New functional aspects of the atypical protein tyrosine phosphatase VHZ

Article abstract of DOI:10.1021/bi400776z

LDP3 (VHZ) is the smallest classical protein tyrosine phosphatase (PTP) known to date and was originally misclassified as an atypical dual-specificity phosphatase. Kinetic isotope effects with steady-state and pre-steady-state kinetics of VHZ and mutants with p-nitrophenol phosphate have revealed several unusual properties. VHZ is significantly more active than previously reported but remains one of the least active PTPs. Highly unusual for a PTP, VHZ possesses two acidic residues (E134 and D65) in the active site. D65 occupies the position corresponding to the typical general acid in the PTP family. However, VHZ primarily utilizes E134 as the general acid, with D65 taking over this role when E134 is mutated. This unusual behavior is facilitated by two coexisting, but unequally populated, substrate binding modes. Unlike most classical PTPs, VHZ exhibits phosphotransferase activity. Despite the presence of the Q-loop that normally prevents alcoholysis of the phosphoenzyme intermediate in other classical PTPs, VHZ readily phosphorylates ethylene glycol. Although mutations of Q-loop residues affect this phosphotransferase activity, mutations on the IPD loop that contains the general acid exert more control over this process. A single P68V substitution on this loop completely abolishes phosphotransferase activity. The ability of native VHZ to catalyze transphosphorylation may lead to an imbalance of intracellular phosphorylation, which could explain the correlation of its overexpression with several types of cancer.

Full text of DOI:10.1021/bi400776z

Article
pubs.acs.org/biochemistry
New Functional Aspects of the Atypical Protein Tyrosine
Phosphatase VHZ
Vyacheslav I. Kuznetsov and Alvan C. Hengge*
Department of Chemistry and Biochemistry, Utah State University, Logan, Utah 84322-0300, United States
S
* Supporting Information
ABSTRACT: LDP3 (VHZ) is the smallest classical protein
tyrosine phosphatase (PTP) known to date and was originally
misclassified as an atypical dual-specificity phosphatase. Kinetic
isotope effects with steady-state and pre-steady-state kinetics of
VHZ and mutants with p-nitrophenol phosphate have revealed
several unusual properties. VHZ is significantly more active
than previously reported but remains one of the least active
PTPs. Highly unusual for a PTP, VHZ possesses two acidic
residues (E134 and D65) in the active site. D65 occupies the
position corresponding to the typical general acid in the PTP
family. However, VHZ primarily utilizes E134 as the general acid, with D65 taking over this role when E134 is mutated. This
unusual behavior is facilitated by two coexisting, but unequally populated, substrate binding modes. Unlike most classical PTPs,
VHZ exhibits phosphotransferase activity. Despite the presence of the Q-loop that normally prevents alcoholysis of the
phosphoenzyme intermediate in other classical PTPs, VHZ readily phosphorylates ethylene glycol. Although mutations of Q-
loop residues affect this phosphotransferase activity, mutations on the IPD loop that contains the general acid exert more control
over this process. A single P68V substitution on this loop completely abolishes phosphotransferase activity. The ability of native
VHZ to catalyze transphosphorylation may lead to an imbalance of intracellular phosphorylation, which could explain the
correlation of its overexpression with several types of cancer.
he protein tyrosine phosphatases (PTPs) are a large
family of enzymes responsible for intracellular dephos-
of the classical PTP family selectively hydrolyze phosphotyr-
osine-containing peptides, and this family includes the well-
studied bacterial effector protein YopH, responsible for the
virulence of notorious Yersinia pestis, and human PTP1B, which
plays an important role in insulin signaling.4 Classical PTPs
have a modular organization and, in addition to the catalytic
phosphatase domain, contain noncatalytic domains that control
subcellular localization and protein−substrate interactions. All
classical PTPs are tyrosine specific enzymes. Members of the
dual-specificity phosphatase (DSP) subfamily hydrolyze
phosphoserine and phosphothreonine in addition to phospho-
tyrosine-containing target sites. Within the DSP subfamily, the
atypical DSPs are smaller and contain only a catalytic domain.5
The classical PTPs and DSPs also differ in their phospho-
transferase ability. In classical PTPs, the phosphoenzyme
intermediate is attacked only by water because of the shielding
effect of conserved Q-loop residues, named for the presence of
conserved glutamines.6 In contrast, DSPs such as VHR and the
low-molecular weight (LMW) Ltp1, both of which lack the Q-
loop, display significant phosphotransferase ability.7 On this
basis, it has been concluded that the presence of the Q-loop
prevents phosphotransferase activity.
T
phorylation. Together with protein tyrosine kinases (PTKs),
PTPs control the level of protein phosphorylation, which
modulates numerous aspects of cell life, such as growth,
proliferation, metabolism, intercellular interaction, immune
responses, and gene transcription.1 PTPs contain a highly
conserved HCXXGXXRS/T signature sequence motif but
share very few sequence similarities outside of the conserved
regions, which are comprised of the phosphate binding loop (P-
loop); the general acid loop, often termed the WPD loop; and
the Q-loop that bears conserved glutamine residues that orient
the water nucleophile in classical PTPs and prevent
phosphotransferase activity to other potential nucleophiles.
All PTPs utilize a two-step double-displacement mechanism
of phosphate monoester hydrolysis (Scheme 1) mediated by an
invariant cysteine-arginine-aspartic acid triad of catalytic
residues.2 The mechanism proceeds through a phosphoenzyme
intermediate in which the second chemical step is often rate-
limiting.3 In the first step, the P-loop orients the substrate as
the nucleophilic cysteine attacks phosphorus with simultaneous
expulsion of the leaving group protonated by the catalytic
general acid. In the second step, a water molecule, directed by
the aspartic acid residue that served as the general acid in the
first step and Q-loop glutamine residues, attacks the
phosphoenzyme intermediate.
Received: June 17, 2013
The PTP family is subdivided into several groups based on
substrate specificity, subcellular localization, and size. Members
Revised: September 16, 2013
Published: September 27, 2013
© 2013 American Chemical Society
8012
dx.doi.org/10.1021/bi400776z | Biochemistry 2013, 52, 8012−8025

Biochemistry
Article
a
Scheme 1. Chemical Steps in the Reaction Catalyzed by PTPs
a
In the first chemical step, a nucleophilic cysteine attacks the phosphate ester with simultaneous protonation of the leaving group by the conserved
aspartic acid. In the second chemical step, water attacks the phosphoenzyme intermediate liberating inorganic phosphate and free enzyme. Forward
rate constants are numbered with odd subscripts, and reverse rate constants are numbered with even subscripts. The Q-loop that is present only in
classical PTPs serves to orient the incoming nucleophilic water and most commonly contains a catalytic glutamine residue marked with an asterisk.
This residue is represented by isosteric glutamic acid E134 in VHZ.
Figure 1. Side-by-side comparison of (A) VHZ/PTP (PDB entry 4ERC) and (B) SsoPTP (PDB entry 2I6J). The proteins are very similar in size
and structure, and both contain a rigid IPD loop (colored red) in contrast to the conserved WPD loop in classical PTPs. Both proteins lack an N-
terminal substrate recognition loop and contain no additional extracatalytic domains.
VHZ, and the closely related phosphatase Sulfolobus
solfataricus PTP (SsoPTP), are among the smallest classical
PTPs known to date (Figure 1). The SsoPTP (161 amino
acids) is similar to VHZ (150 amino acids) in size and catalytic
activity. Both VHZ and SsoPTP consist of a single, catalytic
domain that is more similar to classical PTPs than DSPs8,9 and
contain identical secondary structural elements but, unlike most
classical PTPs, lack an N-terminal extension that forms a
substrate recognition/binding loop. Like VHZ, the general acid
in SsoPTP resides on a rigid IPD loop, which, unlike the
flexible WPD loop in classical PTPs, permanently occupies a
closed conformation. Unlike VHZ, and like classical PTPs,
SsoPTP/WT contains no additional general acid in its Q-loop
region. VHZ was originally classified as an atypical DSP and
named after its prototypical member as VH1-related protein
member Z. In previous work, we presented results indicating
that VHZ should be classified as a PTP rather than a DSP, on
the basis of a structural analysis and results of a phosphopeptide
substrate screen in which VHZ showed activity against pY-
containing peptides but not toward pS or pT peptides.8
In this work, we show that the catalytic activity of VHZ was
significantly underestimated in previous reports, as a result of
pronounced product inhibition, and the inhibitory effect of
certain buffers. Despite having much in common with classical
PTPs, VHZ is highly unusual in possessing two acidic residues
in the active site, D65 and E134. Our results indicate that under
certain circumstances either of these residues can serve as the
general acid in the first step of the reaction. We also present
results demonstrating that VHZ, despite the presence of a Q-
loop, catalyzes the transfer of a phosphoryl group to alcohols
(alcoholysis) in addition to water (hydrolysis) (Scheme 2).
The mutagenesis of several residues in VHZ in parallel with
SsoPTP has revealed that, in addition to the Q-loop, particular
residues in the general acid IPD loop play a crucial role in
nucleophilic selectivity. A combination of kinetics and muta-
genesis experiments have revealed unusual aspects of the kinetic
behavior of VHZ and provided insights into factors that control
8013
dx.doi.org/10.1021/bi400776z | Biochemistry 2013, 52, 8012−8025

Biochemistry
Article
containing 50 mM Tris base, 0.5 mM EDTA, 3 mM DTT, 5%
glycerol, and a reducing concentration of NaCl (300, 150, or 0
mM), at a rate of 1.5 h/step followed by addition of 2 mg of
TEV protease. The cleavage of VHR was rapid and complete in
2 h at 4 °C. VHR was dialyzed in the original Ni loading buffer
to remove DTT and EDTA for 2 h, and the solution was passed
through Ni-fast flow high-affinity resin to remove the cleaved
polyhistidine tag and TEV protease. The collected supernatant
was concentrated to 3−5 mL using a Millipore centrifuge
concentrator tube and loaded on a Superdex 75 26/60 gel
filtration column (GE-Healthcare) pre-equilibrated with buffer
containing 50 mM HEPES, 150 mM NaCl, 50 mM imidazole, 5
mM DTT, and 10% glycerol. A single peak corresponding to
the VHR was collected, concentrated to 6 mg/mL, flash-frozen
in liquid nitrogen, and stored at −80 °C.
Scheme 2. Partitioning of the Enzyme−Phosphate
a
Intermediate between Hydrolysis and Alcoholysis Pathways
a
Alcohols, or a water nucleophile, in two competing pathways attack
the phosphoenzyme intermediate formed in the first step.
the phosphotransferase activity of VHZ, and possibly in other
PTPs.
EXPERIMENTAL PROCEDURES
■
Cloning and Purification of SsoPTP. The S. solfataricus
PTP gene sequence from Uniprot (entry Q97VZ7) was
optimized for the E. coli expression system and synthesized
by GenScript delivered in a shuttle vector. The gene was
ordered with a KpnI restriction site followed by a TEV cleavage
site directly upstream of the SsoPTP sequence and a SacI
restriction site directly downstream of the stop codon. The
shuttle vector containing the described gene was amplified in E.
coli DH5α, isolated, and digested with KpnI and SacI restriction
enzymes in Green Buffer (Fermentas). The digestion products
were separated by electrophoresis using a 1% agarose gel. The
band that corresponded to the desired gene was extracted using
the Qiagen Gel Extraction Kit and ligated into the pet45 (B+)
plasmid predigested with the same set of restriction enzymes.
Unfortunately, unlike VHR (and similar to VHZ8), the
resulting fusion protein was resistant to TEV cleavage, so the
poly-His tag and TEV cleavage site were removed from the
pet45B(+)-SsoPTP vector by one-step overlapping PCR using
primers: Fwd (TATACCATGTACTGGGTCCGTCGCAAA-
ACG) and Rev (GACCCAGTACATGGTATATCTCCTTC-
TTAAAGTAAACAAAATTATTCTAG). Tagless SsoPTP was
expressed in E. coli BL-21 DE-3 (codon+) cells. The growth
and expression conditions were analogous to those used for
VHZ and VHR. The cells were harvested by centrifugation and
resuspended in the buffer containing 50 mM Tris, 1 mM
EDTA, 10 mM DTT, and 5% glycerol (pH 7.4, 4 °C). Cells
were disrupted by sonication on ice, and the pellet was
separated by centrifugation. The supernatant was treated with a
10% (w/v) solution of polyethyleneimine (PEI, Mw = 50000,
pH 8.0 and 4 °C) added dropwise at 4 °C to reach a final PEI
concentration of 0.5% (w/v). After centrifugation, the super-
natant was loaded at a rate of 1 mL/min on a Q-HiTrap (GE
Healthcare) column pre-equilibrated with buffer containing 50
mM sodium acetate, 1 mM EDTA, and 3 mM DTT (pH 5.5).
After being washed, the protein was eluted with a 120 mL linear
gradient (2 mL/min) of buffer containing 50 mM sodium
acetate, 1 mM EDTA, 600 mM NaCl, and 3 mM DTT (pH
5.5). A single isolated peak eluted at 200−250 mM NaCl
corresponding to SsoPTP and was concentrated to 3−5 mL
and loaded on a Superdex 75 26/60 gel filtration column (GE
Healthcare) pre-equilibrated with buffer containing 25 mM
Tris, 50 mM imidazole, 150 mM NaCl, 1 mM EDTA, and 5
mM DTT (pH 7.5 and 4 °C). A single peak was collected,
concentrated to 10 mg/mL (A280 of a 1 mg/mL solution =
2.36), and flash-frozen in liquid nitrogen in the same buffer
with 25% glycerol added.
Protein Cloning, Expression, and Purification. VHZ
mutants were created using the Qiagen QuikChange Lightning
Site-Directed Mutagenesis Kit. VHZ and mutants were purified
as previously described.8 A His-tagged version of VHR was
prepared as follows. In the first step, the gene of VHR was
amplified from the pT7-7 plasmid using Fwd1 (GAAAACC-
TGTATTTTCAGGGCATGTCGGGCTCGTTCGAGCT)
and Rev1 (GGAGAGCTCCTAGGGTTTCAACTTCCCCT-
CCTTGGCTAG) to incorporate the TEV protease cleavage
site (Fwd1, bold) immediately upstream of the protein gene
and the SacI restriction site (Rev1, bold) added at the end of
the gene sequence. In the second step, the product of the first
polymerase chain reaction (PCR) step was used as a template
and a KpnI restriction site was added upstream of the TEV
protease cleavage sequence using primers Fwd2 (CGGGGT-
ACCGAAAACCTGTAT) and Rev1 (GGAGAGCTCC-
TAGGGTTTCAACTTCCCCTCCTTGGC). The resulting
PCR product was digested with KpnI and SacI (Fermentas)
and ligated into the pet-45(B+) vector (Novagen) predigested
with the same set of restriction enzymes. The Escherichia coli
DH5α competent cells were transformed with 5 μL of the
ligation mixture and plated on an ampicillin-containing agar
plate. DNA sequencing confirmed the presence of the desired
gene. BL-21 DE-3 (codon+) E. coli competent cells were
transformed with the peT-45(B+)-VHR vector. Ten milliliters
of Luria-Bertani medium was inoculated with a single colony
and incubated at 37 °C on a shaker overnight; 1 L of 2×YT
medium containing ampicillin and chloramphenicol was
inoculated with 10 mL of overnight cell growth. The cells
were grown at 37 °C until OD600 reached 1.2−1.5; 100 mg of
IPTG was added (final concentration of 100 mg/L), and the
flask was transferred to a room-temperature shaker and
incubated for 18−20 h. The cells were harvested by
centrifugation and resuspended in Ni loading buffer containing
50 mM Tris, 500 mM NaCl, 20 mM imidazole, 5 mM 2-
mercaptoethanol, and 5% glycerol (pH 8.0). Cells were
sonicated on ice, and after centrifugation, the supernatant was
decanted and filtered through a 0.45 μm Millipore syringe filter.
Ni-fast flow high-affinity resin (GE Healthcare) was washed
three times with Ni loading buffer and incubated with the
supernatant for 30 min at 4 °C while being gently shaken. The
resin slurry was transferred to a 15 mL glass chromatography
column. The column was extensively washed with Ni loading
buffer to reach baseline absorbance, and protein was eluted with
a 120 mL linear gradient with buffer containing 50 mM Tris,
500 mM NaCl, 20 mM imidazole, 2-mercaptoethanol, and 5%
glycerol (pH 8.0) at a rate of 2 mL/min. The fusion VHR
protein obtained was dialyzed stepwise in TEV cleavage buffers
YopH, PTP1B, and their mutants were expressed and
purified as previously described.10,11
8014
dx.doi.org/10.1021/bi400776z | Biochemistry 2013, 52, 8012−8025

Biochemistry
Article
All enzymes were purified to ≥99% homogeneity based upon
sodium dodecyl sulfate−polyacrylamide gel electrophoresis
analysis (data not shown). The concentration of each enzyme
was determined by measuring the absorbance at 280 nm using
calculated extinction coefficients.
stirred in 100 mL of deionized water while the mixture was
being gently heated, avoiding boiling for several hours to yield
clear colorless solution C [2.5% (w/v)]. Prior to use, 2 mL of
solution C was added to 10 mL of adjusted solution B and the
solution mixed to yield a dark brown working solution. In a 96-
well plate, 280 μL of the working solution was mixed with 30
μL of diluted phosphate standards in the range of 0−200 μM.
The color was fully developed in 3−5 min, and the absorbance
measured at 625 nM was plotted versus inorganic phosphate
concentration to obtain a calibration curve.
Determination of Inhibition Constants. The effect of
buffers and other inhibitors on the activity of VHZ was tested
with pNPP (sodium salt) in 50 mM sodium acetate buffer (pH
5.5), which showed no inhibitory effect, with inhibitor
concentrations in the range of 25−200 mM. The data were
fit to several inhibition models using a nonlinear least-squares
fit (Origin 8.5.1) with the competitive model yielding the best
results in all cases.
Preparation of p-Nitrophenyl Phosphate (pNPP). The
dicyclohexylammonium salt of pNPP was synthesized as
previously described.12 A phosphate free solution of pNPP
was prepared in two separate steps. The crude product was
dissolved in a minimal volume of 0.8 M NaOH. Neutral
cyclohexylamine was extracted with five equal portions of
chloroform, accompanied by a reduction of the pH to 8.0−8.5.
Inorganic phosphate was precipitated by addition of a solution
+
containing 1 M MgCl and 5 M NH4Cl (1:5 Mg2+:NH4 ratio)
to yield a final magnesium concentration of 0.1 M. The pH was
adjusted to 9.0−9.3 with ammonium hydroxide and the mixture
stirred for 10 min until the solution turned cloudy because of
the precipitation of MgNH4PO4. The concentration of pNPP in
solution remains essentially unchanged, in contrast to calcium
or magnesium chloride precipitation alone, which mostly
precipitates pNPP. The precipitate was removed by filtration
using a fritted glass funnel, and 10 g of a preactivated Chelex
100 resin suspension in water (pH 9.0) was added to scavenge
the remaining magnesium. The resin was removed by filtration,
and a cyclohexylammonium hydrochloride (Fisher) solution
(pH 8−9) was added. The dicyclohexylammonium salt of
pNPP precipitated and was collected by filtration, washed with
cold absolute ethanol, and dried overnight under vacuum to
yield the phosphate free dicyclohexylammonium salt of pNPP
as a white solid, which was stored at −20 °C under nitrogen.
The sodium salt of pNPP allows the preparation of higher-
concentration stock solutions and was produced by dissolving
the dicyclohexylammonium salt, obtained as described above, in
a 0.8 M NaOH solution followed by removal of cyclohexyl-
amine by chloroform extractions. The pH of the aqueous layer
was adjusted to pH 12 with 0.1 M NaOH, as necessary. A small
amount (0.5−1 g) of Amberlite IR120 H resin, extensively
prewashed with deionized water, was added to the solution and
the mixture stirred for 1 min. When the pH reached 6.0−6.5,
the resin beads were removed by filtration. The solution was
adjusted to pH 8.5 with dilute sodium hydroxide and stirred on
ice under reduced pressure overnight to remove any traces of
organic solvent. The concentration of the stock solution was
assayed by adding 10 μL of the pNPP solution to 1 mL of 100
mM Tris buffer (pH 10) followed by complete hydrolysis with
alkaline phosphatase. The final concentration of liberated p-
nitrophenol was found using a λ400 value of 18300 M−1 cm−1.
Quantification of Inorganic Phosphate. A malachite
green assay was used to determine the concentration of
inorganic phosphate in the pNPP substrate, and the
concentration of inorganic phosphate in inhibition studies.
Briefly, 1.5 g of ammonium hexamolibdate was dissolved in 85
mL of deionized water. The volume was adjusted to 100 mL
with 15 mL of concentrated (60.5%) perchloric acid yielding
solution A. The use of perchloric acid was found to improve the
sensitivity and rate of color development. Malachite green
hydrochloride (0.2 g) was added to 50 mL of solution A while
the mixture was being stirred. After 30 min, the dark orange
solution was centrifuged to separate any undissolved particles
yielding solution B. Solution A was used to adjust solution B to
a final A450 of 15 (measured by assaying diluted aliquots and
calculating back to the original concentration). In a separate
250 mL Erlenmeyer flask, 2.5 g of hydrolyzed PVA (Acros) was
Steady-State Kinetic Analysis. All reactions were
performed in noninhibitory buffers in the presence of 1 mM
DTT and a constant ionic strength adjusted to 150 mM with
NaCl at 25 °C. The following buffers, which showed no
inhibition against VHZ, were used: sodium acetate at pH 4.75−
5.5, sodium succinate at pH 5.75−6.5, and 3,3-dimethylgluta-
rate at pH 6.75−7.25. All buffers were at a concentration of 50
mM. At least eight substrate concentrations ranging from 0.5KM
to 4KM were used for each enzyme to obtain Michaelis−
Menten curves. Reaction progress was followed continuously
by the change in absorbance at 400 nm at each pH using a
VersaMax plate reader (Molecular Devices). Partial extinction
coefficients obtained as described in the Supporting Informa-
tion were used to convert the measured absorbance values into
amounts of p-nitrophenol released. VHZ was susceptible to
product inhibition, so linear initial velocities were used at each
substrate concentration. Control reactions in the absence of
enzyme verified that nonenzymatic hydrolysis could not be
detected during the time spans used for enzyme kinetics. The
initial rates were plotted versus substrate concentration and fit
to the Michaelis−Menten equation using Origin version 8.5.1
to obtain kinetic parameters kcat and KM. The values of kcat and
kcat/KM were plotted versus pH and fit to the equations shown
in the Supporting Information to obtain the pKa values of
catalytically important ionizable residues, presented in the
Table S1 of the Supporting Information.
Isotope Effect Measurements. Kinetic isotope effects
(KIEs) on the VHZ-catalyzed reaction with pNPP were
measured using the competitive method and thus are isotope
effects on V/K. Figure 2 shows the positions at which KIEs
were measured in the substrate and the designations used.
Natural abundance pNPP was used for measurements of 15(V/
K). The 18O KIEs 18(V/K)bridge and 18(V/K)nonbridge were
measured by the remote label method, using the nitrogen atom
in p-nitrophenol as a reporter of the isotopic fractionation in
the labeled oxygen positions.13 The isotopic isomers used are
shown in Figure 2, and their synthesis was as previously
described.14 KIEs were measured at pH 5.5 using 100 mM
acetate, 1 mM DTT, and 0.5 mM EDTA as a buffer. The
reactions were conducted at 25 °C and 25 mM pNPP. All
reactions for bridged, nonbridged, and natural abundance
isotope effects were performed in triplicate, and the progress
was monitored continuously by measuring the absorbance at
400 nM. Reactions were stopped at 40, 50, and 60%
completion by acidification to pH 3.0 with HCl, which caused
8015
dx.doi.org/10.1021/bi400776z | Biochemistry 2013, 52, 8012−8025

Biochemistry
Article
for VHR/WT and VHZ. Absorbance traces of at least five
separate experiments at each substrate and enzyme concen-
tration were averaged. The data were fit to the equation
[pNPP] = At + B(1 − e−kt). At saturating concentrations of
substrate, k = k3 + k5. The linear steady-state phase A = k3k5/(k3
+ k5). The magnitude of the burst B = {Eo[k3/(k3 + k5)]2}/(1 +
KM/So)2 .
Computational Analysis of Binding of pNPP to VHZ.
The computational packages AutoDock15,16 and FlexX17 were
used to model the docking of pNPP in the active site of VHZ.
The 1.15 Å resolution crystal structure of the VHZ−
metavanadate complex (PDB entry 4ERC) was used as the
starting model. The VO3 ligand at the active site was removed,
and the following charges and protonation states were assigned
to the residues: C95, −1; H94 and R101, +1; D65 and E134,
neutral. The side chains of residues D65, F66, L97, and E134
were treated as flexible, and the rest of the protein was rigid.
The pNPP ligand coordinates were extracted from the crystal
structure of SsoPTP (PDB entry 2I6P), and the dianionic form
of the phosphate ester was used for docking. Free rotation was
allowed around the phosphate monoester bond, while the p-
NPP ring was treated as planar and rigid. The Lamarckian
genetic algorithm was selected for its reliability and ability to
calculate “deeper minima”,18 and the search was conducted
within a 15 Å grid region centered at the active site.
Figure 2. Positions of KIE measurement in the substrate pNPP. 18O
KIEs were measured at the nonbridging oxygen atoms of the
phosphoryl group (a) and the bridging ester oxygen atom (b). The
15N KIE was measured in the nitro group (c).
some precipitation of protein, which was separated by
centrifugation. To remove the remaining enzyme, the reaction
solution was centrifuged in a Millipore Amicon-Ultra 3 kDa
protein concentrator. The resulting solution was extracted with
three 50 mL portions of diethyl ether. Ether fractions were
collected, dried with anhydrous magnesium sulfate, and filtered,
and ether was removed by rotary evaporation. The
unhydrolyzed pNPP remaining in the aqueous layer was
hydrolyzed using alkaline phosphatase after the pH had been
adjusted to 10 by addition of 1 M Tris to pH 11. After 8 h, the
pNP product was extracted and collected as previously
described. After sublimation, the p-nitrophenol samples were
analyzed by isotope ratio mass spectrometry. The isotope effect
was calculated from the nitrogen isotopic ratios in the p-
nitrophenol product at partial reaction, in the residual substrate,
and the starting material, as described in the Supporting
Information. The 18(V/K)nonbridge values were corrected for the
dianionic fraction of pNPP at pH 5.5.
RESULTS
■
Buffer and Oxyanion Inhibition. The effects of buffers
and oxyanions on the catalytic activity of VHZ are summarized
in Table 1. No inhibitory effects were observed for acetate,
succinate, 3,3-dimethylglutarate, or diglycine. VHZ is weakly
a
Table 1. Inhibition by Buffers and Oxyanions
compound
cyclohexylamine
inhibition type
Ki (mM)
140 10
22
competitive
competitive
EDTA
2
Detection of Phosphotransferase Activity in the
Presence of Ethylene Glycol. The hydrolysis of pNPP by
VHZ and VHZ/P68V was monitored using a JEOL 300 MHz
NMR spectrometer at the 121.5 MHz 31P resonance frequency.
Reaction was started by addition of VHZ to a solution
containing 20 mM pNPP in 50 mM sodium acetate (pH 5.5),
0.5 mM EDTA, 3 mM DTT, and 1 M ethylene glycol. The
instrument was locked using D2O in a coaxial tube. The
instrument was set to collect 64 scans, with a relaxation delay of
4 s and a sweep width of 50 ppm.
Inorganic Phosphate
competitive
VHZ/WT
VHZ/D65A
VHZ/D65N
Sso/WT
0.67 0.05
0.43 0.12
0.68 0.11
0.54 0.42
0.7 0.3
competitive
competitive
competitive
VHR/WT
YopH/WT
PTP1B/WT
competitive
competitive
4.4 0.2
competitive
3.7 0.1
Other Oxyanions
competitive
sulfate
4.6 0.3
The dependence of kcat was measured as a function of
ethylene glycol concentration for VHR, VHZ, VHZ/E134Q,
VHZ/E134A, VHZ/D65A, VHZ/P68V, SsoPTP, and SsoPTP/
V72P by monitoring the release of p-nitrophenol. Reactions
were performed in 50 mM sodium acetate buffer (pH 5.5), and
the concentration of ethylene glycol varied in the range of 0−3
M.
Pre-Steady-State Kinetics. Measurements of pNPP
hydrolysis catalyzed by VHZ, VHR, and the VHZ/D65A
mutant were performed at 25 °C using a stopped-flow
spectrophotometer (KinTek). The release of p-nitrophenol
was monitored by the increase in absorbance at 400 nM in 100
mM succinate buffer (pH 5.85), using an extinction coefficient
corrected for this pH (see the Supporting Information). The
enzyme concentration varied in the range of 20−65 μM. The
pNPP concentration was 20 mM for VHZ/D65A and 50 mM
arsenate
vanadate
competitive
0.13 0.04
0.0027 0.0003
competitive
Buffers
Tris
competitive
88
no
9
N-ethylmorpholine (NEM)
Bis-Tris
no
competitive
competitive
competitive
competitive
no
122 12
triethanolamine
HEPES
52
26
5
3
glycylglycine
118 12
sodium acetate
sodium succinate
3,3-demethylglutarate
no
no
no
no
no
a
Experiments were conducted at pH 5.5 in 100 mM sodium acetate
buffer where the ionized form of tested buffering agents dominates in
solution.
8016
dx.doi.org/10.1021/bi400776z | Biochemistry 2013, 52, 8012−8025

Biochemistry
Article
inhibited by triethanolamine hydrochloride and cyclohexyla-
monium hydrochloride, while N-ethylmorpholine (NEM)
hydrochloride displayed no inhibitory effect. As expected, the
sulfonate-containing buffer HEPES showed relatively strong
inhibition. Cyclohexylammonium is a common counterion for
the commercially available substrate pNPP, and although its
effect was relatively weak, the sodium salt was used in all
experiments.
s−1 and a KM of 8.3 mM for pNPP hydrolysis by VHZ at the pH
optimum of 5.5, compared with a previously reported kcat of
0.009 s−1 and a KM of 1.5 mM.20 The revised kcat is comparable
to those of native VHR and SsoPTP. The KM is significantly
higher than those values previously reported, resulting in a
lower overall enzymatic efficiency (kcat/KM).
pH Dependence for the Hydrolysis of pNPP by VHZ.
The pH−rate profiles for native VHZ and mutants D65A and
E134Q are shown in Figure 3. The pKa values of ionizable
residues were determined by nonlinear least-squares fitting of
experimental data to the appropriate equations (see the
Supporting Information), for kcat and kcat/KM, and are listed
in Table S1 of the Supporting Information. The second
ionization constant for pNPP was set to the literature value of
4.96.12 The pKa values obtained are in good agreement with
those previously obtained for other PTPs, and the bell-shaped
profiles are typical of the PTP family. The acid limb is ascribed
to the deprotonated C95 nucleophile, which has an unusually
low pKa because of the stabilizing influences of the neighboring
H94 in VHZ. The basic limb is ascribed to general acid catalysis
in the first step, consistent with the PTP mechanism (Scheme
1).
The IPD loop in VHZ bears the putative D65 general acid.
This loop and the position of the acid correspond to the
conserved WPD loop in classical PTPs (Figure 4). D65 was
proposed to be the general acid catalyst by structural analogy,
and on the basis of the observation of lost hydrolysis of pNPP
by the D65A mutant.21,22 In our hands, the D65A mutation
resulted in a 5-fold decrease in kcat and a 40-fold decrease in KM.
The pH−rate profile remains bell-shaped (Figure 3). In
contrast, the analogous mutation of the general acid in other
PTPs to alanine or to asparagine results in a 100−1000-fold
decrease in kcat, and the loss of the basic limb in the kinetic
pH−rate profile, indicating loss of general acid catalysis.23,24 In
contrast, the kinetic constants for the D65N mutant are similar
to those of native VHZ (Table 3).
The active site of VHZ possesses another acid (E134 from
the Q-loop) in position to potentially protonate the leaving
group (Figure 4). The E134Q and E134A mutations both
decreased kcat by approximately 1 order of magnitude (Table 3)
with no significant effect on KM. The pH−rate profile of the
E134Q mutant remained bell-shaped. Only the simultaneous
removal of both general acids (D65N/E134Q) led to a
significant decrease in kcat and the loss of the basic limb of the
pH−rate profile (Figure 3). The double mutant precipitated
below pH 5.25, precluding measurement of kinetic data below
this pH.
Pre-Steady-State Kinetics. Many PTPs, including YopH,
PTP1, and VHR, exhibit burst kinetics, indicating that the
second step is rate-limiting.3,25 When native VHR was rapidly
mixed with pNPP, a pre-steady-state burst of p-nitrophenol
release was observed (Figure 5).
Kinetic Isotope Effects. The KIEs in the positions shown
in Figure 2 for the VHZ-catalyzed hydrolysis of pNPP are listed
in Table 2, together with previously reported KIEs for PTP1B
Table 2. Kinetic Isotope Effects of Native VHZ, PTP1B, and
VHR
PTP name
15(V/K)
18(V/K)bridge
18(V/K)nonbridge
VHZ
1.0013 0.0004
1.0001 0.0002
0.9999 0.0004
1.0164 0.0017
1.0142 0.0004
1.0118 0.0020
0.9986 0.0008
0.9981 0.0015
1.0003 0.0003
PTP1B10
VHR19
and VHR. The 18(V/K)nonbridge KIEs for VHZ are very similar to
these precedents,10,19 suggesting that, like these related
enzymes, the VHZ-catalyzed reaction proceeds via a loose
transition state. The 18(V/K)bridge KIE is higher in VHZ, and a
significant magnitude for the 15(V/K) isotope effect contrasts
with the absence of a measurable KIE in this position in the
other two phosphatases. Both observations are consistent with
incomplete neutralization of the leaving group by the general
acid in the transition state.
Steady-State Kinetic Analysis. Table 3 shows kinetic
parameters kcat, KM, and kcat/KM for VHZ, VHR, YopH, PTP1B,
Table 3. Kinetic Data for Native VHZ, YopH, VHR, PTP1B,
and SsoPTP and Selected Mutants with pNPP at pH 5.5
a
(optimum) and 25 °C
kcat/KM
kcat (s−1
Native PTPs
3.92 0.03
)
KM (mM)
(mM−1 s−1
)
VHZ
8.31 0.71
1.96 0.11
4.31 0.19
0.98 0.11
0.12 0.01
0.47
1.59
0.73
735
VHR
3.1 0.1
3.15 0.05
720 25
SsoPTP
YopH
PTP1B
51.7 0.9
430
IPD Loop Mutations
SsoPTP/V72P
VHZ/D65A
2.61 0.1
0.84 0.12
3.42 0.12
0.027 0.002
0.07 0.04
0.09 0.05
3.34 0.06
4.62 0.43
0.56
0.22 0.01
8.73 0.68
27.77 4.15
32.92 2.98
31.00 3.80
5.88 0.27
4.19
VHZ/D65N
VHZ/D65N/E134Q
VHZ/P64A
0.39
0.001
0.002
0.003
0.57
VHZ/P69A
VHZ/P68V
Q-Loop
VHZ/E134Q
VHZ/E134A
VHZ/Q138A
0.42 0.07
0.29 0.02
0.13 0.01
7.66 0.25
10.15 1.32
13.1 1.7
0.07
0.03
0.01
The values of k3 and k5 obtained for VHR are close to those
previously reported.25 Under the same conditions, native VHZ
and its E134Q mutant revealed no pre-steady-state burst. In
contrast, the VHZ/D65A mutant displayed a pre-steady-state
burst that was stoichiometric with the amount of enzyme.
Values of k3, k5, and KS (the true substrate binding constant)
were calculated for native VHR and VHZ/D65A and are listed
in Table 4. Although the decrease in the ratio (k5/k3) in VHZ/
D65A decreases KM (see the Supporting Information), it does
not fully explain the magnitude of the reduction, indicating that
KS is decreased, as well. Despite the absence of a burst, the
a
Values are the results of at least six independent experiments.
SsoPTP, and several VHZ mutants, measured at pH 5.5 and 23
°C. This corresponds to the pH optimum of many PTPs,
including VHZ. The kinetic parameters for VHR, YopH, and
PTP1B measured by a continuous assay at 400 nm are in good
agreement with the literature values. We obtained a kcat of 3.9
8017
dx.doi.org/10.1021/bi400776z | Biochemistry 2013, 52, 8012−8025

Biochemistry
Article
Figure 3. pH−rate profiles. (A) kcat values for native VHZ (black) and its D65A (red), E143Q (blue), and D65N/E134Q (green) mutants. (B) kcat/
KM values for native VHZ and its D65A, E134Q, and D65N/E134Q mutants. The D65A mutant is more efficient than native VHZ because of the
simultaneous reduction of kcat and KM. Both D65A and E134Q mutants retain the basic limb diagnostic of general acid catalysis. The basic limb
completely disappears in the VHZ/D65N/E134Q double mutant.
Figure 4. Structural comparison of the active sites of (A) the YopH PTP, (B) the VHR DSP, and (C) VHZ PTP. The structural arrangement of the
VHR active site differs from that of YopH and VHZ in the replacement of the highly conserved Q-loop with the N-loop, and a different position of
the general acid.
value of KS for native VHZ can be calculated if we assume that
the primary role of D65 is orienting the nucleophilic water in
the second step. This assumption is supported by the negligible
effect on kcat of the D65N substitution. By setting k3 for native
VHZ equal to that of D65A, we calculated the other elementary
rate constants for the reaction of the native enzyme as shown in
Table 4. The VHZ/D65A substitution decreases the magnitude
of KS 14-fold. Because substitution of D65 with A (but not N)
increases the enzyme substrate affinity, we conclude the
existence of an unfavorable steric, rather than electrostatic,
interaction between D65 and the aromatic ring of the substrate.
The Ki for inorganic phosphate is lower than the KS for pNPP
in both native VHZ and VHZ/D65A. However, whereas the KS
for pNPP is decreased 14-fold by the removal of the D65 side
chain (Table 4), the Ki for inorganic phosphate is decreased
only ∼1.5-fold (Table 1).
Reaction in the Presence of Ethylene Glycol. The
dependence of kcat on ethylene glycol concentration was
measured for native VHZ and several mutants. It should be
noted (discussed in the Supporting Information) that the slope
of such a plot where kcat = k5 + k7[ROH] yields the second-
order rate constant for ethylene glycol phosphorylation [k7
(Scheme 2)] only when k3 ≫ k5. In the more general case,
when no distinct rate-limiting step exists and no pre-steady-
state burst is present, the expression kcat = (k3k5)/(k5 + k3) +
((k3k7)/(k5 + k3)) × [ROH] holds and interpretation of the
calculated slope is more complex. However, the nucleophilic
selectivity S = slope/intercept = [(k3k7)/(k5 + k3)]/[(k3k5)/(k5
+ k3)] = k7/k5 (Table 5, column 3) is independent of k3 and
reflects the relative preference for alcoholysis over hydrolysis.
The E134Q mutation results in no significant change in
phosphotransferase ability. The E134A mutation increases the
alcoholysis to hydrolysis ratio, indicating that E134 participates
in the second step of the reaction, like Q446 in YopH.
Although Q-loop residues in PTPs are generally thought to
control access to the phosphoenzyme intermediate, the D65A
mutation on the IPD loop has a more pronounced effect than
the E134A mutation. Because the closely related SsoPTP lacks
phosphotransferase activity, we compared the effects of
mutations on the IPD loops in VHZ and SsoPTP. The
SsoPTP contains only two proline residues on its IPD loop,
P68 and P73, corresponding to P64 and P69, respectively, in
VHZ. These residues are highly conserved in classical PTPs
(see the sequence alignment in Figure 8), and mutations result
in similar, adverse catalytic effects in VHZ (Table 3). VHZ
possesses another proline, P68, which is occupied by V72 in
SsoPTP. The VHZ/P68V mutation abolished phosphotransfer-
ase activity (Figure 6). This effect was further supported by 31
P
NMR spectroscopy shown in Figure 7. The orthogonal
8018
dx.doi.org/10.1021/bi400776z | Biochemistry 2013, 52, 8012−8025

Biochemistry
Article
Figure 5. Pre-steady-state kinetics of (A) 48 μM native VHZ with 50 mM pNPP, (B) 26 μM native VHR with 50 mM pNPP, (C) 58 μM VHZ/
E134Q with 50 mM pNPP, and (D) 28 μM VHZ/D65A with 10 mM pNPP. All experiments were performed at 25 °C; 2000 data points were
collected after a 1 ms mixing delay and used in the fit. Data points were omitted from the figure for the sake of clarity.
Table 4. Elementary Rate Constants for pNPP Hydrolysis
Table 5. Second-Order Rate Constants for Alcoholysis and
a
and Substrate Dissociation Constants for Native VHR,
Hydrolysis of pNPP by Several Members of the PTP Family
a
VHZ/D65A, and Native VHZ
name
Ltp1/WT7
YopH/WT6
SsoPTP/WT
VHR/WT6
kt (M−1 s−1
)
kcat′ = kcat/55.5 (M−1 s−1
)
S = kt/kcat′
k3 (s−1
)
k5 (s−1
)
KS (mM)
5.5
0.0
0.026
11.3
211.5
0.0
VHZ/D65A
VHR
17.44 0.13
48.30 0.34
17.44 0.13
1.71 0.37
9.70 0.21
5.19
2.5
11.8
35
0.0
0.07
0.0
VHZ/WT
0.48
1.3
0.07
6.85
14.4
12.1
36.1
19.4
103.3
0.0
a
VHZ/WT
0.09
The values of k3, k5, and KS were obtained from burst kinetics as
VHZ/E134Q
VHZ/E134A
YopH/Q446A6
VHZ/D65A
VHZ/P68V
SsoPTP/V72P
0.06
0.13
21.6
1.55
0.0
0.005
0.0036
1.11
described in the Supporting Information. The kinetic constants for
native VHZ were calculated on the basis of the assumption that k3 is
not affected by the VHZ/D65A substitution, as described in the text.
Under such circumstances, the system consisting of the two equations
kcat = (k5k3)/(k3 + k5) and KM = KS[k5/(k3 + k5)] can be solved to
obtain values of k5 and KS.
0.015
0.060
0.041
0.49
11.95
a
The kcat values obtained in the absence of alcohol (intercept with the
Y axis) were divided by the molarity of water (55.5 M) to yield the
second-order hydrolysis rate constant kcat′. Nucleophilic specificity is
defined by the relative preference for alcoholysis over hydrolysis. kt
corresponds to k7 only when k5 ≫ k3; otherwise, kt = (k3k7)/(k5 + k3)
(see the Supporting Information for a more detailed description). The
values of kt depend on the rate-limiting step and on the overall activity
and should not be used to judge the preference for alcoholysis.
SsoPTP/V72P mutation conferred phosphotransferase ability
comparable to that of native VHZ.
DISCUSSION
■
Although VHZ is related to classical PTPs and utilizes the same
mechanism,8 it differs in several important ways from most PTP
family members.
VHZ Is Inhibited by Commonly Used Buffers and by
Inorganic Phosphate More Strongly Than Typical PTPs.
Previous kinetic investigations of VHZ utilized single-time
point assays after 20 or 30 min and buffers containing Tris20,22
or Bis-Tris, which are weak competitive inhibitors (Table 1).
Although the inhibition constants are in the high millimolar
range, buffers are typically used at such concentrations. While
buffers containing the sulfonate functional group, such as
HEPES, are recognized as inhibitors of PTPs and have been
observed in some PTP crystal structures, the inhibition of VHZ
by buffers such as Tris and triethanolamine was unexpected.
This behavior may result from the combined effect of several
anionic residues near the VHZ active site (D65, E44, E134, and
E137), but the molecular origin of buffer inhibition was not
tested. The inhibition constant for inorganic phosphate is lower
than in classical PTPs and is significantly lower than the KS for
pNPP (Table 4). Probable structural origins for this difference
8019
dx.doi.org/10.1021/bi400776z | Biochemistry 2013, 52, 8012−8025

Biochemistry
Article
Figure 6. Dependence of pNPP turnover on ethylene glycol concentration for (A) VHZ/WT and the VHZ/P68V mutant and (B) SsoPTP/WT and
the SsoPTP/V72P mutant. The kcat for pNPP release was plotted vs ethylene glycol concentration. All experiments were performed at 25 °C.
previous published value of 0.009 s−1). We also developed a
process for the expression and purification of the native enzyme
with no tags. Although previous reports used tagged versions of
VHZ, the difference in activity is too significant to be explained
by the absence of tags. Furthermore, discontinuous assays of
tagless VHZ using the previously reported methods yielded
results similar to those of previous reports.20,22
The Leaving Group Is Not Fully Neutralized in the
First Step of the VHZ Reaction. The KIEs for the hydrolysis
of pNPP have been reported for a number of PTPs, including
YopH,26 PTP1B,27 VHR,19 and the LMW PTP Stp1.28 Because
these are measured by the competitive method, the KIEs reflect
the portion of the kinetic mechanism up to the first irreversible
step, cleavage of pNPP. The mechanistic origins of the KIEs for
pNPP hydrolysis have been described elsewhere.13 In brief, a
normal 15(V/K) up to a maximum of 1.003 arises from negative
charge development on the leaving group. Efficient general acid
catalysis by PTPs abolishes this effect, resulting in a 15(V/K) of
unity. Fission of the P−O bond produces a normal 18(V/K)bridge
effect. Simultaneous leaving group protonation produces an
inverse effect that partially decreases the normal effect from P−
O cleavage. Thus, in general acid mutants, 18(V/K)bridge is
Figure 7. Reaction of pNPP catalyzed by VHZ/P68V and VHZ
monitored by 31P NMR spectroscopy. Panel A shows the reaction of
typically ∼1.03, compared to ∼1.015 in native PTPs. The 18(V/
the VHZ/P68V mutant after 30 min in the presence of 1 M ethylene
K)nonbridge KIE responds to the change in the hybridization state
of the phosphoryl group. This KIE is slightly inverse to near
glycol. Panel B shows the reaction catalyzed by VHZ after 30 min. All
reactions were performed at pH 5.5 in 100 mM sodium acetate buffer
unity in PTPs, reflecting the loose metaphosphate-like
transition state; associative transition states result in normal
values.
in the presence of 20 mM pNPP. The chemical shift of pNPP was
−1.6 ppm; that of inorganic phosphate was set to 0 ppm, and the shift
of phosphorylated ethylene glycol is 1.7 ppm.
Both of the oxygen isotope effects for the VHZ reaction are
within experimental error of previous data with PTP1B and
VHR (Table 4). In contrast, the 15(V/K) differs from those of
the other PTPs and is slightly normal, indicating that the
leaving group is not completely neutralized in the transition
state. The magnitude suggests approximately one-third of a
negative charge, from protonation that is not fully synchronous
with P−O bond fission. This has been observed in one previous
PTP family member, the LMW PTP Stp1.28 Incomplete
protonation of the leaving group in the first step may contribute
to a decrease in k3 and explain the absence of a burst in the
VHZ-catalyzed reaction of pNPP.
Two Potential and Functional General Acids in the
Active Site of VHZ. The D65 residue resides on the IPD loop,
a structure analogous to the WPD loop in classical PTPs that
bears the conserved general acid (Figure 8). The E134 residue
in VHZ can be superimposed with a conserved Q residue
located on the Q-loop in classical PTPs that orients the
nucleophilic water in the second step.29 The pH−rate profiles
are discussed below. The net effect of these properties led to a
significant underestimation of VHZ activity in previous reports.
In addition to avoiding inhibitory buffers, we validated a
method for the continuous collection of rate data using the
substrate pNPP monitoring reaction progress at 400 nm using
extinction coefficients measured under the experimental
conditions (see the Supporting Information). Continuous
monitoring of the reaction showed that VHZ becomes
inhibited by the product after several minutes. Finally,
commercial pNPP, which often contains small but exper-
imentally significant amounts of inorganic phosphate, was used
in previous studies. We developed a purification strategy to
minimize contamination by inorganic phosphate, which also
offers a simple means of converting the dicyclohexylammonium
salt to the more soluble disodium salt.
Using noninhibitory buffers, a continuous assay, and
phosphate free substrate, VHZ proved to be significantly
more active than previously reported (kcat = 3.9 s−1 vs a
8020
dx.doi.org/10.1021/bi400776z | Biochemistry 2013, 52, 8012−8025

Biochemistry
Article
Figure 8. Sequence alignment of residues 65−138 of VHZ with several classical PTPs (top) and atypical DSPs (bottom). The alignment is confined
to the three catalytically important PTP regions, as they are most similar in sequence in the PTP family. VHZ is more similar to classical PTPs than
to the DSP family, with two important distinctions in the aligned regions: substitution of highly conserved W by I in the WPD loop region and
substitution of Q by E in the Q-loop region.
of the D65 and E134 mutants both retain their basic limbs. The
D65N mutation has no significant effect on catalysis, and the
D65A and E134Q mutations have kcat values that are decreased
by only 1 order of magnitude. Only in the double mutant is the
level of catalysis decreased to the extent seen in general acid
mutants of other PTPs, consistent with complete elimination of
general acid catalysis. We conclude the D65 and E134 single
mutants both retain general acid function. We conclude that
native VHZ utilizes E134 as the primary general acid, with a
minor contribution from D65, which becomes the major
general acid when E134 is mutated. The data suggest that,
unlike any other known PTP or DSP, VHZ contains two acidic
residues in the active site, either of which can protonate the
leaving group in the absence of the other.
One might consider whether these results arise from the
good leaving group in pNPP that may not need an enzymatic
general acid to protonate it at the acidic pH optimum.
However, several lines of evidence show that general acid
catalysis is part of the mechanism of pNPP hydrolysis by PTPs,
as with other substrates. KIE results at the acidic pH optima
across the PTP family show that the leaving group leaves as the
neutral phenol in native enzymes but is charged when the
enzymatic general acid is mutated. In such mutants, the rates of
pNPP hydrolysis are significantly decreased, and pH−rate
profiles lose their basic limbs.13
D65 Has a Role Primarily in the Second Step and
Affects Substrate Binding. The fact that the D65N mutation
does not significantly affect activity, while the D65A mutation
does, suggests that the reduced level of catalysis in the D65A
mutant arises because of the inability of the alanine side chain
to participate in phosphoenzyme hydrolysis by orientation of
the nucleophilic water. In this sense, the roles of D65 and E134
are reversed from those of classical PTPs, in which the
conserved glutamine corresponding to E134 positions the
nucleophilic water and the acid corresponding to D65 is the
general acid in the first step and the general base in the second
step.
which is primarily in an open conformation in the free enzyme.
Because the IPD loop in VHZ is permanently closed,8 the D65
side chain is fixed in a position that restricts access to the deep
and narrow VHZ active site. DSPs, such as VHR, also have a
nonmovable general acid loop; however, in these enzymes, the
general acid is positioned on another side of the active site
(Figure 4) and presents less steric hindrance to incoming
ligands. This explains the higher KM for pNPP in VHZ
compared to other PTPs. The structurally analogous SsoPTP,
which also contains a rigid IPD loop, has a KM value
approximately 2-fold lower than that of VHZ and comparable
to that of VHR. However, unlike the active site of VHZ, which
has a narrow and deep pocket,8 the active site of SsoPTP is
broad and shallow because of the presence of multiple
surrounding glycine residues in the P-loop and IPD loop
(Figure 8).
Neither the D65A nor the D65N substitution significantly
affects the Ki for inorganic phosphate (Table 1). It also
confirms that the mutation of the D65 side chain does not
disrupt the P-loop, which serves as the dominant binding
element to the anionic phosphoryl group. In contrast, the
D65A mutation decreases the KS for pNPP 14-fold. This
suggests the effect of D65 substitutions on binding is primarily
steric rather than electrostatic, involving the ester group of the
substrate more than the phosphoryl group. This would permit
the biological activity of VHZ to be more regulated by levels of
intracellular phosphate than the activity of most classical PTPs.
The intracellular regulation of phosphatases by phosphate has
been recently discussed.30 Unlike classical PTPs with much
higher Ki values, VHZ, SsoPTP, and VHR have inhibition
constants similar to the average physiological concentration of
inorganic phosphate (1−1.3 mM).31
VHZ Has a Low Catalytic Efficiency and Different
Rate-Limiting Step Compared to Those of Most PTPs.
Despite the fact that VHZ is more active than previously
thought, it remains one of the least active PTPs. A significant
part of its decreased catalytic efficiency arises from its high KS.
The D65A mutation significantly decreases KM and KS. This
effect is less pronounced for mutations of the corresponding
residue in other PTPs. This may be explained by fact that in
classical PTPs this residue resides on the mobile WPD loop,
Indeed, for the PTP-catalyzed reaction (Scheme 1), kcat/KM =
k3/KS (see the Supporting Information for derivation), which
means that VHZ requires a 5−8-fold higher substrate
concentration to achieve its limiting velocity. In addition to
8021
dx.doi.org/10.1021/bi400776z | Biochemistry 2013, 52, 8012−8025

Biochemistry
Article
Figure 9. Two pNPP docking modes in the active site of VHZ predicted by docking studies. In mode A, the scissile ester oxygen of the pNPP
substrate is oriented toward the E134 side chain. Acid catalysis by D65 is not possible, as its side chain is displaced to relieve a steric clash with the
substrate. The D65A mutation removes this clash, explaining its lower KM. When E134 is mutated, general acid catalysis by D65 can occur from the
binding mode shown in mode B. Conformation B is analogous to that observed in the crystal structure of the substrate bound to an inactive mutant
of SsoPTP and is consistent with the pH−rate profile of E134Q.
high KS values, the kcat for VHZ is lower than those of classical
PTPs. Our data suggest that both steps of the VHZ-catalyzed
reaction are slower than in classical PTPs, and both contribute
to the overall rate [kcat = (k5k3)/(k3 + k5)] under steady-state
conditions. According to the KIE results, the neutralization of
the leaving group in the first step is incomplete, which
decreases k3 but cannot explain the decrease in k5. It was
previously shown that mutations of Q-loop residues in classical
PTPs decrease k5 by 2 orders of magnitude, an effect that was
used to trap the phosphoenzyme intermediate of PTP1B.24,29
The E134Q mutation makes VHZ structurally more similar to
classical PTPs and affects only the first step, resulting in the 8-
fold decrease in activity. The kcat value of the E134A mutant is
70% of that of the E134Q mutant. Such an insignificant
decrease from complete removal of the functional group
indicates that the residue does not function in the second step
like the Q in this position in classical PTPs, explaining the
lower k5 in VHZ compared to those of other PTPs. The k5
value of native VHZ is more similar to that of VHR (Table 4),
which in place of the Q-loop (Figure 4) has an N-loop region
(Figure 8) that is highly conserved among atypical DSPs.
VHZ Has Two Substrate Binding Modes for pNPP. The
expressions for kcat and KM for the PTP-catalyzed reaction
(Scheme 1) {kcat = (k5k3)/(k3 + k5), and KM = KS[k5/(k3 +
k5)]} contain the same elementary constants, and thus, any
change in kcat is reflected in KM and vice versa. A decrease in k3
results in an increased KM as is seen in the VHZ/E134Q/D65N
double mutant, in which both general acids important in k3 are
mutated but k5 remains unaffected. As k3 becomes smaller than
k5, KM approaches KS. Because of this, the KM for the VHZ/
D65N/E134Q double mutant (Table 3) is close to the KS for
native VHZ determined from pre-steady-state kinetics (Table
4). The same effect has been previously observed in the general
acid D92N mutant of VHR.23 In contrast, mutations of Q-loop
residues that do not affect k3 but decrease k5 have the opposite
effect on KM. The same trend was previously observed in the
Q556M and Q446A mutants of YopH.6 The decrease in k5
reduces the rate of formation of the free enzyme form E, which
lowers the KM parameter in the steady-state experiment. This
mutual dependence of kcat and KM becomes less obvious when
k3 ≫ k5, but because in native VHZ the two constants are
relatively similar (consistent with the absence of a burst), even
small changes should be easily detected. The E134Q mutation
in VHZ eliminates the major general acid but results in an only
10-fold decrease in kcat and has no effect on KM. The D65N
substitution results in a modest rate reduction, consistent with
its role as the minor general acid, but also has no significant
effect on KM. The pH−rate profiles of both mutants remain
bell-shaped, indicating that when one general acid is eliminated,
the other one remains, maintaining general acid catalysis. The
kinetic behavior of the mutants suggests the presence of two
catalytically equivalent, but differently populated, forms of the
Michaelis complex. Similar to the mode of action of a
noncompetitive inhibitor on the native enzyme, the E134Q
or D65N mutation renders one of the two conformations
catalytically unproductive, which decreases the rate but has no
effect on KM.
To gain insights into substrate binding modes in VHZ that
might explain how either D65 or E134 can act as a general acid,
AutoDock15,16,32,33 and FlexX17 were used to predict the
orientation of pNPP in the active site. Both programs predicted
two possible conformations, presented in Figure 9. In each, the
phosphate moiety of the substrate is coordinated by the P-loop
and the side chain of R101 and is properly positioned for
nucleophilic attack by the negatively charged cysteine at the
bottom of the active site. In conformation A, the scissile oxygen
is oriented toward E134, consistent with its assignment as the
primary general acid. The D65 side chain turns away to prevent
8022
dx.doi.org/10.1021/bi400776z | Biochemistry 2013, 52, 8012−8025

Biochemistry
Article
a steric clash with the p-nitrophenyl ring. We conclude that this
substrate conformation is the predominant one, consistent with
the kinetic effects of the E134Q mutation and steric relief
observed in the D65A mutant. The substrate conformation in
Figure 9B is the one commonly observed in classical PTPs,
except for the position of the glutamine residue analogous to
E134, which occupies a different conformation to prevent a
steric clash with the substrate phenyl ring.29 However, it
resembles the position of the corresponding Q135 residue in
several structures of SsoPTP in complex with peptide
substrates.9 In this conformation, the phenolate ring is close
to the L97 side chain and D65 is oriented in a position to
donate its proton to the scissile oxygen of the leaving group.
This substrate orientation is consistent with the kinetic
behavior of the E134Q mutant, which utilizes D65 as its
general acid.
The presence of two binding conformations explains why the
E134Q and D65N mutants have different effects on kcat with no
significant effect on KM. If conformation B, in which the E134Q
mutant can utilize the D65 general acid, presents a minor
fraction of the overall enzyme−substrate complex, then it
would kinetically appear as a decrease in kcat because the
predominant conformation A would be catalytically unproduc-
tive in this mutant. The different effects of the D65N and
E134Q mutations on kcat with no significant effect on KM
suggest that while both conformations A and B coexist,
conformation A dominates. The E134Q or D65N substitution,
which results in conformation A or B becoming nonproductive,
respectively, is similar to the effect from noncompetitive
inhibition. Noncompetitive inhibition results from the for-
mation of a nonproductive enzyme−substrate−inhibitor
complex that decreases Vmax but has no effect on KM. The
reaction is catalyzed by the E134Q mutant in which
from Thermococcus kodakaraensis KOD1. On the basis of
structural comparisons with known PTPs, D63 was assigned as
the putative general acid. Unexpectedly, the D63A mutant was
found to be more active, not less, than the native enzyme.34 No
structure of Tk-PTP has been published; however, the protein
sequence (Figure S2 of the Supporting Information) suggests
the presence of a glutamic acid residue in a position
corresponding to that of E134 in VHZ. Like VHZ, Tk-PTP
may utilize a general acid different from the one implicated by
structural comparisons with the PTP family.
The finding of two alternate binding modes and two general
acids may be physiologically relevant, but the results presented
here do not address whether the same flexibility pertains to
peptide substrates. Physiological substrates for VHZ have not
been confirmed. Recently, the existence of two alternate
peptide substrate binding modes, depending on sequence, has
been reported for the related enzyme, VHR.35 In that case, only
a single general acid is in the active site and is used in both
conformations.
VHZ Exhibits Phosphotransferase Activity Controlled
by a Single Residue on the IPD-Loop. In classical PTPs, Q-
loop residues such as Q446 and Q450 in YopH (Figure 4), in
locations analogous to E134 and Q138 in VHZ, position the
nucleophilic water for the second step and shield the
phosphoenzyme from larger nucleophiles.6 In classical PTPs,
catalysis is unaffected by added ethylene glycol. In contrast,
YopH mutants in which these glutamines are mutated show
significant phosphoryl transfer to ethylene glycol.6 This has
provided a rationalization for why native VHR and LMW Ltp1,
which lack an analogous Q-loop, display phosphotransferase
activity.7 Thus, the observation of phosphotransferase activity
by VHZ was unexpected, because its E134 and Q138 residues
can be superimposed with Q446 and Q450 in YopH. The ratio
S of the second-order rate constant for alcoholysis by ethylene
glycol (kt) to the hydrolysis of the phosphoenzyme
intermediate (kcat′) is 14.4 (Table 5). This ratio was not
significantly affected by the E134Q mutation, indicating that
the E and Q residues, as was previously shown with YopH, are
interchangeable.6 The higher level of transphosphorylation by
the E134A mutant indicates that E134 provides some shielding
of the phosphoenzyme. However, the analogous Q446A
mutation in YopH results in a greater increase, from which
we conclude that E134 in VHZ does not function as effectively
in the second step as Q446 in YopH. The D65A substitution in
VHZ results in the most pronounced increase in the S ratio,
which, together with the decreased kcat and presence of a pre-
steady state burst, indicates that D65 is important in the second
step.
Interestingly, unlike VHZ, there is no effect of ethylene
glycol concentration on catalysis by SsoPTP. A sequence
alignment of the IPD loops of VHZ and SsoPTP revealed that
while SsoPTP contains two proline residues in this region, a
pattern that is highly conserved in the PTP family, VHZ has a
third proline, P68. In SsoPTP, V72 is found in the
corresponding position. The P68V mutation in VHZ results
in no significant change in kcat; however, phosphotransferase
activity is lost, and there is no dependence of the rate on
ethylene glycol concentration. The orthogonal V72P mutation
in SsoPTP confers phosphotransferase ability similar to that of
native VHZ. We thus conclude that the single-point mutation
of proline at the P68 position in VHZ, and the analogous V72
position in SsoPTP, controls the ability of these enzymes to
phosphorylate alcohols. Because the IPD loops in VHZ and
conformation A is unproductive and conformation B leads to
WT
product formation according to the equation VAmax = V /(1 +
max
WT
max
1/KAB), where V is the maximal rate of the reaction with
native VHZ and VAmax is the maximal velocity with the E134Q
mutant. The calculated value of KAB = [B]/[A] = 0.12 indicates
that ∼89% of the VHZ [ES] complex exists in conformation A
and 11% in form B. This ratio is consistent with the modest
decrease in kcat in the D65N mutant. The equilibrium constant
of 0.12 implies a modest energetic difference of slightly more
than 1 kcal/mol, consistent with the nearly equal scoring
function obtained from the docking programs for the two
conformations.
The predominance of conformation A in which the
phenolate ring interacts with the D65 side chain explains the
steric relief produced by the D65A mutation. The presence of
the E134 general acid and its use in conformation A may be a
reasonable evolutionary solution to permit a bulky substrate to
enter the narrow and sterically demanding active site pocket.
Conformation B is the one the most commonly observed in the
classical PTPs, which possess a movable WPD loop. This
conformation allows VHZ to utilize its D65 general acid.
However, under the condition of a nonmovable general acid-
bearing loop, conformation B is sterically disfavored, making it
less populated than conformation A. The presence of the two
coexisting but unequally populated conformations explains why
both the E134Q and D65N mutants retain their basic limbs in
the pH−rate profile but produce a proportionally different
effect on kcat without affecting KM.
A similar phenomenon may explain anomalous behavior
reported in the Tk-PTP, a protein tyrosine phosphatase isolated
8023
dx.doi.org/10.1021/bi400776z | Biochemistry 2013, 52, 8012−8025

Biochemistry
Article
SsoPTP are not mobile, this mutation has no effect on kcat.
Further studies, including structural comparisons, are underway
to seek an explanation of how this residue controls
phosphotransferase activity.
modes, and a sequence alignment of VHZ, SsoPTP, and Tk-
PTP. This material is available free of charge via the Internet at
http://pubs.acs.org.
AUTHOR INFORMATION
Corresponding Author
*E-mail: alvan.hengge@usu.edu. Phone: (435) 797-3442. Fax:
(435) 797-3390.
■
CONCLUSIONS
■
Although VHZ is more closely related to classical PTPs than to
DSPs, it is unique and has a number of unusual properties.
VHZ has two functional general acids and, for the small
molecule substrate pNPP, two substrate binding modes. Both
binding modes are catalytically equivalent but unequally
populated. Each binding mode utilizes a different general acid.
Despite the fact that VHZ shares many active site
characteristics of classical PTPs, it is a significantly less efficient
catalyst. Both catalytic steps k3 and k5 are slower. The decreased
k3 is consistent with incomplete neutralization of the leaving
group revealed by KIEs. The decrease in k5 is due to the less
efficient involvement of the E134 residue in the second step, as
revealed by the E134Q and E134A mutations.
Funding
This work was supported by National Institutes of Health
Grant GM47297 (A.C.H.).
Notes
The authors declare no competing financial interest.
ACKNOWLEDGMENTS
We thank Dr. Edwin Antony for use of his stopped-flow
spectrophotometer.
■
ABBREVIATIONS
The results also provide a rationale for the advantage of
mobility of the general acid-bearing WPD loop in classical
PTPs. The availability of an uncatalytic, open conformation
allows the general acid to avoid sterically unfavorable
interactions with substrate binding and to alleviate product
release and decrease the level of product inhibition.
The discovery of phosphotransferase activity of VHZ also
leads to several conclusions.
(1) The fact that the reaction rate increases linearly with
ethylene glycol concentration indicates the second step is at
least partially rate-limiting. Together with the absence of a burst
in the presteady state, we conclude that both steps contribute
to the overall rate.
(2) The Q-loop does not fully participate in protecting the
active site from incoming alcohol nucleophiles. Mutations in
the IPD loop of VHZ have a stronger effect on phospho-
transferase ability. It is logical to conclude that the
phosphotransferase activity observed in VH1-related DSPs
and low-molecular weight PTPs can no longer be explained
solely by the absence of a Q-loop. The significant difference in
the position of the general acid loop among classical PTPs,
LMW PTPs, and VH1-related DSPs undoubtedly contributes
as well.
(3) The presence of phosphotransferase activity in some
phosphatases, but not others, may have biological consequen-
ces. It may not be coincidental that some proteins known to be
associated with cancer, such as VH1-related DSPs and LMW
PTPs, and, recently, VHZ,36 reveal a high level of
phosphotransferase ability. Whether this process is random
and nonspecific, or transphosphorylation is selective for some
protein target, remains to be discovered. However, because
VHZ has a stringent phosphotyrosine specificity because of its
deep and narrow active site, we can conclude that its
transphosphorylation target would likely be limited to tyrosine
protein sites, or to small molecule nucleophile acceptors
capable of entering the active site.
■
KIE, kinetic isotope effect; VHR, Vaccinia H1-related protein
member R; LDP, low-molecular weight dual-specificity
phosphatase; VHZ, Vaccinia H1-related protein member Z;
YopH, Yersinia outer protein type H; SsoPTP, S. solfataricus
protein tyrosine phosphatase; DSP, dual-specificity phospha-
tase; pNPP, p-nitrophenyl phosphate; IPTG, isopropyl β-D-1-
thiogalactopyranoside; TEV, tobacco etch virus; PDB, Protein
Data Bank.
REFERENCES
■
(1) Tonks, N. K. (2006) Protein tyrosine phosphatases: From genes,
to function, to disease. Nat. Rev. Mol. Cell Biol. 7, 833−846.
(2) Zhang, Z. Y., Wang, Y., and Dixon, J. E. (1994) Dissecting the
catalytic mechanism of protein-tyrosine phosphatases. Proc. Natl. Acad.
Sci. U.S.A. 91, 1624−1627.
(3) Zhang, Z. Y., Malachowski, W. P., Van Etten, R. L., and Dixon, J.
E. (1994) Nature of the rate-determining steps of the reaction
catalyzed by the Yersinia protein-tyrosine phosphatase. J. Biol. Chem.
269, 8140−8145.
(4) Wang, W. Q., Sun, J. P., and Zhang, Z. Y. (2003) An overview of
the protein tyrosine phosphatase superfamily. Curr. Top. Med. Chem. 3,
739−748.
(5) Patterson, K. I., Brummer, T., O’Brien, P. M., and Daly, R. J.
(2009) Dual-specificity phosphatases: Critical regulators with diverse
cellular targets. Biochem. J. 418, 475−489.
(6) Zhao, Y., Wu, L., Noh, S. J., Guan, K. L., and Zhang, Z. Y. (1998)
Altering the nucleophile specificity of a protein-tyrosine phosphatase-
catalyzed reaction. Probing the function of the invariant glutamine
residues. J. Biol. Chem. 273, 5484−5492.
(7) Paoli, P., Modesti, A., Magherini, F., Gamberi, T., Caselli, A.,
Manao, G., Raugei, G., Camici, G., and Ramponi, G. (2007) Site-
directed mutagenesis of two aromatic residues lining the active site
pocket of the yeast Ltp1. Biochim. Biophys. Acta 1770, 753−762.
(8) Kuznetsov, V. I., Hengge, A. C., and Johnson, S. J. (2012) New
Aspects of the Phosphatase VHZ Revealed by a High-Resolution
Structure with Vanadate and Substrate Screening. Biochemistry 51,
9869−9879.
(9) Chu, H. M., and Wang, A. H. (2007) Enzyme-substrate
interactions revealed by the crystal structures of the archaeal Sulfolobus
PTP-fold phosphatase and its phosphopeptide complexes. Proteins 66,
996−1003.
ASSOCIATED CONTENT
* Supporting Information
Table of ionization constants associated with catalytically
relevant residues, plot of partial extinction coefficients for p-
nitrophenol versus pH, derivation of equations for PTP-
catalyzed reactions in the presence of alternative nucleophiles, a
kinetic model including two coexisting substrate binding
■
S
(10) Brandao, T. A. S., Hengge, A. C., and Johnson, S. J. (2010)
̃
Insights into the Reaction of Protein-tyrosine Phosphatase 1B. J. Biol.
Chem. 285, 15874−15883.
(11) Brandao, T. A., Robinson, H., Johnson, S. J., and Hengge, A. C.
(2009) Impaired acid catalysis by mutation of a protein loop hinge
8024
dx.doi.org/10.1021/bi400776z | Biochemistry 2013, 52, 8012−8025

Biochemistry
Article
residue in a YopH mutant revealed by crystal structures. J. Am. Chem.
Soc. 131, 778−786.
(31) Marshall, W. J., and Bangert, S. K. (2008) Clinical Biochemistry:
Metabolic and Clinical Aspects, 2nd ed., Elsevier, Amsterdam.
(32) Chang, M. W., Ayeni, C., Breuer, S., and Torbett, B. E. (2010)
Virtual screening for HIV protease inhibitors: A comparison of
AutoDock 4 and Vina. PLoS One 5, e11955.
(33) Sousa, S. F., Fernandes, P. A., and Ramos, M. J. (2006) Protein-
ligand docking: Current status and future challenges. Proteins 65, 15−
26.
(34) Jeon, S. J., Fujiwara, S., Takagi, M., Tanaka, T., and Imanaka, T.
(2002) Tk-PTP, protein tyrosine/serine phosphatase from hyper-
thermophilic archaeon Thermococcus kodakaraensis KOD1: Enzymatic
characteristics and identification of its substrate proteins. Biochem.
Biophys. Res. Commun. 295, 508−514.
(35) Luechapanichkul, R., Chen, X., Taha, H. A., Vyas, S., Guan, X.,
Freitas, M. A., Hadad, C. M., and Pei, D. (2013) Specificity profiling of
dual specificity phosphatase vaccinia VH1-related (VHR) reveals two
distinct substrate binding modes. J. Biol. Chem. 288, 6498−6510.
(36) Tang, J. P., Tan, C. P., Li, J., Siddique, M. M., Guo, K., Chan, S.
W., Park, J. E., Tay, W. N., Huang, Z. Y., Li, W. C., Chen, J., and Zeng,
Q. (2010) VHZ is a novel centrosomal phosphatase associated with
cell growth and human primary cancers. Mol. Cancer, 128.
(12) Bourne, N., and Williams, A. (1984) Effective charge on oxygen
in phosphoryl group transfer from an oxygen donor. J. Org. Chem. 49,
1200−1204.
(13) Hengge, A. C. (2002) Isotope effects in the study of phosphoryl
and sulfuryl transfer reactions. Acc. Chem. Res. 35, 105−112.
(14) Hengge, A. C., and Cleland, W. W. (1990) Direct measurement
of transition-state bond cleavage in hydrolysis of phosphate esters of p-
nitrophenol. J. Am. Chem. Soc. 112 (20), 7421−7422.
(15) Trott, O., and Olson, A. J. (2010) AutoDock Vina: Improving
the speed and accuracy of docking with a new scoring function,
efficient optimization, and multithreading. J. Comput. Chem. 31, 455−
461.
(16) Seeliger, D., and de Groot, B. L. (2010) Ligand docking and
binding site analysis with PyMOL and Autodock/Vina. J. Comput.-
Aided Mol. Des. 24, 417−422.
(17) Rarey, M., Kramer, B., and Lengauer, T. (1995) Time-efficient
docking of flexible ligands into active sites of proteins. Proc. Int. Conf.
Intell. Syst. Mol. Biol., 3rd 3, 300−308.
(18) Fuhrmann, J., Rurainski, A., Lenhof, H. P., and Neumann, D.
(2010) A new Lamarckian genetic algorithm for flexible ligand-
receptor docking. J. Comput. Chem. 31, 1911−1918.
(19) Hengge, A. C., Denu, J. M., and Dixon, J. E. (1996) Transition-
state structures for the native dual-specific phosphatase VHR and
D92N and S131A mutants. Contributions to the driving force for
catalysis. Biochemistry 35, 7084−7092.
(20) Alonso, A., Burkhalter, S., Sasin, J., Tautz, L., Bogetz, J., Huynh,
H., Bremer, M. C., Holsinger, L. J., Godzik, A., and Mustelin, T.
(2004) The minimal essential core of a cysteine-based protein-tyrosine
phosphatase revealed by a novel 16-kDa VH1-like phosphatase, VHZ.
J. Biol. Chem. 279, 35768−35774.
(21) Takagaki, K., Satoh, T., Tanuma, N., Masuda, K., Takekawa, M.,
Shima, H., and Kikuchi, K. (2004) Characterization of a novel low-
molecular-mass dual-specificity phosphatase-3 (LDP-3) that enhances
activation of JNK and p38. Biochem. J. 383, 447−455.
(22) Wu, Q., Li, Y., Gu, S., Li, N., Zheng, D., Li, D., Zheng, Z., Ji, C.,
Xie, Y., and Mao, Y. (2004) Molecular cloning and characterization of
a novel dual-specificity phosphatase 23 gene from human fetal brain.
Int. J. Biochem. Cell Biol. 36, 1542−1553.
(23) Denu, J. M., Lohse, D. L., Vijayalakshmi, J., Saper, M. A., and
Dixon, J. E. (1996) Visualization of intermediate and transition-state
structures in protein-tyrosine phosphatase catalysis. Proc. Natl. Acad.
Sci. U.S.A. 93, 2493−2498.
(24) Flint, A. J., Tiganis, T., Barford, D., and Tonks, N. K. (1997)
Development of “substrate-trapping” mutants to identify physiological
substrates of protein tyrosine phosphatases. Proc. Natl. Acad. Sci. U.S.A.
94, 1680−1685.
(25) Zhang, Z. Y., Wu, L., and Chen, L. (1995) Transition state and
rate-limiting step of the reaction catalyzed by the human dual-
specificity phosphatase, VHR. Biochemistry 34, 16088−16096.
(26) Hengge, A. C., Sowa, G. A., Wu, L., and Zhang, Z. Y. (1995)
Nature of the transition state of the protein-tyrosine phosphatase-
catalyzed reaction. Biochemistry 34, 13982−13987.
(27) Brandao, T. A., Johnson, S. J., and Hengge, A. C. (2012) The
molecular details of WPD-loop movement differ in the protein-
tyrosine phosphatases YopH and PTP1B. Arch. Biochem. Biophys. 525,
53−59.
(28) Hengge, A. C., Zhao, Y., Wu, L., and Zhang, Z. Y. (1997)
Examination of the transition state of the low-molecular mass small
tyrosine phosphatase 1. Comparisons with other protein phosphatases.
Biochemistry 36, 7928−7936.
(29) Pannifer, A. D., Flint, A. J., Tonks, N. K., and Barford, D. (1998)
Visualization of the cysteinyl-phosphate intermediate of a protein-
tyrosine phosphatase by X-ray crystallography. J. Biol. Chem. 273,
10454−10462.
(30) Dick, C. F., Dos-Santos, A. L. A., and Meyer-Fernandes, J. R.
(2011) Inorganic Phosphate as an Important Regulator of
Phosphatases. Enzyme Res. 2011, 1−7.
8025
dx.doi.org/10.1021/bi400776z | Biochemistry 2013, 52, 8012−8025