Sequence-specific DNA binding by noncovalent peptide-tripyrrole conjugates

Article abstract of DOI:10.1002/anie.200603115

To join the groove: Equipping basic-region bZIP peptides with a noncovalent heterodimerizing unit allows their major-groove DNA-binding capability to be triggered upon addition of appropriate external ligands that bind into adjacent minor-groove sites. The resulting noncovalent hybrids bind relatively long DNA sites with good affinity and very high specificity. (Figure Presented).

Full text of DOI:10.1002/anie.200603115

Communications
DNA-Binding Peptides
DOI: 10.1002/anie.200603115
Sequence-Specific DNA Binding by Noncovalent
Peptide–Tripyrrole Conjugates**
Juan B. Blanco, Verónica I. Dodero,
M. Eugenio Vµzquez, Manuel Mosquera, Luis Castedo,
and JosØ L. Mascareæas*
The initiation of gene transcription is dependent on the
interaction between specific proteins and short DNA sequen-
ces that are usually located upstream of the promoter of the
gene.[1] In most cases,these proteins are unable to bind DNA
as monomeric modules and need to cooperate with other
proteins to form high-affinity complexes with specific DNA
sequences.[2] Such is the case for the bZIP family of tran-
scription factors,which bind DNA as leucine-zipper-mediated
homo- or heterodimers,with an N-terminal basic region (BR)
of each monomer inserting into adjacent DNA major
grooves.[2,3] Interestingly,in many of these proteins,for
example,the yeast transcriptional activator GCN4,the basic
region is largely unstructured in the absence of DNA but folds
into an a helix upon specific DNA binding.[4] It has been
shown that the leucine zipper of bZIP proteins can be
replaced by other noncovalent or covalent artificial dimeriz-
ing units without considerably compromising the DNA-
recognition capabilities of the system.[5,6] However,isolated
monovalent bZIP BRs exhibit poor DNA-binding affinities,
unless the important DNA-contacting residues are appropri-
ately grafted into a preorganized a helix.[7]
We recently demonstrated that it is possible to promote
the DNA binding of such a monomeric bZIP BR upon
appropriate cross-linking to a distamycin-like tripyrrole
capable of interacting with moderate to good affinity in the
[*] Dr. J. B. Blanco, Dr. V. I. Dodero, Dr. M. E. Vµzquez,
Prof. Dr. L. Castedo, Prof. Dr. J. L. Mascareæas
Departamento de Química Orgµnica
Universidade de Santiago de Compostela
Facultade de Química
15782 Santiago de Compostela (Spain)
Fax: (+34)981-595-012
E-mail: qojoselm@usc.es
Homepage: http://qoweb.usc.es/jlmgroup/index.htm
Prof. Dr. M. Mosquera
Departamento de Química Física
Universidade de Santiago de Compostela
Facultade de Química
15782 Santiago de Compostela (Spain)
[**] This work was supported by the Spanish MEC (SAF2004-01044).
J.B.B. thanks the Spanish M.E.C. for a predoctoral fellowship and
M.E.V. thanks the HSFP organization for their support with a Career
Development Award (CDA0032/2005-C) and the Spanish MEC for a
“Ramon y Cajal” contract. We also thank Prof. J. Benavente for
access to radioactivity facilities.
Supporting information (including materials, synthetic procedures,
and details of the binding experiments) for this article is available on
the WWW under http://www.angewandte.org or from the author.
8210
ꢀ 2006 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Angew. Chem. Int. Ed. 2006, 45, 8210 –8214

Angewandte
Chemie
minor groove adjacent to the BR target site.[8] The interaction
of hybrids such as 1 to designated composite DNA sites
(GTCATAAAA) most probably involves a simultaneous
major- and minor-groove interaction (as outlined in Figure 1),
that the interaction would involve the formation of a stable
complex among the peptide,the tripyrrole,and the DNA.
[9]
The feasibility of implementing this type of recognition
strategy might open new and interesting opportunities to
develop site-specific and ligand-responsive DNA-binding
peptides. Herein we demonstrate that the attachment of an
adamantyl group at the C terminus of a 23 amino acid peptide
derived from a BR bZIP fragment allows its recruitment to a
cognate DNA site adjacent to an A/T-rich sequence upon
addition of a b-cyclodextrin-containing tripyrrole.[10]
It was not easy to deductively predict the best position of
the basic region peptide to link the adamantyl group,and
therefore we made peptides in which this unit is either
attached to the side chain of amino acid 245 (peptide 2) or at a
C-terminal cysteine (3a, 3b). In the case of peptide 2,we
chose a relatively long tether to connect the adamantane and
the BR to ensure a certain degree of flexibility in the system.
This peptide was readily prepared by coupling amine 4 with
the required basic-region peptide while it was still bound to
the resin and fully protected except at glutamic acid 245.[11]
A
standard TFA-promoted deprotection step led to the desired
derivative 2 in good overall yield. Peptides 3a and 3b were
readily obtained by coupling a fully deprotected basic-region
peptide containing a cysteine residue at the C terminus with
adamantylmethyl 2-bromoacetate. The cyclodextrin–tripyr-
role unit 7a was prepared from tripyrrole derivative 5 by
following the steps indicated in Scheme 1.
Figure 1. Structure of the tripyrrole–BR hybrid 1 and outline of its
hypothetical DNA-binding mode.
As we have already shown for the covalent hybrids,[8]
circular dichroism (CD) spectroscopy is a very interesting
technique to extract information about the DNA-binding
properties of this type of molecules. As shown in Figure 2a,
the helicity of peptide 2 is not affected by the presence of 20-
and takes place with a Kd in the low nanomolar range at 48C.
On the basis of this bipartite DNA-binding strategy,we
considered it of interest to check whether both DNA-binding
units could be connected by means of a noncovalent link so
Scheme 1. Synthesis of the adamantyl-containing peptides and the tripyrrole-bCD units. For the synthesis of 7a: a) K2CO3, 6, DMF/acetone, 608C.
b) H2, Pd/C, MeOH. c) 1) i) HATU, DIEA, ii) bCD-NH2, DMF; 2) TFA. Aba=p-acetamidobenzoyl, Boc=tert-benzyloxycarbonyl, DIEA=N,N-
diisopropylethylamine, DMF=N,N-dimethylformamide, HATU=O-(7-azabenzotriazol-1-yl)-1,1,3,3-tetramethyluronium hexafluorophosphate,
TFA=trifluoroacetic acid.
Angew. Chem. Int. Ed. 2006, 45, 8210 –8214
ꢀ 2006 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.angewandte.org
8211

Communications
equipped with the bCD (7a) is present. In all cases,there is
also a positive ellipticity increase at 330 nm,which is
consistent with the tripyrrole unit binding in the DNA
minor groove. As might be expected,in the presence of the
double-stranded (ds) oligonucleotide that features a bp
mismatch at the BR-peptide binding subsite (CREhsm/A),
the increase in the magnitude of the negative signal at 222 nm
~
is considerably weaker (Figure 2b, ).
The circular dichroism information indicates that the
tripyrrole-induced helical transition of peptide 3a in the
presence of the target DNA is considerably higher than for
peptide 2. Therefore,the subsequent DNA-binding studies,
based on the use of gel mobility shift experiments (EMSA),
were focused on the first peptide,which features the
adamantane moiety at a C-terminal cysteine. As expected
for an isolated monomeric bZIP BR,[12]we did not observe
retard bands upon incubation of peptide 3a with CREhs/A,a
dsDNA that contains a cognate site for such peptides
(Figure 3 a,lane 1). However,it was gratifying to see that
the addition of increasing amounts of the bCD-tripyrrole unit
7a leads to the clear formation of a slower migrating band
that must correspond to a DNA–peptide–tripyrrole complex
(Figure 3 a,lanes 2–5).
Interestingly,and in contrast to observations made in the
case of covalent BR-peptide–tripyrrole hybrids,[8] a dsDNA
molecule mutated at the BR binding site (CREhsm/A) does
not induce the formation of detectable complexation bands
(Figure 3 a,lanes 6–10). Moreover,we could not detect
mobility-shifted bands in the presence of a dsDNA molecule
containing the BR-peptide binding subsite but lacking the A-
rich sequence (CREhs,Figure 3 a,lanes 11–12). These results
are consistent with a very high sequence-specific DNA
recognition,much better than in the covalent peptide–
tripyrrole hybrids. That the supramolecular assembly is
mediated by the host–guest cyclodextrin–adamantane inter-
action was demonstrated by carrying out control DNA-
complexation experiments with the tripyrrole that lacks the
bCD unit (7b) or with the peptide 3d,which does not
incorporate the adamantane group. As can be deduced from
the absence of retard bands in lanes 14 and 15 in Figure 3 a,
both noncovalent interacting units (the bCD and the ada-
mantane) are required for the formation of the complex
between the BR peptide,the tripyrrole,and DNA. It is
interesting to compare the gel migration of the above
complex with that of the dimer of 3b and 3c with a ds-
Figure 2. Circular dichroism difference spectra of peptides 2 and 3a:
hs
*
a) peptide 2: alone ( ), in the presence of CRE /A (&), and in the
hs
*
*
presence CRE /A and 7a ( ); b) peptide 3a: alone ( ), in the
hs
hs
*
hs
presence of CRE /A (&), in the presence CRE /A and 7a ( ), in the
hs
&
presence CRE /A and 7b ( ), and in the presence of CRE m/A and
~
7a ( ). CD spectra were obtained at 48C (see the Supporting
Information) and are the difference between the spectra of the
mixtures and the spectrum of free dsDNA. Sequences of one strand of
the ds-oligonucleotides used: CREhs/A: 5’-d(ACGAACGTCATAAAATC-
CTC)-3’, CREhsm/A: 5’-d(ACGAACGTCGTAAAATCCTC)-3’. The BR sub-
site (CREhs) is shown underlined, and the tripyrrole subsite is shown in
italics.
base-pair (bp) duplex oligonucleotide containing the target
hybrid DNA sequence (CREhs/A). However,addition of
tripyrrole 7a to the mixture induces a significant,though not
particularly large,increase in the negative intensity of the
oligonucleotide (CRE) containing a cognate dimeric recog-
[6]
nition site (Figure 3 a,lane 13).
The relative migration is
completely consistent with our complexes containing a single
peptidic unit.
*
circular dichroism signal at 222 nm (Figure 2a, ). Peptide
3a,which exhibits the natural amino acids of the basic region
of GCN4,acquires a notable degree of helicity in the presence
of CREhs/A (Figure 2b, &) but becomes significantly more
helicoidal upon addition of the bCD-tripyrrole 7a (Figure 2b,
The specificity of the interaction was further examined by
comparing the EMSA results with dsDNA molecules con-
taining specifically designed mutations. As shown in Fig-
ure 3b,the introduction of a bp spacing between the
consensus recognition sites of the tripyrrole and the BR
peptide (CREhsg/A) leads to a remarkable decrease in affinity
(Figure 3b,lanes 6–10),and the presence of an additional bp
space almost precludes the formation of the complex
(CREhscg/A,Figure 3b,lanes 11–15). On the other hand,
interruption of the adenine (A) sequence in the ds-oligonu-
*
). Peptide 3b behaved similarly.
Interestingly,the addition of tripyrrole 7b (that lacks the
cyclodextrin unit) in place of 7a does not promote a change in
&
the helicity of the peptide (Figure 2b, ). These results are
consistent with significant a-helix formation and specific
binding of the peptide to the DNA only when the tripyrrole
8212
www.angewandte.org
ꢀ 2006 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Angew. Chem. Int. Ed. 2006, 45, 8210 –8214

Angewandte
Chemie
kinetic lability of the peptide–DNA complex,which may
partially dissociate under the conditions of the assay.[12]
Ensuring the presence of enough dsDNA (> 20 nm),we
obtained clear complexation results upon titration of the
target DNA with increasing amounts of equimolecular
mixtures of 3a and 7a,or with fixed concentrations of one
of the partners and increasing proportions of the other
(Figure 3c). Titration assays in the presence of an excess of
the tripyrrole 7a,therefore ensuring that most of the dsDNA
probe is saturated,allowed calculation of an approximate Kd
value of 3a for a DNA·7a complex of 63 Æ 7 nm (see the
Supporting Information). Assuming that the BR monomeric
peptide binds DNA with affinities in the range of 1–5 mm,[12]
we can infer that the presence of 7a induces a very important
binding improvement.
In conclusion,attachment of complementary noncovalent
heterodimerizing units at a side chain of a distamycin-related
tripyrrole and at the C terminus of a bZIP BR peptide
provides for sequence-specific DNA recognition of relatively
long DNA sites (8–9 bp). This strategy,which must involve a
major- and minor-groove interaction,allows the DNA binding
of very short peptides (23 amino acids) in a highly sequence-
specific manner and represents a first step towards the
development of small,highly selective and ligand-responsive
DNA-binding peptides. Current studies are focused on
further characterizing the binding mode,refining the system
to obtain more stable complexes,and extending the recog-
nition strategy to other transcription factor fragments.
Figure 3. EMSA results showing the binding of peptide 3a to dsDNA
molecules. Experiments for (a) and (b) were analyzed by fluorescent
dye staining and those of c) were analyzed by autoradiography.
a) [dsDNA]ꢀ30 nm. Lanes 1–5: 7a in the presence of a mixture of
3a+CREhs/A, [3a]=200 nm, [7a]=0, 50, 100, 200, 400 nm; lanes 6–
10: 7a in the presence of a mixture of 3a+CREhsm/A, [3a]=200 nm,
[7a]=400, 200, 100, 50, 0 nm; lanes 11,12: 7a in the presence of a
mixture of 3a+CREhs, [3a]=5 mm, [7a]=0.5, 1 mm; lane 13:
CRE+3b+3c, [3b]=[3c]=500 nm; lane 14: 3a+CREhs/A+7b,
[3a]=2 mm, [7b]=500 nm; lane 15: 3d+CREhs/A+7a, [3d]=2 mm,
[7a]=500 nm. b) [dsDNA]ꢀ30 nm. Lanes 1–5: 7a in the presence of a
mixture of 3a+CREhs/A, [3a]=200 nm, [7a]=0, 50, 100, 200, 400 nm;
lanes 6–10: 7a in the presence of a mixture of 3a+CREhsg/A,
[3a]=200 nm, [7a]=0, 50, 100, 200, 400 nm; lanes 11–15: 7a in the
presence of a mixture of 3a+CREhscg/A, [3a]=200 nm, [7a]=0, 50,
100, 200, 400 nm; lanes 16–20: 7a in the presence of a mixture of
3a+CREhsg/Am, [3a]=200 nm, [7a]=0, 50, 100, 200, 400 nm. c) Auto-
radiograms with 32P-labeled CREhs/A (ꢀ45 pm of 32P-labeled +
100 nm unlabeled). Lanes 1–8: equimolecular mixture of 3a and 7a,
[3a]=0, 50, 80, 100, 150, 200, 250, 300 nm; lanes 9–15: 3a in the
presence of a mixture of 7a+CREhs/A, [7a]=200 nm, [3a]=50, 80,
100, 150, 200, 250, 300 nm; lanes 16–22: 7a in the presence of a
mixture of CREhs/A+3a, [3a]=200 nm, [7a]=50, 80, 100, 150, 200,
250, 300 nm. Sequences of one strand of the ds-oligonucleotides used:
CREhs: 5’-d(CGAACGTCATCGAAGGTCCT)-3’; CRE: 5’-d(TGGAGAT-
GACGTCATCTCGT)-3’; CREhsg/A: 5’-d(CGAACGTCATGAAAATCCTC)-3’;
CREhscg/A: 5’-d(CGAACGTCATCGAAAATCCT)-3’; CREhsg/Am: 5’-
d(CGAACGTCATGAAAGTCCTC)-3’. The BR subsite (CREhs) is shown
underlined, and the tripyrrole subsite is shown in italics.
Experimental Section
Circular dichroism measurements were made in a 2-mm cell at 48C.
Samples contained 10 mm phosphate-buffered saline solution
(pH 7.5),100 m m NaCl,5 mm peptide,and 5 mm ds-oligonucleotide
when present. The peptide–DNA mixtures were incubated for 5 min
before registering. For gel mobility shift assays,binding reactions
were performed over 30 min in a binding mixture (20 or 40 mL)
containing 18 mm tris(hydroxymethyl)aminomethane (Tris; pH 7.5),
À1
90 mm KCl,1.8 m m MgCl2,1.8 m m EDTA,9% glycerol,0.11 mgmL
bovine serum albumin (BSA) and 2.2% NP-40 (nonidet-P40).
Products were resolved by PAGE by using a 10% nondenaturing
polyacrylamide gel and 0.5XTBE buffer solution (44.5 mm Tris,
44.5 mm boric acid,1 m m EDTA,pH 8) and analyzed by auto-
radiography (when radioactivity was used) or by staining with
SyBrGold (Molecular Probes: 5 mL in 50 mL of 1XTBE) for 10 min
and visualized with fluorescence.
Received: August 1,2006
Revised: October 13,2006
Published online: November 17,2006
Keywords: distamycin · DNA recognition ·
noncovalent interactions · peptides · proteins
cleotide CREhsg/A completely abolishes the complexation
(CREhsg/Am,Figure 3b,lanes 16–20). These data confirm the
high specificity of the system and are consistent with the
proposed major–minor groove interaction model.
.
Standard EMSA experiments by using 32P-end-labeled
dsDNA molecules revealed that to detect the bands of the
complex it is necessary to use larger amounts of the dsDNA
than commonly used in this type of assay. Well-known
precedents for related systems suggest that such a require-
ment could probably be a consequence of a relatively high
[1] R. J. White, Gene Transcription, Mechanism and Control,Black-
well Science,Oxford, 2001.
[2] a) C. O. Pabo,R. T. Sauer, Annu. Rev. Biochem. 1992, 61,1053 –
1095; b) D. S. Latchman, Transcriptional Factors: Structural
Families and Principles of DNA Recognition,Academic Press,
San Diego, 1998; c) C. W. Garvie,C. Wolberger, Mol. Cell 2001,
8,936 – 946; d) J. T. Kadonaga, Cell 2004, 116,247 – 257; e) N. M.
Angew. Chem. Int. Ed. 2006, 45, 8210 –8214
ꢀ 2006 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
www.angewandte.org
8213

Communications
Luscombe,S. E. Austin,H. M. Berman,J. M. Thornton, Genome
Biol. 2000, 1,1.
[3] a) J. C. Hu,R. T. Sauer, Nucleic Acids Mol. Biol. 1992, 6,82 –
101; b) H. C. Hurst, Protein Profile 1995, 2,101 – 168; c) T.
Ellemberger, Curr. Opin. Struct. Biol. 1994, 4,12 – 21.
[4] a) M. A. Weiss, Biochemistry 1990, 29,8020 – 8024; b) K. T.
OꢀNeil,R. H. Hoess,W. F. Degrado, Science 1990, 249,774 – 778.
[5] For covalent dimers,see: a) R. V. Talanian,C. J. McKnight,P. S.
Kim, Science 1990, 249,769 – 771; b) B. Cuenoud,A. Shepartz,
Science 1993, 259,510 – 513; c) A. M. Caamaæo,M. E. Vµzquez,
J. Martínez-Costas,L. Castedo,J. L. Mascareæas, Angew. Chem.
2000, 112,3234 – 3237; Angew. Chem. Int. Ed. 2000, 39,3104 –
3107; d) T. Morii,Y. Saimei,M. Okagami,K. Makino,Y.
Sugiura, J. Am. Chem. Soc. 1997, 119,3649 – 3655.
[6] For noncovalent dimers,see: a) T. Morii,M. Shimomura,M.
Morimoto,I. Saito, J. Am. Chem. Soc. 1993, 115,1150 – 1151;
b) Y. Aizawa,Y. Sugiura,T. Morii, Biochemistry 1999, 38,1626 –
1632.
[7] a) N. J. Zondlo,A. Schepartz, J. Am. Chem. Soc. 1999, 121,
6938 – 6939; b) J. W. Chin,A. Schepartz, J. Am. Chem. Soc. 2001,
123,2929 – 2930; see also: c) D. Stanojevic,G. L. Verdine, Nat.
Struct. Biol. 1995, 2,450 – 457.
[8] a) M. E. Vµzquez,A. M. Caamaæo,J. Martínez-Costas,L.
Castedo,J. L. Mascareæas, Angew. Chem. 2001, 113,4859 –
4861; Angew. Chem. Int. Ed. 2001, 40,4723 – 4725; b) J. B.
Blanco,M. E. Vµzquez,J. Martínez-Costas,L. Castedo,J. L.
Mascareæas, Chem. Biol. 2003, 10,713 – 722; c) J. B. Blanco,O.
Vµzquez,J. Martínez-Costas,L. Castedo,J. L. Mascareæas,
Chem. Eur. J. 2005, 11,4171 – 4178; d) J. B. Blanco,M. E.
Vµzquez,L. Castedo,J. L. Mascareæas, ChemBioChem 2005, 6,
2173 – 2177; For a review,see: e) M. E. Vµzquez,A. M. Caa-
maæo,J. L. Mascareæas, Chem. Soc. Rev. 2003, 32,338 – 349.
[9] The formation of a cooperative DNA complex between a
polyamide and the DNA-binding protein EXD (extradenticle)
has been recently disclosed: a) H-D. Arndt,K. E. Hauschild,
D. P. Sullivan,K. Lake,P. B. Dervan,A. Z. Ansari, J. Am. Chem.
Soc. 2003, 125,13322 – 13323; b) K. E. Hauschild,R. E. Metzler,
H.-D. Arndt,R. Moretti,M. Raffaelle,P. B. Dervan,A. Z.
Ansari, Proc. Natl. Acad. Sci. USA 2005, 102,5008 – 5013.
[10] We chose
a cyclodextrin–adamantane interaction system
because it has been successfully used to obtain DNA-binding
dimeric BR bZIP peptides,see Ref. [6].
[11] The natural basic region contains an arginine at that position
(245),but we changed it to glutamic acid to facilitate its synthetic
manipulation (see Ref. [8a]).
[12] a) T. Morii,J. Yamane,Y. Aizawa,K. Makino,Y. Sugiura, J. Am.
Chem. Soc. 1996, 118,10012 – 10017; b) M. Zhang,B. Wu,H.
Zhao,J. W. Taylor, J. Pept. Sci. 2002, 8,125 – 136; c) D. D. Jones,
P. D. Barker Angew. Chem. 2005, 117,6495 – 6499; Angew.
Chem. Int. Ed. 2005, 44,6337 – 6341. See also Ref. [7].
8214
www.angewandte.org
ꢀ 2006 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim
Angew. Chem. Int. Ed. 2006, 45, 8210 –8214