-

bated for 1 h with or without 10s at different concentrations. Next,

streptavidin-conjugated horseradish peroxidase (Beyotime,

Shanghai, China) was added, and TMB substrate solution used to

detect the horseradish peroxidase activity. The amount of LPS

binding to rhMD-2 was determined by measuring absorbance at

450 nm.

DMSO-d₆)

d 12.749 (s, 1H, COOH), 9.232 (s, 1H, OH), 9.012 (s, 1H,

thiazol-H2), 8.411 (d, J ¼ 8.0 Hz, 1H, NH), 7.518 (d, J ¼ 15.5 Hz, 1H,

CH¼CH), 7.027 (d, J ¼ 8.0 Hz, 2H, HAr), 6.658 (d, J ¼ 8.0 Hz, 2H, HAr),

6.426 (d, J ¼ 15.5 Hz, 1H, CH¼CH), 4.448e4.492 (m, 1H, CH),

2.754e3.007 (m, 2H, CH₂), 2.455 (s, 3H, CH₃). ¹³C NMR (125 MHz,

DMSO-d₆)

d

173.0, 164.2, 155.9, 154.0, 153.4, 129.9 ꢂ 2, 128.5, 128.3,

127.5, 123.5, 115.0 ꢂ 2, 66.3, 36.1, 15.2. ESI-MS m/z: 333.1 (M þ H)þ,

calcd for C₁₆H₁₆N₂O₄S: 332.08.

4.7. Surface plasmon resonance (SPR) analysis

4.2. Animals

The binding afﬁnity of 10s was detected using ProteOn XPR36

Protein Interaction Array system (Bio-Rad Laboratories, Hercules,

CA) with a GLH sensor chip (ProteOn, #1765013). Brieﬂy, MD2 or

TLR4 protein (in acetate acid buffer) was immobilized on the sensor

after the activation by 40 mM EDC and 10 mM sNHS in water so-

lution. Then 10s at different concentrations was dissolved in

running buffer (PBS, 0.1% SDS and 0.05% Tween-20) with added 5%

DMSO. The compounds were captured in rotate channel 2 and 3,

taking the ﬁrst channel as a reference channel. Compounds at

different concentrations were injected simultaneously at a ﬂow

C57BL/6 (B6) mice weighing 18e22 g were purchased from the

Animal Center of Wenzhou Medical University (Wenzhou, China).

Mice were kept at a constant room temperature with 12:12 h light-

dark cycle and supplied with standard rodent diet and water. The

animals were adapted to the laboratory environment for at least 7

days before experiments. Animals operation protocols were

approved by the Wenzhou Medical University Animal Policy and

Welfare Committee (approval documents: 2013/APWC/0361).

4.3. Cell culture and reagents

rate of 30 mM/min for 120s of association phase, followed with 120s

of dissociation phase at 25 ^ꢁC. Data were analyzed by ProteOn

manager software. The K_Dvalue was calculated by global ﬁtting of

the kinetic data from various concentrations of 10s using 1:1

Langmuir binding model.

Lipopolysaccharide (LPS) was obtained from Sigma-Aldrich (St

Louis, MO, USA). The mouse TNF-a and IL-6 ELISA kits were pur-

chased from (eBioscience, Inc. San Diego, CA, USA). For peritoneal

macrophage (MPMs) preparation, ICR mice were stimulated by

intraperitoneal (i.p.) injection of 3 mL thioglycollate solution. The

thioglycollate solution was constituted with 0.3 g beef extract, 1 g

tryptone, 0.5 g sodium chloride and 6 g soluble starch and boiled in

100 mL water. Peritoneal macrophages were collected by washing

the peritoneal cavity with PBS, centrifuged, and the cell pellet was

resuspended in RPMI-1640 medium. The macrophages were

cultured at 37 ^ꢁC in 5% CO₂-humidiﬁed air.

4.8. Flow cytometric analysis

Cellular binding of ﬂuorescein isothiocyanate-labeled LPS (LPS-

FITC, from E. coli 055:B5, Sigma, St. Louis, MO) was measured.

Brieﬂy, mouse peritoneal macrophages cells (1 ꢂ 10⁶) were incu-

bated with LPS-FITC (50 mg/mL) for 30 min with or without 5 and

10s. After washing, the cells with bound LPS-FITC were examined

by ﬂow cytometry.

4.4. Determination of cytokines

4.9. Immunoprecipitation

The inhibition of TNF-a and IL-6 secretion by novel CAPE de-

rivatives was evaluated in LPS-stimulated MPMs. The cytokine

levels in the conditioned medium were determined by ELISA kit

according to the manufacturer's instructions. Brieﬂy, MPMs were

plated in 96-well plates at a density of 4*10⁵cells per well and

incubated for 24 h. Cells were pretreated with compounds for

TLR4 was co-precipitated with MD2 from macrophages to detect

the interaction of MD2 with TLR4. Macrophages were stimulated

with LPS (0.5

mg/mL) for 15 min after pretreatment with com-

pounds (10 M for 30min). Cells were lysed by extraction buffer

m

containing mammalian protein extraction reagent with added

protease and phosphatase inhibitors. Cell extracts were incubated

with sufﬁcient amount of anti-MD2 antibody and precipitated with

protein A þ G agarose beads (Beyotime Biotech, Nantong, China) at

4 ^ꢁC overnight. After boiling, the released proteins were detected by

immunoblot using anti-TLR4 and anti-MD2 antibodies.

30 min, and stimulated with LPS (0.5 mg/mL). After incubation for

24 h, the cells and conditioned media were collected separately.

The protein concentration of cells was determined using Bio-Rad

protein assay. The amount of cytokines in the media was normal-

ized to total cell protein.

4.5. Fluorescence measurements of bis-ANS displacement

4.10. Molecular docking of compounds to the MD2/TLR4 structural

model

SpectraMax M5 (Molecular Devices, Sunnyvale, CA) was used to

detect the ﬂuorescence measurements at 25 ^ꢁC in a 1 cm path-

length quartz cuvette. A mixture of rhMD2 protein (5 nM) and

The binding pose of compounds in the binding site of MD2 was

predicted by the software Autodock (version 4.2.6) [47]. The crys-

tallographic co-ordinates for human MD-2/TLR4 complex (PDB ID:

3FXI) were retrieved from the Protein Data Bank (PDB) [48]. Prior to

docking, AutoDock4 atomic radii were assigned to MD-2 protein,

and Gasteiger partial charges were assigned to ligands. A grid box

bis-ANS (5

mM) was incubated in PBS (pH 7.4) to reach stable

relative ﬂuorescence units (RFUs) emitted at 420e570 nm under

excitation at 385 nm. Next, compounds 5 or 10s at 10 mM was added

and incubated for 5 min, and RFUs recorded.

374

L. Chen et al. / European Journal of Medicinal Chemistry 143 (2018) 361e375

size of 60 X 60 X 60 dimensions with a spacing of 0.375 Å between

the grid points was implemented and covered almost the entire

binding site of MD-2 protein. The Lamarckian genetic algorithm

(LGA) was applied to deal with the protein and inhibitor in-

teractions. The docking parameters were as follows: trials of 100

dockings, the number of individuals in population was set to 300,

25 million of maximum number of energy evaluations and other

parameters were set to default. AutoDockTools and PyMol were

used to analyze the docking results.

4.15. Lung immunohistochemistry

For immunohistochemistry evaluation, lung tissue sections at

5

mm were deparafﬁnized in xylene, and hydrated in ethanol

gradient. After treatment with 30% of H₂O₂, the sections were

blocked in 5% bovine serum albumin and incubated with primary

anti-CD68 or anti-TNF-a

antibody overnight at 4 ^ꢁC. The sections

were next incubated with HRP-labeled secondary antibody for

2 h at 37 ^ꢁC, and stained with 3,3-diaminobenzidine tetrahydro-

chloride for evaluation by light microscopy (200ꢂ ampliﬁcation;

Nikon).

4.11. LPS-induced ALI

4.16. Statistical analysis

Male C57/BL6 mice were randomly divided into four groups: (i)

control (n ¼ 7); (ii) LPS (n ¼ 7); (iii) 5 þ LPS (n ¼ 7); (iv) 10s þ LPS

The statistical differences between different groups were

analyzed by the student's t-test or ANOVA multiple comparisons in

GraphPad Pro5.0 (GraphPad, San Diego, CA). P values < 0.05 were

considered signiﬁcant.

(n ¼ 7). Mice were treated with compounds in solution (200

mL,

15 mg/kg) by i.p. injection 30 min before challenged with LPS

intratracheally (5 mg/kg). Control animals received a similar vol-

ume (200 mL) of vehicle. Mice were then euthanized with ketamine

6 h after LPS challenge. The thorax of each mouse was opened for

BALF collection. The BALF was centrifuged at 1000 rpm for 10 min,

the supernatant collected for protein and cytokine determinations.

The cell pellet was resuspended in physiological saline for total cell

count determination.

Acknowledgement

This study was supported by the National Natural Science

Funding of China (81703352, 81770825, 81622043, and 81670768),

and the Natural Science Funding of Zhejiang Province

(LR16H310001, LR18H160003 and LQ18B020004).

4.12. Myeloperoxidase (MPO) activity

Appendix A. Supplementary data

The lung tissue MPO activity was evaluated using a commercial

kit (Jiancheng Bioengineering Institute, Nanjing, China) following

the manufacturer's instruction. Brieﬂy, the supernatants were

incubated with 0.01% H₂O₂in the company of O-dianisidine dihy-

drochloride (0.167 mg/mL). After for 30 min, the enzymatic activity

was determined by measuring the changes in absorbance at

460 nm. MPO activity was considered as the quantity of enzyme

Supplementary data related to this article can be found at

https://doi.org/10.1016/j.ejmech.2017.1 1 .066.

References

[1] L.K. Reiss, U. Uhlig, S. Uhlig, Models and mechanisms of acute lung injury

caused by direct insults, Eur. J. Cell Biol. 91 (2012) 590e601.

[2] M.A. Matthay, R.L. Zemans, The acute respiratory distress syndrome: patho-

genesis and treatment, Annu. Rev. Pathol. 6 (2011) 147e163.

[3] G.D. Rubenfeld, E. Caldwell, E. Peabody, J. Weaver, D.P. Martin, M. Neff,

E.J. Stern, L.D. Hudson, Incidence and outcomes of acute lung injury, N. Engl. J.

Med. 353 (2005) 1685e1693.

degrading 1 m

mol peroxide per min at 37 ^ꢁC and was expressed in

units per gram lung tissue.

[4] L.B. Ware, M.A. Matthay, The acute respiratory distress syndrome, N. Engl. J.

Med. 342 (2000) 1334e1349.

4.13. Real-time quantitative PCR

[5] G.U. Meduri, A.S. Headley, E. Golden, S.J. Carson, R.A. Umberger, T. Kelso,

E.A. Tolley, Effect of prolonged methylprednisolone therapy in unresolving

acute respiratory distress syndrome: a randomized controlled trial, JAMA 280

(1998) 159e165.

[6] J.R. Michael, R.G. Barton, J.R. Saf ﬂ e, M. Mone, B.A. Markewitz, K. Hillier,

M.R. Elstad, E.J. Campbell, B.E. Troyer, R.E. Whatley, T.G. Liou, W.M. Samuelson,

H.J. Carveth, D.M. Hinson, S.E. Morris, B.L. Davis, R.W. Day, Inhaled nitric oxide

versus conventional therapy: effect on oxygenation in ARDS, Am. J. Respir.

Crit. Care Med. 157 (1998) 1372e1380.

[7] B.G. Zeiher, A. Artigas, J.L. Vincent, A. Dmitrienko, K. Jackson, B.T. Thompson,

G. Bernard, S.S. Group, Neutrophil elastase inhibition in acute lung injury:

results of the STRIVE study, Crit. Care Med. 32 (2004) 1695e1702.

[8] J.L. Vincent, S.M. Opal, J.C. Marshall, K.J. Tracey, Sepsis de ﬁ nitions: time for

change, Lancet 381 (2013) 774e775.

Cells or lung tissues were homogenized in TRIZOL solution

(Invitrogen, Carlsbad, CA) for RNA extraction according to manu-

facturer's protocol. The reverse transcription and quantitative PCR

were carried out via a two-step M-MLV Platinum SYBR Green qPCR

SuperMix-UDG kit (Invitrogen, Carlsbad, CA). The primers of genes

for TNF-a, IL-6, and housekeeping gene b-actin were synthesized by

Invitrogen. The primer sequences are shown as follows:

b

-actin sense primer, CCGTGAAAAGATGACCCAGA;

-actin antisense primer, TACGACCAGAGGCATACAG.

TNF-

a

sense primer, TGATCCGCGACGTGGAA;

antisense primer, ACCGCCTGGAGTTCTGGAA.

[9] J.I. Kim, C.J. Lee, M.S. Jin, C.H. Lee, S.G. Paik, H. Lee, J.O. Lee, Crystal structure of

CD14 and its implications for lipopolysaccharide signaling, J. Biol. Chem. 280

(2005) 11347e11351.

[10] B.S. Park, D.H. Song, H.M. Kim, B.S. Choi, H. Lee, J.O. Lee, The structural basis of

lipopolysaccharide recognition by the TLR4-MD-2 complex, Nature 458

(2009) 1191e1195.

IL-6 sense primer, GAGGATACCACTCCCAACAGACC;

IL-6 antisense primer, AAGTGCATCATCGTTGTTCATACA.

[11] H. Kumar, T. Kawai, S. Akira, Pathogen recognition by the innate immune

system, Int. Rev. Immunol. 30 (2011) 16e34.

[12] F. Moghimpour Bijani, J.G. Vallejo, N. Rezaei, Toll-like receptor signaling

pathways in cardiovascular diseases: challenges and opportunities, Int. Rev.

Immunol. 31 (2012) 379e395.

4.14. Lung histopathological evaluation

[13] S. Hadina, J.P. Weiss, P.B. McCray Jr., K. Kulhankova, P.S. Thorne, MD-2-

dependent pulmonary immune responses to inhaled lipooligosaccharides:

effect of acylation state, Am. J. Respir. Cell Mol. Biol. 38 (2008) 647e654.

[14] S.H. Park, N.D. Kim, J.K. Jung, C.K. Lee, S.B. Han, Y. Kim, Myeloid differentiation

2 as a therapeutic target of in ﬂ ammatory disorders, Pharmacol. Ther. 133

(2012) 291e298.

For lung histopathological assessment, the superior lobe of right

lungs from different groups were collected and ﬁxed in 4% para-

formaldehyde solution, embedded in parafﬁn, and cut into 5 mm

sections. The sections were stained with hematoxylin and eosin

(H&E) using standard protocol for light microscopic examination

(200ꢂ ampliﬁcation; Nikon).

[15] F. Peri, V. Calabrese, Toll-like receptor 4 (TLR4) modulation by synthetic and

natural compounds: an update, J. Med. Chem. 57 (2014) 3612e3622.

L. Chen et al. / European Journal of Medicinal Chemistry 143 (2018) 361e375

375

[16] K. Miyake, Endotoxin recognition molecules MD-2 and toll-like receptor 4 as

potential targets for therapeutic intervention of endotoxin shock, Curr. Drug

Targets In ﬂ amm. Allergy 3 (2004) 291e297.

[17] K. Miyake, Innate recognition of lipopolysaccharide by CD14 and toll-like

receptor 4-MD-2: unique roles for MD-2, Int. Immunopharmacol. 3 (2003)

119e128.

[18] D.P. Rossignol, M. Lynn, Antagonism of in vivo and ex vivo response to

endotoxin by E5564, a synthetic lipid A analogue, J. Endotoxin Res. 8 (2002)

483e488.

[19] A. Barochia, S. Solomon, X. Cui, C. Natanson, P.Q. Eichacker, Eritoran tetraso-

dium (E5564) treatment for sepsis: review of preclinical and clinical studies,

Expert Opin. Drug Metab. Toxicol. 7 (2011) 479e494.

[20] S.M. Opal, P.F. Laterre, B. Francois, S.P. LaRosa, D.C. Angus, J.P. Mira,

X. Wittebole, T. Dugernier, D. Perrotin, M. Tidswell, L. Jauregui, K. Krell,

J. Pachl, T. Takahashi, C. Peckelsen, E. Cordasco, C.S. Chang, S. Oeyen,

N. Aikawa, T. Maruyama, R. Schein, A.C. Kalil, M. Van Nuffelen, M. Lynn,

D.P. Rossignol, J. Gogate, M.B. Roberts, J.L. Wheeler, J.L. Vincent, A.S. Group,

Effect of eritoran, an antagonist of MD2-TLR4, on mortality in patients with

severe sepsis: the ACCESS randomized trial, JAMA 309 (2013) 1154e1162.

[21] T. Rodrigues, D. Reker, P. Schneider, G. Schneider, Counting on natural

products for drug design, Nat. Chem. 8 (2016) 531e541.

H. Yilmaz, A. Kartal, Effects of caffeic acid phenethyl ester (CAPE) on sepsis in

rats, In ﬂ ammation 31 (2008) 273e280.

[33] H. Fidan, O. Sahin, Y. Yavuz, A. Kilbas, Z. Cetinkaya, Y. Ela, O.A. Ozen,

I. Altuntas, Caffeic acid phenethyl ester reduces mortality and sepsis-induced

lung injury in rats, Crit. Care Med. 35 (2007) 2822e2829.

[34] O. Koksel, A. Ozdulger, L. Tamer, L. Cinel, M. Ercil, U. Degirmenci, S. Unlu,

A. Kanik, Effects of caffeic acid phenethyl ester on lipopolysaccharide-induced

lung injury in rats, Pulm. Pharmacol. Ther. 19 (2006) 90e95.

[35] N. Celli, L.K. Dragani, S. Murzilli, T. Pagliani, A. Poggi, In vitro and in vivo

stability of caffeic acid phenethyl ester, a bioactive compound of propolis,

J. Agric. Food Chem. 55 (2007) 3398e3407.

[36] X. Wang, J. Pang, J.A. Maffucci, D.S. Pade, R.A. Newman, S.M. Kerwin,

P.D. Bowman, S. Stavchansky, Pharmacokinetics of caffeic acid phenethyl ester

and its catechol-ring ﬂ uorinated derivative following intravenous adminis-

tration to rats, Biopharm. Drug Dispos. 30 (2009) 221e228.

[37] X. Ning, Y. Guo, X. Wang, X. Ma, C. Tian, X. Shi, R. Zhu, C. Cheng, Y. Du, Z. Ma,

Z. Zhang, J. Liu, Design, synthesis, and biological evaluation of (e)-3,4-

dihydroxystyryl aralkyl sulfones and sulfoxides as novel multifunctional

neuroprotective agents, J. Med. Chem. 57 (2014) 4302e4312.

[38] X. Ning, Y. Guo, X. Ma, R. Zhu, C. Tian, X. Wang, Z. Ma, Z. Zhang, J. Liu, Synthesis

and neuroprotective effect of E-3,4-dihydroxy styryl aralkyl ketones de-

rivatives against oxidative stress and in ﬂ ammation, Bioorg. Med. Chem. Lett.

23 (2013) 3700e3703.

[22] F.E. Koehn, G.T. Carter, The evolving role of natural products in drug discovery,

Nat. Rev. Drug Discov. 4 (2005) 206e220.

[23] J.Y. Lee, B.H. Lee, N.D. Kim, J.Y. Lee, Celastrol blocks binding of lipopolysac-

charides to a Toll-like receptor4/myeloid differentiation factor2 complex in a

thiol-dependent manner, J. Ethnopharmacol. 172 (2015) 254e260.

[24] S.I. Ahn, J.K. Lee, H.S. Youn, Inhibition of homodimerization of toll-like re-

ceptor 4 by 6-shogaol, Mol. Cells 27 (2009) 211e215.

[25] M.R. Peluso, C.L. Miranda, D.J. Hobbs, R.R. Proteau, J.F. Stevens, Xanthohumol

in LPS-activated THP-1 monocytes: structure-activity relationships and in

silico binding to myeloid differentiation protein-2 (MD-2), Planta Med. 76

(2010) 1536e1543.

[39] G. Chen, Y. Zhang, X. Liu, Q. Fang, Z. Wang, L. Fu, Z. Liu, Y. Wang, Y. Zhao, X. Li,

G. Liang, Discovery of a new inhibitor of myeloid differentiation 2 from cin-

namamide derivatives with anti-in ﬂ ammatory activity in sepsis and acute

lung injury, J. Med. Chem. 59 (2016) 2436e2451.

[40] A.V. Pastukhov, I.J. Ropson, Fluorescent dyes as probes to study lipid-binding

proteins, Proteins 53 (2003) 607e615.

[41] M. Bhatia, S. Moochhala, Role of in ﬂ ammatory mediators in the pathophysi-

ology of acute respiratory distress syndrome, J. Pathol. 202 (2004) 145e156.

[42] S.L. Menezes, P.T. Bozza, H.C. Neto, A.P. Laranjeira, E.M. Negri, V.L. Capelozzi,

W.A. Zin, P.R. Rocco, Pulmonary and extrapulmonary acute lung injury: in-

ﬂ ammatory and ultrastructural analyses, J. Appl. Physiol. 98 (2005) (1985)

1777e1783.

[43] M.M. Levy, A. Artigas, G.S. Phillips, A. Rhodes, R. Beale, T. Osborn, J.L. Vincent,

S. Townsend, S. Lemeshow, R.P. Dellinger, Outcomes of the Surviving Sepsis

Campaign in intensive care units in the USA and Europe: a prospective cohort

study, Lancet Infect. Dis. 12 (2012) 919e924.

[44] Y. Nagai, S. Akashi, M. Nagafuku, M. Ogata, Y. Iwakura, S. Akira, T. Kitamura,

A. Kosugi, M. Kimoto, K. Miyake, Essential role of MD-2 in LPS responsiveness

and TLR4 distribution, Nat. Immunol. 3 (2002) 667e672.

[45] H. Shi, D. Xie, R. Yang, Y. Cheng, Synthesis of caffeic acid phenethyl ester

derivatives, and their cytoprotective and neuritogenic activities in PC12 cells,

J. Agric. Food Chem. 62 (2014) 5046e5053.

[46] T. Silva, T. Mohamed, A. Shakeri, P.P. Rao, L. Martinez-Gonzalez, D.I. Perez,

A. Martinez, M.J. Valente, J. Garrido, E. Uriarte, P. Serrao, P. Soares-da-Silva,

F. Remiao, F. Borges, Development of blood-brain barrier permeable

nitrocatechol-based catechol O-methyltransferase inhibitors with reduced

potential for hepatotoxicity, J. Med. Chem. 59 (2016) 7584e7597.

[47] G.M. Morris, R. Huey, W. Lindstrom, M.F. Sanner, R.K. Belew, D.S. Goodsell,

A.J. Olson, AutoDock4 and AutoDockTools4: automated docking with selective

receptor ﬂ exibility, J. Comput. Chem. 30 (2009) 2785e2791.

[26] S.Y. Kim, J.E. Koo, Y.J. Seo, N. Tyagi, E. Jeong, J. Choi, K.M. Lim, Z.Y. Park, J.Y. Lee,

Suppression of Toll-like receptor 4 activation by caffeic acid phenethyl ester is

mediated by interference of LPS binding to MD2, Br. J. Pharmacol. 168 (2013)

1933e1945.

[27] G. Ozturk, Z. Ginis, S. Akyol, G. Erden, A. Gurel, O. Akyol, The anticancer

mechanism of caffeic acid phenethyl ester (CAPE): review of melanomas, lung

and prostate cancers, Eur. Rev. Med. Pharmacol. Sci. 16 (2012) 2064e2068.

[28] Y.J. Chen, M.S. Shiao, S.Y. Wang, The antioxidant caffeic acid phenethyl ester

induces apoptosis associated with selective scavenging of hydrogen peroxide

in human leukemic HL-60 cells, Anticancer Drugs 12 (2001) 143e149.

[29] P. Michaluart, J.L. Masferrer, A.M. Carothers, K. Subbaramaiah, B.S. Zweifel,

C. Koboldt, J.R. Mestre, D. Grunberger, P.G. Sacks, T. Tanabe, A.J. Dannenberg,

Inhibitory effects of caffeic acid phenethyl ester on the activity and expression

of cyclooxygenase-2 in human oral epithelial cells and in a rat model of

in ﬂ ammation, Cancer Res. 59 (1999) 2347e2352.

[30] F. Armutcu, S. Akyol, S. Ustunsoy, F.F. Turan, Therapeutic potential of caffeic

acid phenethyl ester and its anti-in ﬂ ammatory and immunomodulatory ef-

fects (Review), Exp. Ther. Med. 9 (2015) 1582e1588.

[31] M. Kassim, M. Mansor, T.A. Kamalden, I.I. Shariffuddin, M.S. Hasan, G. Ong,

S.D. Sekaran, A. Suhaimi, N. Al-Abd, K.M. Yusoff, Caffeic acid phenethyl ester

(CAPE): scavenger of peroxynitrite in vitro and in sepsis models, Shock 42

(2014) 154e160.

[48] U. Ohto, K. Fukase, K. Miyake, Y. Satow, Crystal structures of human MD-2 and

its complex with antiendotoxic lipid IVa, Science 316 (2007) 1632e1634.

[32] A. Tekin, T. Kucukkartallar, S. Turkyilmaz, A. Dinckan, H. Esen, B. Ates,

Article Doi

Discovery of caffeic acid phenethyl ester derivatives as novel myeloid differentiation protein 2 inhibitors for treatment of acute lung injury

DOI: 10.1016/j.ejmech.2017.11.066

Source and publish data:

Authors:

Article abstract of DOI:10.1016/j.ejmech.2017.11.066

Full text of DOI:10.1016/j.ejmech.2017.11.066

Products guided by the article

R&D Labs maybe for 73490-49-0

Relevant to this article

Hot Product