Characterization of a novel hormone-sensitive lipase family esterase from Rhizomucor miehei with tertiary alcohol hydrolysis activity

Article abstract of DOI:10.1016/j.molcatb.2014.08.008

A novel esterase gene (designated RmEstB) from the thermophilic fungus Rhizomucor miehei was cloned and functionally expressed in Escherichia coli. Sequence analysis revealed a 960-bp open reading frame encoding a protein of 319 amino acids. The deduced protein sequence contained an HGGG motif, suggesting that the enzyme is a hormone-sensitive lipase (HSL) family esterase. It showed highest identity of 52% with the esterase from Pseudomonas mandelii. The recombinant esterase was purified to homogeneity at 5.1-fold purification with a recovery yield of 85%. The molecular mass of RmEstB was estimated to be 37 kDa by SDS-PAGE. RmEstB was most active at pH 7.5 and 50 °C. The enzyme was highly stable in the presence of 30% ethanol, methanol, acetone, isopropanol, dimethyl sulfoxide and acetonitrile. RmEstB showed a broad range of substrate specificities toward various p-nitrophenol (pNP) esters (C₂-C₁₀) and triglycerides (C₂-C₆), with the highest specific activities obtained for pNP acetate (255 U/mg) and triacetin (1330 U/mg), respectively. In addition, RmEstB efficiently catalyzed the hydrolysis of sterically hindered esters of tertiary alcohols. This study presents a novel fungal HSL family esterase with potential for some industrial applications.

Full text of DOI:10.1016/j.molcatb.2014.08.008

Journal of Molecular Catalysis B: Enzymatic 109 (2014) 76–84
Contents lists available at ScienceDirect
Journal of Molecular Catalysis B: Enzymatic
journal homepage: www.elsevier.com/locate/molcatb
Characterization of a novel hormone-sensitive lipase family esterase
from Rhizomucor miehei with tertiary alcohol hydrolysis activity
Qiao-juan Yana, Shao-qing Yangb, Xiao-jie Duanb, Hai-bo Xua,
Yu Liub, Zheng-qiang Jiangb,∗
a Bioresource Utilization Laboratory, College of Engineering, China Agricultural University, Beijing 100083, China
b Department of Biotechnology, College of Food Science and Nutritional Engineering, China Agricultural University, Beijing 100083, China
a r t i c l e i n f o
a b s t r a c t
Article history:
A novel esterase gene (designated RmEstB) from the thermophilic fungus Rhizomucor miehei was cloned
and functionally expressed in Escherichia coli. Sequence analysis revealed a 960-bp open reading frame
encoding a protein of 319 amino acids. The deduced protein sequence contained an HGGG motif, suggest-
ing that the enzyme is a hormone-sensitive lipase (HSL) family esterase. It showed highest identity of 52%
with the esterase from Pseudomonas mandelii. The recombinant esterase was purified to homogeneity at
5.1-fold purification with a recovery yield of 85%. The molecular mass of RmEstB was estimated to be
37 kDa by SDS-PAGE. RmEstB was most active at pH 7.5 and 50 ◦C. The enzyme was highly stable in the
presence of 30% ethanol, methanol, acetone, isopropanol, dimethyl sulfoxide and acetonitrile. RmEstB
showed a broad range of substrate specificities toward various p-nitrophenol (pNP) esters (C2–C10) and
triglycerides (C2–C6), with the highest specific activities obtained for pNP acetate (255 U/mg) and triacetin
(1330 U/mg), respectively. In addition, RmEstB efficiently catalyzed the hydrolysis of sterically hindered
esters of tertiary alcohols. This study presents a novel fungal HSL family esterase with potential for some
industrial applications.
Received 17 March 2014
Received in revised form 18 July 2014
Accepted 11 August 2014
Available online 20 August 2014
Keywords:
Rhizomucor miehei
Esterase
Hormone-sensitive lipase
Characterization
Tertiary alcohol
© 2014 Elsevier B.V. All rights reserved.
1. Introduction
paper and pulp, detergents and the dairy industry, based on their
widely varied enzymatic properties [2]. However, there are still
Esterases (EC 3.1.1.1) and lipases (EC 3.1.1.3) belong to the
general class of carboxylic ester hydrolases, catalyzing both the
cleavage and formation of ester bonds of an extensive range
of substrates [1]. Esterases exhibit maximum activity toward
water-soluble or emulsified esters of short-chain (less than 10
carbon atoms) carboxylic acids, whereas lipases prefer long-
chain (≥10 carbon atoms) esters [2]. Both types of enzymes
share a definite order of ␣-helices and ␤-sheets, termed ␣/␤
hydrolase fold, in their three-dimensional structures [3], and
most of them contain the consensus sequence Gly–X–Ser–X–Gly
around the active site [4]. The most significant difference between
esterases and lipases is their ability to act on surface displays:
lipases exhibit interfacial activation whereas esterases do not
[5].
some bottlenecks in the industrial usage of known esterases, such
as low production yield, limited pH and thermal stability, and poor
performance in organic solvents [6]. Several strategies have been
used to overcome these limitations, such as molecular modifica-
tion [7] and protein engineering [8,9]. Alternatively, it has been
proposed that instead of modifying enzymes to enhance their prop-
erties, it is more desirable to isolate naturally evolved enzymes
directly for industrial applications [10].
To date, a number of esterases have been purified and biochemi-
cally characterized from various microbes, such as Pseudoalteromas
sp. strain 643A [11], Rhodococcus sp. [6], Bacillus subtilis strain
DR8806 [12], Psychrobacter celer strain 3Pb1 [13] and Sulfolobus
solfataricus [14]. Some esterase genes have been cloned and het-
erologously expressed, including those from Oenococcus oeni [15],
Mycobacterium tuberculosis strain Rv0045c [16], Thermus ther-
mophilus strain HB27 [17], Pelagibacterium halotolerans B2T [18],
Thermotoga maritima [19] and Bacillus sp. strain BP-7 [20]. In
addition, several esterase genes have been cloned, expressed and
characterized from various metagenomic DNA libraries [21–24].
Despite growing interest in esterases, most of them are from bacte-
ria, and only a few have been reported from fungi [25–29].
Microbial esterases have attracted considerable attention in the
last decades due to their broad array of potential applications in
fields such as food, pharmaceuticals, cosmetics, organic chemicals,
∗
Corresponding author. Tel.: +86 10 62737689; fax: +86 10 82388508.
E-mail address: zhqjiang@cau.edu.cn (Z.-q. Jiang).
http://dx.doi.org/10.1016/j.molcatb.2014.08.008
1381-1177/© 2014 Elsevier B.V. All rights reserved.

Q.-j. Yan et al. / Journal of Molecular Catalysis B: Enzymatic 109 (2014) 76–84
77
In a previous study, we cloned and biochemically characterized
an esterase (RmEstA) from the thermophilic fungus Rhizomucor
miehei strain CAU432 [29]. This novel esterase showed high-
efficiency flavor-ester synthesis. In a further experiment, another
novel esterase (RmEstB) belonging to the hormone-sensitive lipase
(HSL) family with relatively high molecular mass was found in the
same strain. Hence, in this paper, we report on the cloning, expres-
sion and biochemical characterization of this second novel esterase.
In addition, the potential application of RmEstB as a catalyst for the
hydrolysis of tertiary alcohol esters was investigated.
a BD SMARTTM RACE cDNA Amplification Kit (Clontech, Palo Alto,
CA, USA). To amplify the 5ꢀ end of the cDNA, the RACE product
was amplified with primer Est5ꢀGSP and an adapter primer (UPM),
and subjected to nested PCR using nested gene-specific primer
Est5ꢀNGSP and adapter primer NUP (Table 1). The PCR conditions
for RACE were: one cycle of 1 min at 94 ◦C, followed by 30 cycles of
30 s at 94 ◦C, 30 s at 68 ◦C and 1 min at 72 ◦C, and finally 10 min at
72 ◦C. For the 3ꢀ RACE, the primary PCR was performed with primers
Est3ꢀGSP and UPM followed by a nested PCR using nested gene-
specific primer Est3ꢀNGSP and NUP. The obtained PCR product was
thus purified, cloned and sequenced. To amplify the coding region
from the genomic DNA, the same PCR conditions were used with
specific primers EstDNAF and EstDNAR (Table 1). The PCR product
was gel-purified, ligated to pMD18-T vector, transferred into E. coli
strain DH5␣ for sequencing and finally subjected to BLAST analysis.
Sequence assembly was performed with DNAMAN software
(LynnonBiosoft, Quebec, Canada). Database homology search
of obtained nucleotide sequences was carried out using BLAST
in GenBank at NCBI (http://blast.ncbi.nlm.nih.gov/Blast.cgi).
Multiple sequence alignment analysis was performed using
Clustal W program (ftp://ftp-igbmc.u-strasbg.fr/pub/ClustalW/).
Signal peptide was analyzed by SignalP 4.0 server
2. Materials and methods
2.1. Materials
Linalyl acetate, linalool, p-nitrophenol (pNP), p-nitrophenyl
acetate (pNPA), p-nitrophenyl butyrate (pNPB), p-nitrophenyl
caprylate (pNPC), p-nitrophenyl decanoate (pNPD), p-nitrophenyl
laurate (pNPL), p-nitrophenyl myristate (pNPM), p-nitrophenyl
palmitate (pNPP), 4-methylumbelliferyl butyrate (MUF-butyrate)
and Fast Red TR Salt were purchased from Sigma Chemical Co. (St.
Louis, MO, USA). p-Nitrophenyl hexanoate (pNPH) was obtained
from HEOWNS Company (Tianjin, China). Triacetin (C2), tribu-
tyrin (C4), tricaproin (C6), tricaprylin (C8) and tricaprin (C10) were
obtained from TCI Co. (Tokyo, Japan).
(http://www.cbs.dtu.dk/services/SignalP/).
ysis of conserved domains was carried out using
ScanProsite (http://prosite.expasy.org/scanprosite/). N-
Search
anal-
Glycosylation sites were predicted using NetNGlyc1.0
(http://www.cbs.dtu.dk/services/NetNGlyc/).
Escherichia coli strain DH5␣ (Biomed, Beijing, China) and the
plasmid pMD18-T (TaKaRa, Tokyo, Japan) were used for DNA
manipulations and amplification. E. coli strain BL21 (DE3) (Biomed)
and the pET-30a(+) vector (Novagen, Madison, WI, USA) were used
for protein expression. PrimeSTAR HS DNA polymerase and restric-
tion endonucleases were purchased from TaKaRa. T4 DNA ligase
was purchased from New England Biolabs (Ipswich, MA, USA). All
other chemicals were of analytical grade unless otherwise stated.
2.4. Expression of the esterase gene in E. coli
To express the esterase gene in E. coli, the open reading frame
(ORF) region of the cDNA gene was amplified by PCR with RmEstBF
and RmEstBR (Table 1) as primers. NdeI and XhoI sites (underlined
in Table 1) were added to the forward and reverse primers, respec-
tively. The PCR program was as follows: a hot start at 94 ◦C for
5 min, 30 cycles of 94 ◦C for 30 s, 55 ◦C for 30 s and 72 ◦C for 1 min,
and a final extension cycle at 72 ◦C for 10 min. The obtained cDNA
product was purified, cloned into pMD18-T, and then transformed
into E. coli strain DH5␣. The recombinant plasmid containing the
esterase gene was recovered and digested with the respective
restriction enzymes NdeI and XhoI, subcloned into the correspond-
ing sites of the pET-30a(+) vector, and transformed into E. coli
strain BL21 competent cells for protein expression. The positive
colonies were isolated from LB agar plates containing kanamycin
(50 ␮g mL−1). Transformants were identified by enzymatic diges-
tion and PCR analysis, and further confirmed by DNA sequencing.
Seed culture of E. coli strain BL21 harboring the esterase gene in
vector pET-30a(+) was prepared by incubating cells at 37 ◦C in a
rotary shaker with a rotation speed of 200 rpm for 4 h, and then
inoculating on LB medium (1 l) containing 50 ␮g/ml kanamycin.
2.2. Strain and cultivation
R. miehei strain CAU432 used in this study has been deposited
in the China General Microbiological Culture Collection Center
(CGMCC) under accession number 4967. For isolation of genomic
DNA, R. miehei CAU432 was cultivated at 50 ◦C for 2 days in liq-
uid medium containing (g/l): oat flour (30), soybean peptone (10),
MgSO4·7H2O (0.3), KH2PO4 (5) and CaCl2 (0.3), and the initial cul-
ture pH was adjusted to 7.0. The mycelia were collected and ground
to a fine powder under liquid nitrogen.
2.3. Cloning of the esterase gene and sequence analysis
Recombinant DNA techniques described by Sambrook and Rus-
sell [30] were employed to perform DNA manipulations. Genomic
DNA was isolated from R. miehei strain CAU432 mycelium using
CTAB (hexadecyltrimethyl ammonium bromide) according to the
method of Lodhi et al. [31]. Total RNA was isolated with the Tri-
zol reagent (Invitrogen, Carlsbad, CA), and mRNAs were purified
using the Oligotex mRNA Midi Kit (Qiagen, Hilden, Germany).
Genomic DNA of R. miehei strain CAU432 was used as a template
for subsequent PCR amplification. The degenerate primers EstDF
and EstDR (Table 1) were designed based on two conserved motifs
(LAVAGDSAGGN and DVLRDEGEAYA) of known esterases using
the CODEHOP algorithm [32], and were used to amplify a partial
esterase gene. PCR conditions were as follows: a hot start at 94 ◦C
for 5 min, 10 cycles of 94 ◦C for 30 s, 60–55 ◦C for 30 s and 72 ◦C for
1 min, followed by 20 cycles of 94 ◦C for 30 s, 55 ◦C for 30 s and 72 ◦C
for 1 min. The amplified PCR product was purified, ligated to vector
pMD18-T and sequenced.
Table 1
Primers used in this study.
Primers
Primer sequence (5ꢀ→3ꢀ)
EstDFa
GCCGGCGACTCCgcnggnggnaa
CTCGCCCTCGTCTcknarnacrtc
EstDRa
Est5ꢀGSP
Est5ꢀNGSP
Est3ꢀGSP
Est3ꢀNGSP
EstDNAF
EstDNAR
RmEstBFb
RmEstBRb
TCGCCTTCCTCTCGGAGAACATC
GGAGAACATCAGCTTCTGCGG
ACTCTGCAGGTGGTAACCTGTC
TGGTAACCTGTCCGCGGTTGT
ATGGCACCCACTGTGAAGC
TTATTTCCAGGTCTTTTGCAACCAG
GGGTTTCATATGGCACCCACTGTGAAGC
ATTCCGCTCGAGTTTCCAGGTCTTTTGCAACCAG
To obtain the full-length cDNA sequence of the esterase, 5ꢀ and
3ꢀ rapid amplification of cDNA ends (RACE) was performed using
a
N = A/T/C/G, K = G/T, R = A/G.
Restriction enzyme sites incorporated into primers are underlined.
b

78
Q.-j. Yan et al. / Journal of Molecular Catalysis B: Enzymatic 109 (2014) 76–84
When the culture broth’s optical density at 600 nm (OD600) reached
0.6–0.8, expression was induced by adding 1 mM isopropyl ␤-d-
thiogalactopyranoside (IPTG). After the culture was further grown
at 30 ◦C for 12 h, the cells were harvested by centrifugation at
10,000 × g for 10 min at 4 ◦C.
The optimal temperature of the purified esterase was exam-
ined by measuring the enzyme’s activity at different temperatures
(30–80 ◦C) in 50 mM Tris–HCl buffer (pH 7.5). Thermostability of
the esterase was determined by measuring the enzyme activ-
ity retained at 50 ◦C in 50 mM Tris–HCl buffer (pH 7.5) after the
enzyme had been incubated in this buffer at different temperatures
(30–80 ◦C) for 30 min. For thermal denaturing half-life determina-
tion, the enzyme was treated at various temperatures (50–60 ◦C)
for 5 h, samples were withdrawn at different time intervals (from
5 min to 5 h), cooled on ice for 30 min, and then the residual activ-
ities were measured at 50 ◦C in 50 mM Tris–HCl buffer (pH 7.5).
The sample stored at 4 ◦C was used as control, and its activity was
expressed as 100%.
2.5. Purification of the recombinant esterase
Fermentation culture broth (1 l) was harvested by centrifuga-
tion. The precipitate was suspended in 50 mM phosphate buffer
(pH 8.0) containing 100 mM NaCl, and then disrupted by sonication.
Debris was removed by centrifugation at 8000 × g for 5 min, and the
clear supernatant was applied to a Ni-iminodiacetic acid (Ni-IDA)
column (1 × 5 cm2) (GE Healthcare) pre-equilibrated with buffer A
(50 mM Tris–HCl buffer pH 8.0 containing 500 mM NaCl and 20 mM
imidazole). The column was washed with 15 column volumes (CV)
of buffer A, followed by 5 CV of buffer B (50 mM Tris–HCl buffer
pH 8.0 containing 500 mM NaCl and 50 mM imidazole) and 5 CV
of buffer C (50 mM Tris–HCl buffer pH 8.0 containing 500 mM NaCl
and 200 mM imidazole) at a flow rate of 1.0 ml/min. The eluted pro-
teins were fractionally collected and checked for esterase activity.
The purity of the enzyme was checked by SDS-PAGE.
2.9. Effect of organic solvents, detergents and metal ions on
RmEstB activity
The effects of various organic solvents on the enzyme’s activ-
ity were determined by incubating it (at 40 ␮g/ml) with 30% (v/v)
of each organic solvent in 50 mM Tris–HCl buffer (pH 7.5) at 30 ◦C
for 1 h. The residual activity was then measured using the standard
enzyme assay. The organic solvents were methanol, ethanol, ace-
tone, acetonitrile, isopropanol and DMSO.
Stability of the enzyme in the presence of various detergents was
estimated by incubating the enzyme (40 ␮g/ml) in 50 mM Tris–HCl
buffer (pH 7.5) at 30 ◦C for 1 h in the presence of 5% (w/v) of the
following detergents: Tween 20, Tween 80, Triton X-100 and SDS.
The residual activities were then measured. The effect of metal ions
on the enzyme’s stability was also evaluated in a similar manner in
the presence of 10 mM of various metal ions.
2.6. Enzyme assay and protein determination
Esterase activity was determined according to the method of
Sumby et al. [15] using pNPA as the substrate with minor modi-
fications. A 50-␮l aliquot of suitably diluted enzyme solution was
added to 400 ␮l 2 mM pNPA substrate solution (prepared in 50 mM
Tris–HCl buffer pH 7.5) containing 10% (v/v) isopropanol, and incu-
bated at 50 ◦C for 10 min. Then the reaction was stopped by adding
500 ␮l of 300 mM phosphate buffer (pH 7.0) containing 5% (w/v)
SDS. The liberated pNP was quantified by measuring the absorbance
at 410 nm. One unit of enzyme activity was defined as the amount
of enzyme required to liberate 1 ␮mol pNP per minute under the
above assay conditions.
2.10. Substrate specificity and kinetics parameters
Substrate specificity of RmEstB was examined by measuring the
enzyme’s activity toward the pNP esters (pNPA, pNPB, pNPH, pNPC,
pNPD, pNPL, pNPM and pNPP), and the synthetic triacylglycerol sub-
strates (triacetin, tributyrin, tricaproin and tricaprylin). For the pNP
ester substrates, the measurement was the same as for the enzyme
assay, except that the substrate solution contained 0.1% (v/v) Triton
X-100 and 0.1% (w/v) arabic gum in addition to the different pNP
esters [36]. The substrate specificity for synthetic triacylglycerol
esters was analyzed titrimetrically using 10 mM NaOH for titration
according to the method of Egger et al. [37]. The substrates at a
concentration of 10 mM were emulsified in 20 ml phosphate buffer
(2.5 mM, pH 6.5) containing 1% arabic gum. The reaction was initi-
ated with 10 ␮l of suitably diluted enzyme, and incubated at 50 ◦C
for 10 min, after which the reaction was titrated and the amount of
consumed NaOH recorded. One unit of enzyme activity was defined
as the amount of enzyme required to release 1.0 ␮mol of pNP or
fatty acid per minute under the above assay conditions.
Protein concentration was measured by the Lowry method [33]
using bovine serum albumin (BSA) as the standard. Specific activity
was expressed as units per milligram protein.
2.7. SDS-PAGE and zymogram analysis
SDS-PAGE was performed according to the method of Laemmli
[34] using a 12.5% separating gel and 4.5% stacking gel. The protein
bands on the SDS-polyacrylamide gel were visualized by Coomassie
Brilliant Blue R250 staining. A low-molecular-weight calibration
kit (GE Healthcare) containing phosphorylase b (97.0 kDa), BSA
(66.0 kDa), ovalbumin (45.0 kDa), carbonic anhydrase (30.0 kDa),
trypsin inhibitor (20.1 kDa) and ␣-lactalbumin (14.4 kDa) was used.
Esterase activity staining on the polyacrylamide gel was performed
as described by Karpushova et al. [35].
The kinetic parameters of RmEstB toward pNPA, pNPB, pNPH,
pNPC and linalyl acetate were determined by measuring the
enzyme’s activity with different substrate concentrations at 50 ◦C
for 5 min in 50 mM Tris–HCl buffer (pH 7.5). The constant kinetic
parameters of Km and Vmax were calculated using “GraFit” software
(Erithacus Software Ltd., Horley, UK).
2.8. Biochemical characterization of the purified esterase RmEstB
The optimal pH of the purified esterase was determined by mea-
suring the enzyme’s activity in different buffers (50 mM) with pHs
ranging from 2.5 to 10.6. The buffers were glycine–HCl (pH 2.5–3.5),
citrate (pH 3.0–6.0), 2-(N-morpholino) ethane sulfonic acid (MES)
(pH 5.5–6.5), phosphate (pH 6.0–8.0), Tris–HCl (pH 7.0–9.0) and
glycine–NaOH (8.6–10.6). For pH stability, the purified esterase was
incubated in these different buffers for 60 min, and then the resid-
ual activity was measured at 50 ◦C in 50 mM Tris–HCl buffer (pH
7.5) by standard enzyme assay. The sample without treatment was
used as control, and its activity determined in optimal pH at 50 ◦C
was expressed as 100%.
2.11. Hydrolytic properties of RmEstB toward tertiary alcohol
esters
Hydrolysis of tertiary alcohol esters by RmEstB was examined as
described by Kang et al. [38] using linalyl acetate, terpinyl acetate
and cedryl acetate as the substrates. The reaction mixture contain-
ing each substrate (15 mg/ml) and the purified enzyme (1 mg/ml in
50 mM Tris–HCl buffer pH 7.5) was incubated on a rotary shaker
(150 rpm) at 30 ◦C for 4 h. The reaction was stopped by adding

Q.-j. Yan et al. / Journal of Molecular Catalysis B: Enzymatic 109 (2014) 76–84
79
Table 2
three volumes of ethanol, and the insoluble material was removed
Stability of the purified RmEstB in various organic solvents and detergents.
by centrifugation. Samples were periodically withdrawn and ana-
lyzed by thin-layer chromatography (TLC) and high-pressure liquid
chromatography (HPLC).
Organic solvents and detergents
Residual activity (%)a
Control
100
For TLC analysis, the reaction mixture was spotted onto a silica
gel plate (Merck silica gel 60 F, Darmstadt, Germany), and devel-
oped in a solvent system containing petroleum ether:ethyl acetate
(7:1, v/v). Compounds were visualized by spraying the TLC plate
with a solution of 5 g/l vanillin (prepared in 30% v/v H2SO4) and
then heating at 130 ◦C in an oven for a few minutes. HPLC was per-
formed using a Hydrosphere C18 column (250 × 4.6 mm2). Linalool
and linalyl acetate were eluted with a mobile phase of 60:40 (v/v)
acetonitrile:water at a flow rate of 0.8 ml/min. The UV detector was
set at 210 nm. The retention times for linalool and linalyl acetate
were 17.7 min and 9.9 min, respectively.
Methanol
Ethanol
Isopropanol
Acetone
Acetonitrile
DMSO
Tween 20
Tween 80
Triton X-100
SDS
100 1.1
123 3.7
125 3.8
117 3.7
113 4.6
120 2.1
145 4.5
138 4.2
110 2.6
258 6.1
a
Enzyme solution was mixed with different organic solvents (30%) or detergent
solutions (5%), and incubated at 30 ◦C for 1 h prior to determining the residual activ-
ity at 50 ◦C. Results are presented as means standard deviation (n = 3). The sample
in the buffer without of organic solvents and detergents was used as control.
3. Results
3.1. Cloning of the esterase gene from R. miehei and sequence
analysis
3.3. Effect of pH and temperature on the activity and stability of
RmEstB
A 407-bp partial gene fragment for an esterase of R. miehei
strain CAU432 was amplified by PCR using degenerate primers
EstDF and EstDR (Table 1). Sequence analysis showed that the frag-
ment shared the highest sequence identity of 64% with the esterase
gene from Fluoribacter dumoffii strain Tex-KL (ZP 10140317). The
fragment’s 5ꢀ and 3ꢀ flanking regions were obtained by RACE
(rapid amplification of cDNA ends). By assembling the two flanking
regions, a 1206-bp putative full-length esterase cDNA (RmEstB) was
obtained. Analysis of the whole gene revealed the presence of a 960-
bp ORF encoding 319 amino acids, and three introns with sequence
lengths of 63 bp, 68 bp and 65 bp (Fig. 1). The nucleotide sequence
was deposited in the GenBank database under accession number
KC757348. The deduced protein has a predicted molecular mass
of 35,538 Da and a theoretical pI of 6.07. No possible glycosylation
sites or signal peptides were predicted in the RmEstB sequence.
Sequence analysis showed that RmEstB belongs to the ␣/␤
hydrolase family containing a catalytic triad consisting of Ser164,
Asp261 and His291 residues, and contains a well-conserved GDSAG
motif. An HGGG motif was also found at upstream of the active-
site conserved motif (from position 88 to 91), which is involved in
hydrogen-bonding interactions that stabilize the oxygen hole. The
motif is considered a criterion for the classification to HSL family
(family IV).
Based on amino acid sequence alignment, RmEstB showed the
highest similarity to the esterase from Pseudomonas mandelii (52%,
AEW10549, [39]), followed by the esterase from F. dumoffii (51%,
ZP 10140317). The amino acid sequence identities of RmEstB with
those of the other esterases from L. pneumophila (ABQ55291), Cyan-
othece sp. (ACL43266), Paenibacillus mucilaginosus (AEI44735), R.
miehei (AGC24321) and Bacillus amyloliquefaciens (AEB22650) were
50%, 48%, 47%, 46% and 43%, respectively (Fig. 2). No fungal esterase
was found that showed over 30% sequence identity with the present
esterase except RmEstA (AGC24321) from R. miehei [29].
The purified RmEstB showed relatively high activity under alka-
line conditions, and exhibited optimum activity at pH 7.5 in 50 mM
Tris–HCl (Fig. 4a). The enzyme was fairly stable over a broad pH
range of 4.5–10.1, since more than 90% of its original activity was
retained after incubation in the various buffers for 1 h (Fig. 4b).
The optimal temperature of RmEstB for pNPA hydrolysis was 50 ◦C,
and the enzyme activity decreased significantly at temperatures
below 40 ◦C and above 60 ◦C (Fig. 5a). RmEstB was stable up to
55 ◦C, retaining nearly 100% of its original activity after incubation
at this temperature for 60 min (Fig. 5b). The thermal denaturing half
lives of RmEstB at 50, 55 and 60 ◦C were determined to be 974 min,
294 min and 83 min, respectively (data not shown).
3.4. Effects of organic solvents, detergents and metal ions on the
enzyme activity of RmEstB
The enzyme activity of RmEstB was significantly activated in
the presence of 30% isopropanol, ethanol, DMSO, acetone and ace-
tonitrile, while not obviously affected by methanol (Table 2). In
addition, the enzyme’s activity was significantly promoted in the
presence of 5% SDS, and moderately activated in the presence of
Tween 20, Tween 80 and Triton X-100 (Table 2).
The esterase’s activity was strongly inhibited by Hg2+ (7%), Mg2+
(11%), Fe2+ (37%) and Sn2+ (67%), and moderately inhibited by Ag2+
(87%) and Cr2+ (88%). In contrast, the enzyme was greatly activated
by the addition of Ni2+ (145%), and significantly activated by Ba2+
(114%), Zn2+ (111%), Co2+ (108%) and Na+ (107%). No significant
effect was observed on the enzyme’s activity in the presence of
Cu2+ (104%), Mn2+ (99%) or Ca2+ (104%).
3.5. Substrate specificity and kinetic parameters of RmEstB
3.2. Expression of the esterase gene and purification of the
recombinant esterase (RmEstB)
RmEstB hydrolyzed pNP esters with carbon chain lengths ran-
ging from 2 to 16, with the highest hydrolysis rate observed for
pNPA, followed by pNPB and pNPH (Table 3). RmEstB also showed
hydrolytic activity on various emulsified synthetic triglycerides,
displaying the highest activity on triacetin. The specific activities
declined dramatically with increasing carbon numbers in the sub-
strates (Table 3). The values of the Michaelis-Menten constants Km
and Vmax toward pNPA, pNPB, pNPH, pNPC and linalyl acetate are
given in Table 4.
RmEstB was cloned and expressed in E. coli as a soluble
intracellular protein. The recombinant esterase was purified to
homogeneity with a fold purification of 5.1 and a recovery yield of
85%. The specificity activity of the purified esterase was 255 U/mg.
The molecular mass of RmEstB was estimated to be 37 kDa by
SDS-PAGE (Fig. 3), which matched its predicted molecular mass
(35,538 Da).

80
Q.-j. Yan et al. / Journal of Molecular Catalysis B: Enzymatic 109 (2014) 76–84
Fig. 1. Nucleotide and deduced amino acid sequences of the cDNA, flanking regions and genomic DNA of RmEstB from R. miehei. Conceptual translation of the ORF to the
319 amino acids is shown in one-letter code below the respective codon. The translation-initiation codon ATG and termination codon TAA are boxed. The asterisk indicates
the stop codon. Three intron sequences are shown in lowercase letters with dotted underlining. A poly(A+) tail is double underlined. The nucleotide sequence reported here
has been submitted to GenBank under accession number KC757348.
3.6. Hydrolytic properties of RmEstB toward tertiary alcohol
esters
esters of tertiary alcohols to tertiary alcohols. Quantita-
tive analysis by HPLC showed that most of the linalyl
acetate (98%) was converted to linalool in the first 4 h of
hydrolysis (Fig. 6b). In addition, RmEstB could hydrolyze ter-
pinyl acetate, but hardly hydrolyze cedryl acetate (data not
shown).
TLC analysis showed that linalyl acetate is completely con-
verted to linalool by the purified RmEstB in 6 h of hydrolysis
(Fig. 6a), indicating that RmEstB can efficiently hydrolyze

Q.-j. Yan et al. / Journal of Molecular Catalysis B: Enzymatic 109 (2014) 76–84
81
Fig. 2. Multiple alignment of amino acid sequences of several esterases. Numbers on the left are the residue number of the first amino acid in each line. Abbreviations and
accession numbers of the esterases are as follows: Rhizomucor miehei (RmEstB, R.m. KC757348; RmEstA, R.m. AGC24321), Pseudomonas mandelii (P.m. AEW10549), Fluoribacter
dumoffii (F.d. ZP10140317), Legionella pneumophila (L.p. ABQ55291), Cyanothece sp. (C.s. ACL43266), Paenibacillus mucilaginosus (P.m. AEI44735) and Bacillus amyloliquefaciens
(B.a. AEB22650). Identical residues are shaded in black, and conserved residues are shaded in gray. The conserved catalytic motif is underlined. The hormone-sensitive lipase
(HSL) family conserved motif is shown with dotted underlining. The putative catalytic nucleophile and acid/base are identified by filled circles.
4. Discussion
on a first fungal esterase (RmEstA) from the thermophilic fun-
gus R. miehei strain CAU432, which exhibited potential application
in flavor-ester synthesis in the food industry [29]. In subsequent
investigations, another esterase (RmEstB) was identified in that
Though a number of microbial esterases have been reported,
only a few of them are from fungi [28]. Recently, we reported

82
Q.-j. Yan et al. / Journal of Molecular Catalysis B: Enzymatic 109 (2014) 76–84
a
100
90
80
70
60
50
40
30
20
10
0
2
3
4
5
6
7
8
9
10
pH
b
100
90
80
70
60
50
40
30
20
10
0
Fig. 3. SDS-PAGE and zymogram analysis of the purified esterase from R. miehei
(RmEstB). Lane M, low-molecular-weight protein standards; lane 1, purified esterase
(RmEstB); lane 2, zymogram analysis of esterase on SDS-polyacrylamide gel using
␣-naphthyl acetate.
Table 3
Substrate specificity of the purified RmEstB from R. miehei.
Substrate
Specific activity (U/mg)
Relative activity (%)
pNP estersa
pNPA (C2)
pNPB (C4)
pNPH (C6)
pNPC (C8)
255 5.4
92 2.6
100
36
2
3
4
5
6
7
8
9
10
19.1 0.4
10.5 0.4
3.5 0.1
1.3 0.03
0.6 0.01
7.5
4.1
1.4
0.5
0.2
0.01
pH
pNPD (C10
pNPL (C12
pNPM (C14
pNPP (C16
)
)
)
)
Fig. 4. Optimal pH (a) and pH stability (b) of the purified RmEstB from R. miehei.
The optimal pH was determined by measuring the enzyme’s activity using pNPA
as the substrate in different buffers at pHs ranging from 2.5 to 10.6. Buffers used
were: glycine-HCl (ꢀ) (pH 2.5–3.5), citrate (ꢁ) (pH 3.0–6.0), MES (ꢂ) (pH 5.5–6.5),
phosphate (♦) (pH 6.0–8.0), Tris-HCl (ꢃ) (pH 7.0–9.0) and glycine–NaOH (ꢁ) (pH
8.6–10.6). For pH stability determination, the enzyme was incubated in these dif-
ferent buffers for 60 min, and then residual activity was assayed at 50 ◦C in 50 mM
Tris–HCl buffer (pH 7.5) by standard assay. The sample without treatment was used
as control, and its activity determined in optimal pH at 50 ◦C was expressed as 100%.
0.05
0
Triglyceridesb
Triacetin (C2)
Tributyrin (C4)
Tricaproin (C6)
Tricaprylin (C8)
1330 21
89 2.1
27 0.6
8.9 0.1
100
6.7
2.1
0.7
a
Assays with pNP esters as substrates were performed at 50 ◦C in 50 mM Tris–HCl
(pH 7.5) containing 0.1% Triton X-100 and 0.1% arabic gum.
The specific activities for synthetic triglycerides were measured in 2.5 mM
Tris–HCl buffer (pH 6.5) containing 0.1% arabic gum.
residues and a GDSAG motif was predicted, indicating that RmEstB
belongs to the serine hydrolase family, as the GXSXG (where X
represents an arbitrary amino acid residue) motif is conserved in
the active site of most serine enzymes [5]. The typical HSL family
(also known as family IV) motif HGGG was predicted at upstream
of the active-site conserved motif (Fig. 1), suggesting that RmEstB
belongs to HSL family of esterases. In addition, RmEstB showed
relatively low sequence similarity with other reported esterases,
with the highest identity of 52% observed for P. mandelii esterase
(AEW10549, [39]) (Fig. 2), indicating that it is a novel HSL esterase.
It should be noted that RmEstB shared low sequence identity (46%)
with RmEstA reported in our previous investigation [29].
b
strain with a relatively high molecular mass (37 kDa) compared
to RmEstA (34 kDa). Herein we describe the gene cloning and bio-
chemical characterization of the second esterase – RmEstB – from
R. miehei strain CAU432.
Sequence analysis revealed that RmEstB belongs to the ␣/␤
hydrolase family of enzymes, which is one of the largest groups
of structurally related proteins with diverse catalytic functions [1].
A potential catalytic triad consisting of Ser164, Asp261 and His291
Table 4
Kinetic parameters of the purified RmEstB from R. mieheia.
Substrate
Vmax (␮mol/min/mg)
Km (mM)
kcat (s−1
)
kcat/Km (s−1 mM−1
)
pNPA
pNPB
pNPH
pNPC
328.8
145.5
51.8
32.8
7.43
1.6
1.1
5.6
4.7
6.5
0.195
0.086
0.031
0.019
0.004
0.122
0.078
0.005
0.004
0.0007
Linalyl acetate
a
The kinetic parameters of the purified esterase were determined by measuring the enzyme activities with different substrate concentrations at 50 ◦C for 5 min in 50 mM
Tris–HCl buffer (pH 7.5).

Q.-j. Yan et al. / Journal of Molecular Catalysis B: Enzymatic 109 (2014) 76–84
83
Fig. 5. Effects of temperature on the activity (a) and stability (b) of RmEstB from
R. miehei. The optimal temperature was determined by measuring the enzymatic
activity at different temperatures (30–80 ◦C) under standard assay conditions. The
thermostability of RmEstB was determined by measuring the residual activities after
the enzyme had been incubated at different temperatures (30–80 ◦C) for 60 min. The
sample stored at 4 ◦C was used as control, and its activity was expressed as 100%.
Fig. 6. Profile of linalyl acetate hydrolysis by RmEstB from R. miehei detected by TLC
(a) and HPLC (b). Hydrolysis of linalyl acetate was qualitatively indicated by TLC:
lane M1, linalyl acetate; lane M2, linalool.
whose activities are inhibited by one or two kinds of these organic
solvents. For example, the esterase from P. halotolerans strain B2
is inhibited by acetonitrile and acetone [18], the esterase from a
compost metagenomic library is inhibited by acetone [38], and
the esterase from Bacillus sp. is inhibited by ethanol and propanol
[35]. Furthermore, several esterases have been reported to be acti-
vated in the presence of certain organic solvents, such as those
from the compost metagenomic library (activated by ethanol and
acetonitrile, [38]), Acinetobacter sp. strain EH28 (activated by ace-
tone, [10]), soil metagenomic DNA (activated by ethanol, [42]) and
O. oeni (activated by ethanol) [15]. RmEstB activity was obviously
enhanced by DMSO (20%), which differs from some other reported
esterases whose activities are not obviously affected one way or
the other [18,45]. In addition, RmEstB was stable in the presence
of various detergents, and its activity was obviously enhanced by
all tested detergents (Table 2), similar to RmEstA [29], whereas the
activities of most other esterases are either not obviously affected
or only slightly enhanced [10,18,38,42,45]. The excellent toler-
ance of RmEstB to organic solvents and detergents may enable
its use in the treatment of industrial effluents, the production of
inter-esterification substances, or the synthesis of useful chemical
compounds as well as molecule modifications.
RmEstB was purified to homogeneity and biochemically char-
acterized. The molecular mass of the enzyme was estimated to be
37 kDa by SDS-PAGE (Fig. 3), which is in accordance with most other
characterized HSL esterases which have molecular masses ranging
from 30 to 40 kDa [29,40–42]. Biochemical properties, in particular
pH and temperature range and stability, determine the conditions
under which a specific industrial process must operate [1]. The opti-
mal pH of RmEstB is 7.5, which is similar to that of most other
reported esterases [18,35,43], higher than that of a HSL esterase
from Pyrobaculum calidifontis [4] and RmEstA from R. miehei [29],
and lower than that of a HSL esterase from a soil DNA library [42]
and EstK from P. mandelii [39]. Most microbial esterases exhibit nar-
row pH stabilities under alkaline conditions [11,38,44]. However,
RmEstB in the present study also showed excellent stability across a
broad range of pHs (4.5–10.1) (Fig. 4). This range is much wider than
that of most other reported esterases from other sources, includ-
ing Bacillus sp. [35], Pseudoalteromas sp. strain 643A [11] and a
compost metagenomic library [38]. RmEstB displays a tempera-
ture optimum of 50 ◦C, and is unstable at temperatures above 55 ◦C
(Fig. 5). The optimal temperature is comparable to that of most
esterases from mesophilic microbes, but obviously lower than that
of the esterases from thermophilic bacteria, such as Rhodococcus
sp. strain LKE-028 (70 ◦C) [6] and T. tengcongensis (70 ◦C) [45].
Esterases are widely used in organic synthesis, which often
involves organic solvents [43]. Therefore, stability in organic sol-
vents is critically important for esterases. RmEstB was stable in the
presence of ethanol, acetone, isopropanol and acetonitrile, simi-
lar to RmEstA [29]. This is in contrast to other known esterases,
A criterion has been proposed whereby enzymes capable of
hydrolyzing triglycerides with short chains (less than 10 carbon
atoms) are defined as esterases, while those capable of hydrolyz-
ing triglycerides with long chains (≥10 carbon atoms) are defined
as lipases [46]. RmEstB exhibited relatively high activity toward
both pNP esters and triglycerides with short chain lengths (Table 3),
clearly indicating that it belongs to the group of esterases. RmEstB
displayed the highest activities with pNPA and triacetin (C2)

84
Q.-j. Yan et al. / Journal of Molecular Catalysis B: Enzymatic 109 (2014) 76–84
(Table 3), and showed low activity toward esters with carbon chains
longer than six carbon atoms; this is similar to a HSL family esterase
from S. coelicolor strain A3 [40], but different from most other char-
acterized members of the HSL family esterases which show optimal
activity with butyrate or caproate esters [4,42]. The substrate speci-
ficity of RmEstB also differed from that of RmEstA, which showed
highest activities for pNPH and tributyrin (C4) [29]. It is interesting
that RmEstB also displayed activities toward pNP esters with car-
bon chains longer than 10 (C10–C14) (Table 3), a property which is
distinct from most other reported esterases [6,15,44].
[3] M. Nardini, B.W. Dijkstra, Curr. Opin. Struct. Biol. 9 (1999) 732–737.
[4] Y.J. Hotta, S. Ezaki, H. Atomi, T. Imanaka, Appl. Environ. Microbiol. 68 (2002)
3925–3931.
[5] U.T. Bornscheuer, FEMS Microbiol. Rev. 26 (2002) 73–81.
[6] L. Kumar, B. Singh, D.K. Adhikari, J. Mukherjee, D. Ghosh, Process Biochem. 47
(2012) 983–991.
[7] M.K. Hedge, A.M. Gehring, C.T. Adkins, L.A. Weston, L.D. Lavis, R.J. Johnson,
Biochim. Biophys. Acta 1824 (2012) 1024–1030.
[8] A.O. Magnusson, J.C. Rotticci-Mulder, A. Santagostino, K. Hult, Chem. Biochem.
6 (2005) 1051–1056.
[9] S. Yoon, S. Kim, S. Park, E. Hong, J. Kim, S. Kim, T.H. Yoo, Y. Ryu, J. Mol. Catal. B
Enzym. 100 (2014) 25–31.
[10] E.H. Ahmed, T. Raghavendra, D. Madamwar, Bioresour. Technol. 101 (2010)
3628–3634.
Tertiary alcohols are important intermediates for the syn-
thesis of various fragrance compounds, organic chemicals and
valuable pharmaceuticals [20,47]. The production of tertiary alco-
hols by chemical processes generally requires extreme conditions.
Enzymatic conversion provides an opportunity for more environ-
mentally friendly routes for the production of tertiary alcohols from
racemates [43]. Linalyl alcohol, one of the most important terpene
alcohols that is mainly abundant in flowers, has been widely used
in the fragrance and flavor industries. It is interesting that RmEstB
efficiently hydrolyzed the tertiary alcohol ester linalyl acetate to
yield linalyl alcohol, similar to two esterases from metagenomic
DNA libraries [42,43], while most other esterases and lipases do
not possess this ability [43]. Moreover, the conversion yield (98%)
is much higher than those of the other two esterases with a conver-
sion yield of less than 50% [42,43]. This property makes this enzyme
attractive for possible practical application in the production of fla-
vor compounds in the food industry. In general, esterases cannot
use tertiary alcohol esters as substrates due to the steric require-
ments of their structure [42]. RmEstB’s hydrolytic activity toward
tertiary alcohol esters may be due to its containing a GGGW motif
near its active site. The presence of a GGG(A)X motif in the oxyanion
hole has been reported to be important for activity toward tertiary
alcohols as it can provide broad binding sites for tertiary alcohol
esters [20,47].
[11] H. Cieslinski, A.M. Bialkowska, A. Dlugolecka, M. Daroch, K.L. Tkaczuk, H. Kali-
nowska, J. Kur, M. Trukiewiez, Arch. Microbiol. 188 (2007) 27–36.
[12] A. Asoodeh, T. Ghanbari, J. Mol. Catal. B Enzym. 85 (2013) 49–55.
[13] G. Wu, S. Zhang, H. Zhang, S. Zhang, Z. Liu, J. Mol. Catal. B Enzym. 98 (2013)
119–126.
[14] J.K. Nam, Y.J. Park, H.B. Lee, J. Mol. Catal. B Enzym. 94 (2013) 95–103.
[15] K.M. Sumby, A.H. Matthews, P.R. Grbin, V. Jiranek, Appl. Environ. Microbiol. 75
(2009) 6729–6735.
[16] J. Guo, X. Zheng, L. Xu, Z. Liu, K. Xu, S. Li, T. Wen, S. Liu, H. Pang, PLoS One 5
(2010) e13143.
[17] S.N. Rocha, J. Abrahão-Neto, M.E. Cerdán, A.K. Gombert, M.I. González-Siso,
Appl. Microbiol. Biotechnol. 89 (2011) 375–385.
[18] X. Jiang, Y. Huo, H. Chen, X. Zhang, X. Zhu, M. Wu, Extremophiles 16 (2012)
427–435.
[19] T. Wei, S. Feng, D. Mao, X. Yu, C. Du, X. Wang, J. Mol. Catal. B Enzym. 85–86
(2013) 23–30.
[20] A. Fillat, P. Romea, F. Urpi, F.I. Javier Pastor, P. Diaz, Appl. Microiol. Biotechnol
(2014), http://dx.doi.org/10.1007/s00253-013-5458-9.
[21] C. Heath, X.P. Hu, S.C. Cary, D. Cowan, Appl. Environ. Microbiol. 75 (2009)
4657–4659.
[22] S. Biver, M. Vandenbol, J. Ind. Microbiol. Biotechnol. 40 (2013) 191–200.
[23] S. Wang, K. Wang, L. Li, Y. Liu, J. Mol. Catal. B Enzym. 95 (2013) 1–8.
[24] Y. Zhu, J. Li, H. Cai, H. Ni, A. Xiao, L. Hou, Microbiol. Res. 168 (2013)
589–597.
[25] R.E. Purdy, P.E. Kolattukudy, Biochemistry 13 (1975) 2824–2831.
[26] X. Fan, M. Mattey, Biotechnol. Lett. 21 (1999) 1071–1076.
[27] O. Calero-Rueda, V. Barba, E. Rodríguez, F. Plou, Á.T. Martínez, M.J. Martínez,
Biochim. Biophys. Acta 1794 (2009) 1099–1106.
[28] M. Chen, S. Fang, Afr. J. Biotechnol. 10 (2011) 5166–5172.
[29] Y. Liu, H. Xu, Q. Yan, S. Yang, X. Duan, Z. Jiang, PLoS One 8 (2013) e77856.
[30] J. Sambrook, D.W. Russell, Molecular Cloning: A Laboratory Manual, 3rd edn.,
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York, 2001.
[31] M.A. Lodhi, G.N. Ye, N.F. Weeden, B.I. Reisch, Plant Mol. Biol. Rep. 12 (1994)
6–13.
5. Conclusions
[32] T.M. Rose, J.G. Henikoff, S. Henikoff, Nucleic Acids Res. 31 (2003) 3763–3766.
[33] O.H. Lowry, N.J. Rosebrough, A. Farr, R.J. Randall, J. Biol. Chem. 193 (1951)
265–275.
[34] U.K. Laemmli, Nature 227 (1970) 680–685.
[35] A. Karpushova, F. Brümmer, S. Barth, S. Lange, R.D. Schmid, Appl. Microbiol.
Biotechnol. 67 (2005) 59–69.
[36] P.H. Janssen, C.R. Monk, H.W. Morgan, FEMS Microbiol. Lett. 120 (1994)
195–200.
[37] T. Egger, G. Pencreach, I. Douchet, R. Verger, K.E. Jaeger, Eur. J. Biochem. 267
(2000) 6459–6469.
[38] C.H. Kang, K.H. Oh, M.H. Lee, T.K. Oh, B.H. Kim, J.H. Yoon, Microb. Cell Factor. 10
(2011) 41.
[39] C. Lee, J. Kim, S. Hong, B. Goo, S. Lee, S.H. Jang, Appl. Biochem. Biotechnol. 169
(2013) 29–40.
A novel HSL family esterase-encoding gene (RmEstB) from R.
miehei was cloned and functionally expressed in E. coli. RmEstB
was most active at pH 7.5 and 50 ◦C, and exhibited a wide range of
pH stability (4.5–10.1). It displayed excellent stability in high con-
centrations of various organic solvents. Furthermore, the enzyme
showed a wide range of substrate specificities for various pNP
esters and triglycerides, and high efficiency for the hydrolysis of
tertiary alcohol esters. The remarkable organic solvent tolerance
and unique hydrolytic properties of RmEstB make it a potential
candidate for use in industrial processes.
[40] S.H. Soro, R. Rao, J. Cullum, Protein Eng. 22 (2009) 333–339.
[41] J.H. Jeon, H.S. Lee, J.T. Kim, S.H. Choi, S.G. Kang, J.H. Lee, Appl. Microbiol. Bio-
technol. 93 (2012) 623–631.
Acknowledgements
[42] P. Jin, X.L. Pei, P. Du, X. Yin, X. Xiong, H. Wu, X. Zhou, Q. Wang, Bioresour. Technol.
116 (2012) 234–240.
[43] K.H. Oh, G.S. Nguyen, E.Y. Kim, R. Kourist, U. Bornscheuer, T.K. Oh, J.H. Yoon, J.
Mol. Catal. B Enzym. 80 (2012) 67–73.
[44] Z.X. Yang, Y. Zhang, T.T. Shen, Y. Xie, Y.M. Mao, C.N. Ji, J. Biosci. Bioeng. 115
(2013) 133–137.
This work was financially supported by the National Natural
Science Foundation of China (Project no. 31371718) and National
Science fund for Distinguished Young Scholars (No. 31325021).
[45] L. Rao, Y.F. Xue, C. Zhou, J. Tao, G. Li, J.R. Lu, Y.H. Ma, Biochim. Biophys. Acta
1814 (2011) 1695–1702.
References
[46] K.E. Jaeger, B.W. Dijkstra, M.T. Reetz, Annu. Rev. Microbiol. 35 (1999)
315–351.
[47] R. Kourist, S.H. Krishna, J.S. Patel, F. Bartnek, T.S. Hitchman, D.P. Weiner, U.T.
Bornscheuer, Org. Biomol. Chem. 5 (2007) 3310–3313.
[1] R.A. Khudary, R. Venkatachalam, M. Katzer, S. Elleuche, G. Antranikian,
Extremophiles 14 (2010) 273–285.
[2] J.T. Kim, S.G. Kang, J.H. Woo, J.H. Lee, B.C. Jeong, S.J. Kim, Appl. Microbiol. Bio-
technol. 74 (2007) 820–828.