Antitubercular Triazines: Optimization and Intrabacterial Metabolism

Article

Antitubercular Triazines: Optimization and

Intrabacterial Metabolism

Graphical Abstract

Authors

Xin Wang, Daigo Inoyama,

Riccardo Russo, ..., Nancy Connell,

Pradeep Kumar, Joel S. Freundlich

Correspondence

freundjs@rutgers.edu

In Brief

Wang et al. disclose the optimization of a

triazine antitubercular agent and probe its

mechanism of action. They demonstrate

the signiﬁcance of studying intrabacterial

drug metabolism. Through this approach

and other methods, they evidence a novel

,

mechanism involving NO release and

inhibition of the cell wall biosynthesis

enzyme InhA.

Highlights

d

Optimization of an antitubercular agent afforded gains in

solubility and plasma PK

,

The triazines release intrabacterial NO as the predominant

mechanism of action

The triazines/their intrabacterial metabolites also inhibit InhA

and FAS-II pathway

Wang et al., 2020, Cell Chemical Biology 27, 1–14

January 16, 2020 ª 2019 Elsevier Ltd.

https://doi.org/10.1016/j.chembiol.2019.10.010

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

Cell Chemical Biology

Article

Antitubercular Triazines: Optimization

and Intrabacterial Metabolism

Xin Wang,¹^,⁷Daigo Inoyama, Riccardo Russo, Shao-Gang Li, Ravindra Jadhav, Thomas P. Stratton, Nisha Mittal,

1,7

2

1

2

1

2

1

Joseph A. Bilotta, Eric Singleton, Thomas Kim, Steve D. Paget, Richard S. Pottorf, Yong-Mo Ahn,

Alejandro Davila-Pagan, Srinivasan Kandasamy, Courtney Grady, Seema Hussain, Patricia Soteropoulos,

Matthew D. Zimmerman, Hsin Pin Ho, Steven Park, V e´ ronique Dartois, Sean Ekins, Nancy Connell, Pradeep Kumar,

1

2

3,4

5

6

2

1

,2,8,

and Joel S. Freundlich

1

*

Department of Pharmacology, Physiology and Neuroscience, Rutgers University – New Jersey Medical School, Newark, NJ 07103, USA

²Division of Infectious Disease, Department of Medicine and the Ruy V. Louren c¸ o Center for the Study of Emerging and Re-emerging

Pathogens, Rutgers University – New Jersey Medical School, Newark, NJ 07103, USA

³Genomics Center, Rutgers University – New Jersey Medical School, Newark, NJ 07103, USA

⁴Department of Microbiology, Biochemistry and Molecular Genetics, Rutgers University – New Jersey Medical School, Newark, NJ

0

7103, USA

⁵Public Health Research Institute, Rutgers University – New Jersey Medical School, Newark, NJ, USA

⁶Collaborations in Chemistry Inc., Raleigh, NC 27606, USA

⁷These authors contributed equally

⁸Lead Contact

*Correspondence: freundjs@rutgers.edu

https://doi.org/10.1016/j.chembiol.2019.10.010

SUMMARY

drug-resistant infections, respectively. The newest additions to

the tuberculosis drug armamentarium consist of bedaquiline

The triazine antitubercular JSF-2019 was of inter- (approved by the Food and Drug Administration [FDA] in 2012),

est due to its in vitro efﬁcacy and the nitro group pretomanid (approved by the FDA in 2019; Figure 1A), and de-

lamanid (approved by the European Medicines Agency in

2014; Figure 1B). While bedaquiline inhibits ATP biosynthesis

shared with the clinically relevant delamanid and pre-

tomanid. JSF-2019 undergoes activation requiring

(

Andries et al., 2005), delamanid, or OPC-67683, appears to

F₄₂₀H and one or more nitroreductases in addition

2

,

target M. tuberculosis through the release of nitric oxide (NO )

as well as inhibition of cell wall biosynthesis, more speciﬁcally

through modulating mycolic acid biosynthesis through an

apparent reduction in ketomycolates (Matsumoto et al., 2006).

However, concerns with delamanid have been raised over

poor bioavailability, additive QTc prolongation, and marginally

to Ddn. An intrabacterial drug metabolism (IBDM)

platform was leveraged to demonstrate the system

kinetics, evidencing formation of NO and a des-nitro

metabolite. Structure-activity relationship studies

focused on improving the solubility and mouse phar-

,

macokinetic proﬁle of JSF-2019 and culminated in shortened duration for culture conversion when co-administered

JSF-2513, relying on the key introduction of a mor- with an optimized background regimen in a pivotal phase 3 trial

pholine. Mechanistic studies with JSF-2019, JSF- (Geiter, 2017). Pretomanid, the most recently approved drug,

seems to function through a mechanism of action similar to

2

513, and other triazines stressed the signiﬁcance

that of delamanid (Manjunatha et al., 2006, 2009; Singh et al.,

2008; Stover et al., 2000), with superior bactericidal activity.

Pretomanid offers promise as a highly effective oral, short-

course regimen for multidrug and extensively drug-resistant in-

fections when co-administered with bedaquiline and linezolid

of achieving potent in vitro efﬁcacy via release of

intrabacterial NO along with inhibition of InhA and,

more generally, the FAS-II pathway. This study high-

lights the importance of probing IBDM and its poten-

tial to clarify mechanism of action, which in this case

,

(

Conradie et al., 2017; Murray, 2016). Both delamanid and preto-

,

is a combination of NO release and InhA inhibition.

manid are nitro-containing heterocycles, which do not cause

genotoxicity. In fact, the Ames mutagenicity of the parent of pre-

tomanid (CGI-17341) (Ashtekar et al., 1993) and early analogs

were attributed to metabolic oxidation of the benzyl methylene

group (Thompson et al., 2011). Both pretomanid and delamanid

INTRODUCTION

Mycobacterium tuberculosis is the causative agent of tubercu- suffer from signiﬁcant liabilities due to a relatively high frequency

losis, the world’s deadliest infectious disease. The World Health of resistance (FOR) (ꢀ10^ꢁ–10 ) and any one of these muta-

5

ꢁ6

Organization’s most recent report revealed 10 million cases and tions leads to a dramatic loss of potency (R500-fold). In clinical

1

.6 million mortalities for 2017 (WHO, 2018). The need for new studies where pretomanid is combined with other antitubercu-

drugs is underscored by criteria such as (1) lack of cross-resis- lars, pretomanid resistance remains a signiﬁcant issue (Harper

tance with existing therapies and (2) potential for shortening et al., 2012; Li et al., 2017). It is clear that pretomanid and

therapy from ca. 6 months and 2 years for drug-sensitive and delamanid are not ideal additions to the tuberculosis drug

Cell Chemical Biology 27, 1–14, January 16, 2020 ª 2019 Elsevier Ltd.

1

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

Figure 1. Highlighted Chemical Structures

and Reaction Chemistry

Chemical structures of (A) pretomanid and (B) de-

lamanid, and (C) the evolution from JSF-2019 to

JSF-2513 enabled by (D) a facile synthetic route.

Chemical structures of pretomanid and delamanid

are depicted in (A) and (B), respectively. (C) The

evolution of the triazine series from the initial

Bayesian model hit JSF-2019 to JSF-2513. (D) The

general route involved sequential amine additions

to cyanuric chloride. The hydrazine was then

added and capped with either an aldehyde to

afford the hydrazones or an acid chloride to pre-

pare the acyl hydrazides.

exhibiting a minimum bactericidal con-

centration (MBC; lowest concentration

to reduce the bacterial population by 2

log10) of 600–1,200 nM. Proﬁling of JSF-

2019 demonstrated a lack of cross-resis-

tance with front-line drugs and a smaller

loss of whole-cell efﬁcacy versus preto-

manid-resistant mutants (Ekins et al.,

2013; Inoyama et al., 2018). However,

JSF-2019 lacked in vivo efﬁcacy in

models of acute M. tuberculosis infection

model (Bruhin et al., 1969; Ekins et al.,

2013), which has been attributed to a sub-

optimal mouse PK proﬁle (area under the

curve [AUC0–5h] = 1,148 h*ng/mL based

on

measured in the plasma) (Inoyama et al.,

018). The PK proﬁle may be driven by

poor aqueous solubility (S < 0.060 mM <

a single 25-mg/kg oral dose as

2

goal of at least

et al., 2018).

1

mM) (Inoyama

Here, we disclose the optimization of

JSF-2019 to enhance triazine solubility

and mouse PK proﬁle to arrive at JSF-

2513, which features a critical morpholine

moiety. We also explored the mechanism

regimen and, therefore, efforts are ongoing to arrive at a replace- of action of these triazines, focusing primarily on JSF-2019 and

ment by addressing issues with in vitro and in vivo efﬁcacy and the optimized analog JSF-2513 (Figure 1C), and demonstrated

pharmacokinetic (PK) proﬁle (Blaser et al., 2012; Palmer et al., the signiﬁcance of the intrabacterial F420

H

2

-dependent release

of nitric oxide (NO ) and the inhibition of the essential enoyl-

Our laboratory serendipitously entered the realm of nitro- acyl carrier protein reductase InhA. These results offer insights

,

2

015; Thompson et al., 2017).

substituted heterocyclic antituberculars with the rediscovery of of value to the pursuit of next-generation nitro-containing antitu-

the whole-cell growth-inhibitory efﬁcacy of (E)-6-(2-((5-nitro- berculars to supplant pretomanid and/or delamanid.

furan-2-yl)methylene)hydrazinyl)-N2,N4-diphenyl-1,3,5-triazine-

2,4-diamine (JSF-2019; Figure 1C) (Ekins et al., 2013). Predicted RESULTS

by our naive Bayesian dual-event model, it was deemed a

promising hit through discernment of its potent in vitro activity The Nitro Moiety Is Essential for Whole-Cell Activity

judged by a minimum concentration to inhibit 90% of bacterial Analogs of JSF-2019 were prepared to assess the essentiality of

growth (MIC) of 150 nM, and acceptable Vero cell-based cyto- the nitro moiety with respect to whole-cell efﬁcacy (Table S1A).

toxicity as the concentration to inhibit the growth of Vero cells The des-nitro analog JSF-2026 was prepared via our general

by 50% (CC50) was 9.6 mM. JSF-2019 also exhibited a narrow route to analogs of JSF-2019 that in this case speciﬁcally

spectrum of activity, with its only signiﬁcant growth inhibition involved two sequential additions of aniline to cyanuric chloride

of the ESKAPE bacteria family observed with Staphylococcus and was followed by hydrazine addition and its capping with

aureus (ATCC 43300, MIC = 2.4 mM). JSF-2019 was bactericidal, 5-nitrofuraldehyde (Figure 1D). As necessary for other syntheses

2

Cell Chemical Biology 27, 1–14, January 16, 2020

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

JSF-2019 in the H37Rv background. JSF-2019 exhibited a

ꢁ8

Table 1. MIC Values for Select Compounds versus Spontaneous

ꢁ6

FOR of 1.3 3 10 at 83 MIC and 6.4 3 10 at 163 MIC. These

ꢁ6

M. tuberculosis JSF-2019-Resistant Mutant Strains

ꢁ5

FOR values are lower than those for pretomanid (10 –10

Haver et al., 2015). Seventeen colonies were isolated and

)

MIC (mM)

Gene(s) Mutated

(

Strain

JSF-2019 Pretomanid INH (Amino Acid Change)

resistance was veriﬁed by MIC determination. JSF-2019

suffered a 16- to 64-fold loss of in vitro efﬁcacy against all 17

strains (Table 1). We assayed for resistance of these 17 JSF-

Reference:

H37Rv

0.078

0.039

0.16

–

2019_8x1

1.3

10

1.25 multiple mutations

2019-resistant strains against pretomanid and the front-line

including fbiB

drug isoniazid (INH), which inhibits the essential fatty acid

biosynthetic enzyme InhA (Banerjee et al., 1994; Rozwarski

et al., 1998; Vilcheze et al., 2006). All 17 strains exhibited resis-

tance to pretomanid. Seven of 17 strains were highly resistant

to pretomanid with a >1,0003 shift in MIC (MIC >40 mM),

whereas 10 of 17 strains exhibited a 64–5123 shift in MIC. Inter-

estingly, 1 of 17 exhibited cross-resistance with INH, quantiﬁed

by an 83 MIC shift versus the parental strain H37Rv.

(

K208E) and inhA

promoter

a

(

c(-15)t)

2

019_8x2

019_8x3

019_8x4

019_8x5

019_8x6

1.3

0.63

>40

20

0.16 fgd1 (R283L)

0.16 fgd1 (E205*)

0.16 fgd1 (G168*)

#

5.0

0.16 rv1435c (A33S)

rv2623 (T84I)

It was reported that high-level resistant strains versus preto-

2

manid harbored mutations within the F420H biosynthetic

2

019_8x7

019_8x8

019_8x9

0.63

1.3

5.0

>40

5.0

>40

10

0.16 rv2983 (D188N)

0.16 fgd1 (E205*)

0.16 rv2983 (D188N)

0.16 ppnK (V171M)

0.16 fgd1 (E205*)

pathway (Haver et al., 2015), and we have previously reported

low-level cross-resistance between JSF-2019 and pretomanid

while investigating pyrimidine analogs (Inoyama et al., 2018).

We, therefore, examined and conﬁrmed that all seven mutants

with high-level pretomanid cross-resistance possessed muta-

tions in the fgd1 open reading frame encoding F420-dependent

glucose-6-phosphate dehydrogenase via Sanger sequencing.

Additionally, whole-genome sequencing identiﬁed two fbiB

mutants and three rv2983 mutants among ten strains with a

moderate level of pretomanid cross-resistance. These genes

encode two F420 biosynthetic enzymes, converting FO into F420

#

0.63

#

019_8x10 1.3

019_16x1 1.3

019_16x2 1.3

#

019_16x3 1.3

0.16 fbiB (S54P)

ppnK (V171M)

#

019_16x4 1.3

2

5.0

2.5

0.16 fbiB (S54P)

ppnK (V171M)

#

019_16x5 2.5

2

0.16 ppnK (V234L)

rv2983 (C187*)

(

Haver et al., 2015; Rifat et al., 2018). Finally, a transposon strain

fgd1::tn in the H37Rv background demonstrated a 17-fold

loss of susceptibility to JSF-2019 while only being 2-fold less

susceptible to JSF-2026 (Table 2).

accA2 (A323T)

#

019_16x6 1.3

2

5.0

0.16 rv1435c (A33S)

rv2632c (T84I)

2019_16x7 1.3

>40

0.16 fgd1 (E205*)

,

JSF-2019 Is an Intracellular NO Donor Dependent on

Mutated genes are listed with the amino acid change in parentheses. Mu-

tations in strains marked with a hash mark (#) were identiﬁed by whole-

genomic sequence while the others were identiﬁed by Sanger

sequencing.

the Cofactor F420H

2

We hypothesized that F420-dependent activation of JSF-2019

,

was associated with NO production and formation of a des-nitro

a

metabolite (previously synthesized as JSF-2026) (Figure 2A). To

Other mutations observed were rv2421c (V54A), snoP (D151E), rv1771

test this hypothesis, we treated M. tuberculosis wild-type

(

Q291R), rv1907c (V158A), and rv3058c (D184H).

strain H37Rv and F420

2

H -deﬁcient strain fgd1::tn with 20 mM

JSF-2019, using pretomanid and JSF-2026 as controls, and as-

,

of analogs of JSF-2019, the order of addition of the various sayed for intracellular NO quantiﬁcation with the Griess reagent

triazine substituents could be altered (Supplemental Informa- (Figures 2B and 2C) (Ding et al., 1988; Tan et al., 2010). Specif-

,

tion). JSF-2026 was 130-fold less active than JSF-2019, with ically, NO released intracellularly due to compound activation

signiﬁcantly diminished whole-cell activity (MIC = 20 mM). would be oxidized and then efﬂuxed from the cell into the media

ꢁ

However, JSF-2026 was still more potent than des-nitro preto- and quantiﬁed as nitrite NO

2

. During the 5-day exposure to an

manid, which was reported to lack quantiﬁable whole-cell M. tuberculosis H37Rv culture, JSF-2019 generated a smaller

,

efﬁcacy (Singh et al., 2008). Replacement of the nitro moiety yet quantiﬁable NO release compared with pretomanid at an

,

with electron-withdrawing groups (CF

3

in JSF-2389; CN in equimolar concentration (Figure 2B). This NO release was not

JSF-2390) also led to signiﬁcant losses of activity.

2

discernible in fgd1::tn cells, indicating that cofactor F420H was

,

essential for JSF-2019 extrusion of NO (Figure 2C). The nitro

,

Deﬁciency in the F420

H

2

Biosynthetic Pathway Leads to

group in JSF-2019 was required for NO release, as des-nitro

,

JSF-2019 Resistance

JSF-2026 failed to generate NO in either wild-type or fgd1::tn

ꢁ

The early structure-activity relationship (SAR) as to the impor- strains given the lower limit of quantiﬁcation of 0.80 mM NO

tance of the nitro group was reminiscent of pretomanid and

2

.

We applied a liquid chromatography-mass spectrometry (LC-

delamanid and suggested a shared mode of bioactivation (Man- MS)-based intrabacterial drug metabolism (IBDM) assay to

,

junatha et al., 2009; Singh et al., 2008). To probe this similarity, identify JSF-2019 metabolites inherent to NO generation.

we raised M. tuberculosis spontaneous mutants resistant to Generally, a liquid culture of mid-log phase M. tuberculosis

Cell Chemical Biology 27, 1–14, January 16, 2020

3

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

Table 2. MIC Values for Select Compounds versus M. tuberculosis Strains with Mutations in inhA, katG, F420

2

H Biosynthetic Genes,

or ddn

Strain

Name

H37Rv

MIC (mM)

JSF-2019

0.078

0.63

Mutated Gene(s)

\

JSF-2026

JSF-2513

0.63

2.5

JSF-4328

>250

ND

Pretomanid

0.078

0.16

INH

0.16

1.25

>10

0.16

1.25

20

40

2

mc 4914

inhA promoter c(-15)t

katG (S315T)

DRM12

0.078

1.3

0.63

10

0.039

>40

fgd1::tn

fgd1 transposon insertion

>250

JSF-Mtb-1

fbiC F567S

5.0

20

>40

inhA promoter c(-15)t

ddn::tn

ddn transposon insertion

0.63

20

1.3

ND

>80

0.16

ND, not determined.

was subjected to compound treatment followed by metabolism k % ꢁ1.4) between JSF-2019 and pretomanid in H37Rv quanti-

quenching, metabolite extraction, and LC-MS analysis of the ﬁed by BRAID analysis of the checkerboard assay (Twarog et al.,

intrabacterial metabolites as a function of time. The IBDM proto- 2016) (Figure S2A), compared with the lack of synergy or antag-

col is based on previous methods for M. tuberculosis agar-based onism (at the 95% conﬁdence interval, ꢁ0.046 % k % 0.51) be-

metabolomics developed by Rhee’s group (Chakraborty et al., tween INH and pretomanid (Figure S2B) and the weak synergy

2013) and a drug penetration assay reported by Dartois and (at the 95% conﬁdence interval, 0.12 % k % 0.37) between

colleagues (Sarathy et al., 2013). Our IBDM assay affords homo- INH and JSF-2019 (Figure S2C). This antagonism was likely

geneous compound exposure while attempting to minimize due to a competition for utilization of the F420

2

H pool for activa-

compound degradation during metabolite extraction. Here, we tion between JSF-2019 and pretomanid.

discuss its application to study the kinetics of intrabacterial

Pretomanid has been reported to require activation by the ni-

as a cofactor (Singh et al.,

metabolism of JSF-2019. M. tuberculosis H37Rv and fgd1::tn troreductase Ddn utilizing F420

H

2

strains were treated with 20 mM JSF-2019 for 24 h, followed by 2008). The susceptibility of a ddn transposon insertion strain

metabolite extraction and LC-MS interrogation. One peak with ddn::tn (Inoyama et al., 2018; Singh et al., 2008) to JSF-2019

+

m/z of 372.1 amu [M + H ] was observed in the H37Rv lysate, and pretomanid was assessed (Table 2). As expected, functional

consistent with des-nitro JSF-2026. LC-MS and high-resolution inactivation of ddn afforded a >1,000-fold loss of susceptibility

mass spectrometry (HRMS) conﬁrmed that the observed des- to pretomanid compared with the wild type. In contrast, JSF-

nitro metabolite was identical to previously prepared JSF-2026 2019 exhibited only an 8-fold loss of activity versus this trans-

(

Figure S1). This des-nitro metabolite was not detected when poson mutant compared with H37Rv, indicating that Ddn is not

the fgd1::tn was cultured with JSF-2019 given the limit of detec- the primary nitroreductase activator for JSF-2019. As expected,

tion of 1.2 pmol for JSF-2026 (Figure 2E). This indicated an JSF-2026 did not lose whole-cell efﬁcacy versus the ddn::tn

F

420

H

2

-dependent reductive metabolism of JSF-2019. Consis- strain when compared with the wild type.

tent with the previously established link between F420 and

H

2

bioreduction of the nitro moiety (Singh et al., 2008), sodium boro- The Hydrazone Linker Is Optimal

hydride treatment of JSF-2019 led to formation of JSF-2026, Given SAR and mechanistic studies pointing to the importance

as demonstrated by LC-MS. Consistent with its role as a product of maintaining the nitrofuran of JSF-2019, we turned to the

of nitro-group bioactivation, JSF-2026 suffered only a 2-fold shift optimization of other aspects of the molecule (Table S1B),

in MIC versus the fgd1 mutant strain as compared with the wild- relying on the general synthetic route in Figure 1D. Methylation

type strain (Table 2).

We sought to correlate JSF-2019 metabolism with NO

of the hydrazone N-H (cf. JSF-2113) was somewhat tolerated,

as it led to an 8-fold loss in activity compared with JSF-2019.

release by studying the system kinetics in the H37Rv and Methylation in combination with saturation of the hydrazone

,

fgd1::tn strains. These strains were treated with 20 mM JSF- to afford hydrazine JSF-2116 did not result in a further loss

2

019, after which nitrite levels were quantiﬁed in the supernatant of efﬁcacy compared with JSF-2113. Replacement of the hy-

while the metabolite proﬁle of the pellet was probed by LC-MS at drazone with an acyl hydrazide (cf. JSF-2111) only afforded

several time points. A rapid accumulation followed by a gradual a 4-fold reduction in efﬁcacy and did not signiﬁcantly change

decay of JSF-2019 was observed in H37Rv (Figure 2D). The des- Vero cell cytotoxicity. The alteration did signiﬁcantly enhance

nitro metabolite, JSF-2026, appeared after 4 h of treatment, solubility (S = 13.8 mM versus <0.060 mM for JSF-2019) while

which was concurrent with the formation of nitrite in the superna- maintaining good mouse liver microsome (MLM) stability (t1/2

tant (Figures 2E and 2F). Metabolic transformation of JSF-2019 55.0 min versus 63.6 min for JSF-2019). N-methylation of

=

,

to produce JSF-2026 and NO was not detectable in the this acyl hydrazide at N-1 (cf. JSF-2114) did not improve

F

420

H

2

-deﬁcient strain. The concurrent accumulation of nitrite whole-cell activity, although it further increased Vero cell cyto-

and the des-nitro metabolite in H37Rv were indicative of an toxicity. N-2 methylation (cf. JSF-2118) was not desirable, as it

,

F

420

H

2

-dependent metabolism resulting in NO release. This raised the MIC by a factor of 60. These limited investigations

-dependent activation was further supported by the culminated with further proﬁling of JSF-2111, and a signiﬁcant

2

observed antagonism (at the 95% conﬁdence interval, ꢁ1.7 % issue was noted with the compound’s stability in mouse and

Cell Chemical Biology 27, 1–14, January 16, 2020

4

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

$

Figure 2. JSF-2019 Produces NO and JSF-

2026 in a Process Dependent on F420H

2

(

A) Proposed scheme for JSF-2019 activation.

B and C) M. tuberculosis strains H37Rv and

fgd1::tn, respectively, were treated with 20 mM

compound followed by nitrite quantiﬁcation via the

Griess reagent. Numbers above each data point

indicate the molarity ratio of nitrite versus triazine

dose. Gray dashed line indicates nitrite lower limit

of detection (LLOD) as 0.80 mM. Data points are

shown as mean ± standard error with three inde-

pendent experiments. Statistical signiﬁcance was

analyzed by paired Student’s t test. *p < 0.05; **p <

0

.01; n.s., not statistically signiﬁcant.

(

D–F) H37Rv and fgd1::tn were treated with 20 mM

JSF-2019 followed by study of the kinetics of in-

$

trabacterial metabolism and NO release. Data

points are shown as mean ± standard error with

three independent experiments. Statistical signiﬁ-

cance was analyzed by paired multiple t tests

corrected for multiple comparison using the Holm-

Sidak method. *p < 0.05; ***p < 0.001.

(

G and H) Mid-log phase H37Rv were treated with

03 MIC of JSF-2019 and JSF-2026 followed by

1

hierarchical analysis of transcriptional response

comparison with INH, RIF (rifampicin), pretomanid,

and DETA/NO (diethylenetriamine/nitric oxide

adduct). (G) demonstrates responses in the dosR

$

regulon and (H) shows responses in 212 NO -

sensitive non-dosR genes.

strated no time above the MIC (t > MIC)

and a reduction in compound exposure

in the plasma, as quantiﬁed by AUC,

compared with JSF-2019 (1,082 versus

1

,148 h*ng/mL). Following an approach

human plasma (68.4% and 63.8% compound remaining after of exchanging both anilines in JSF-2019 with the same amine

h of incubation, respectively; Table S2) compared with and utilizing the synthetic chemistry shown in Figure 1D, we

5

JSF-2019.

explored a range of cyclic and acyclic amines (Table S1C).

While solely considering MIC and Vero cell CC50 values, we

identiﬁed promising substitutions to be cyclopropyl (cf. JSF-

2377), cyclobutyl (cf. JSF-2378), 4-F-cyclobutyl (cf. JSF-

Enhanced Aqueous Solubility May Be Introduced

through a Morpholine Substituent

Maintenance of the nitrofuryl hydrazone of JSF-2019 led us to 2592), cyclobutylmethyl (cf. JSF-2511), cyclopentyl (cf. JSF-

explore replacement of both anilines with a wide range of 2379), and cyclohexyl (cf. JSF-2380). Some variation in Vero

amines. We contemplated the di-i-Pr analog of JSF-2019, cell cytotoxicity was noted in this series. N-methylation of

shown to be in vivo active in 1969 (Bruhin et al., 1969). This each of the secondary amines in this group was not explored,

compound was prepared and renamed as JSF-2032, and ex- although it may be noted that the bis(di-cyclobutylamino)

hibited diminished whole-cell activity (MIC = 1.4 mM), although analog (cf. JSF-2594) was active (MIC = 0.81 mM). This, howev-

2

in a model of intracellular infection with mc 6206-infected er, represented a loss in activity compared with the mono-cy-

J774.1 cells (Kumar et al., 2018), its IC50 (minimum compound clobutyl JSF-2378 (MIC = 0.11 mM). Cyclic amines such as aze-

concentration to inhibit bacterial growth by 50%) versus tidine (cf. JSF-2589) and thiomorpholine (cf. JSF-2343) were

2

mc 6206-infected J774.1 cells was slightly better than that of slightly less active than JSF-2019. A noteworthy compound in

JSF-2019 (0.13 versus 0.27 mM) with INH (IC50 = 0.44 mM) this series was bis(morpholine) JSF-2189. Although it was

and rifampicin (RIF) (IC50 = 0.13 mM) as positive controls. less active than JSF-2019 with an MIC = 7.8 mM, it displayed

JSF-2032 exhibited decreased MLM stability (t1/2 = 31.8 min) promising solubility (S = 20.2 mM) and MLM stability (t1/2

compared with JSF-2019, but it was judged signiﬁcant that 68.0 min).

=

its solubility (S = 27.5 mM) was much improved versus JSF-

2

019. Interestingly, the mouse 5-h PK study (two mice, one Mono(amine) Mono(morpholine) Analogs Show

5 mg/kg oral dose with 5% dimethylacetamide [DMA]/60% Promising Initial Proﬁles

polyethylene glycol 300/35% D5W [5% dextrose in water] as To enhance the potency of JSF-2189, we leveraged the

the formulation, unless noted otherwise) for JSF-2032 demon- learnings with the other di(alkylamino) triazines discussed

Cell Chemical Biology 27, 1–14, January 16, 2020

5

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

JSF-3456 with furan (cf. JSF-3511), thiophene (cf. JSF-

3

Table 3. Mouse PK Comparison among Select Triazines

510), thiazole (cf. JSF-3543), pyridine (cf. JSF-3524), pyrimi-

dine (cf. JSF-3542), and pyrazine (cf. JSF-3541) also did not

improve upon the MIC of JSF-2513.

JSF-2019 JSF-2513 JSF-2619 JSF-2625

a

AUC0–5h (h*ng/mL) 1148

a

12,025

1707

120

7639

4200

19

538

266

5.5

C

max (ng/mL)

a

317

AUC0–5h/MIC

a

14

Further Proﬁling of Select Analogs Leads to JSF-2513 as

an In Vivo Efﬁcacy Candidate

C

max/MIC

a

t > MIC (h)

5.1

5.0

18

11

2.7

8–24

BLQ

R99

0.43

2232

3–5

1–3

0.30

11.4

0.19

5283

A comparison of MIC, Vero cell CC50, S, and MLM t1/2 values

led to the selection of JSF-2513, JSF-2619, and JSF-2625 for

further proﬁling. Each compound was assessed for 24-h PK

proﬁle (Table 3) in three mice dosed with 25 mg/kg orally with

a 0.5% carboxymethylcellulose (CMC)/0.5% Tween 80 formu-

lation and in three mice dosed 5 mg/kg intravenously with a

C

lung/Cplasma at 5 h 2.6

0.23

49.2

0.36

3700

%

F

ND

b

t

1/2 (h)

Clearance

b

(

mL/(kg*h))

b

(L/kg)

5% DMA/95% (4% cremophor in 0.9% saline) formulation. A

V

d

ND

1.38

1.91

1.44

comparison of the three compounds (Tables S1 and S3; Fig-

ures S3A–S3C) favored JSF-2513 over JSF-2625 and JSF-

BLQ, below level of quantiﬁcation; ND, not determined.

a

Following administration of a single 25-mg/kg oral dose.

2619 due to its AUC, t > MIC, and oral bioavailability (%F) met-

b

Following administration of a single 5-mg/kg intravenous dose.

rics. The corresponding values for JSF-2625 were surprisingly

low and warranted further investigation. JSF-2625 in mouse

3

above and the synthetic route in Figure 1D, and explored the plasma, aqueous dimethyl sulfoxide, or aqueous CH CN was

replacement of one of the two morpholines with a primary or found to degrade through a presumptive C-N bond cleavage

secondary amine (Table S1D). Acyclic and cyclic alkyl amines reaction to afford aminotriazine JSF-3226 (Figure S4). JSF-

were examined in this subseries. Among the acyclic amines, i- 3226 was synthesized independently, via adaptation of the

1

propyl amine JSF-2621 exhibited the most preferable combi- route in Figure 1D, and demonstrated via H nuclear magnetic

nation of properties, most prominently with an MIC

.13 mM, Vero cell CC50 = 130 mM, S = 25.4 mM, and MLM degradant isolated from aqueous acetonitrile. JSF-3226 was

1/2 = 54.2 min. Homologation of the alkyl moiety (cf. JSF- found to be signiﬁcantly less active than M. tuberculosis

595), methylation of the amine nitrogen (cf. JSF-2683), and (MIC = 3.9 mM). This decomposition process was light depen-

replacement of the methine hydrogen with a methyl group dent and was most apparent in triazines containing an alkyl-

cf. JSF-3382) all led to a loss of whole-cell activity (4- to amine substituent. JSF-2513 and JSF-2619 were not found to

5-fold). Cyclization of the one amine substituent was then be as vulnerable to this cleavage reaction and demonstrated

investigated with pendant 3- to 5-membered rings. Cyclopro- satisfactory stabilities in mouse plasma (Table S2).

pylamine JSF-2624 and a-methylcyclopropylamine JSF-2625 With the data package weighing in favor of JSF-2513,

exhibited the most promising proﬁles. It was interesting to further in vitro activity proﬁling was conducted. The antituber-

observe that while both compounds were similar in potency cular activity of JSF-2513 was dependent on F420 cofactor,

MIC = 0.26 and 0.25 mM, respectively) their solubility (S = judged by a 16-fold potency loss versus the fgd1::tn strain, but

=

resonance and LC-MS characterization to be identical to the

0

t

2

(

1

H

2

(

1

17 and 8.71 mM, respectively) and MLM stability (t1/2 = 22.0 not signiﬁcantly on a functional Ddn, as its MIC only increased

and 56.4 min, respectively) values differed substantially based 2-fold against the ddn::tn strain (Table 2). JSF-2513 generated

,

on the a-methyl substitution. N-methylation (cf. JSF-2684) or NO in the M. tuberculosis H37Rv strain in a lesser amount

,

homologation (cf. JSF-2686 or JSF-2786) of JSF-2624 led to than JSF-2019 at equimolar concentrations, and this NO

slight losses in activity and signiﬁcant increases in Vero cell release was abolished in fgd1::tn cells (Figures 3A–3C). The

cytotoxicity. The corresponding cyclobutyl series (cf. JSF-

682, -2620, -2685, -2707, -2706, -2705) and cyclopentyl (cf. duced the des-nitro metabolite JSF-4328 (Figures 3A and

JSF-3249, -3366) subseries did not offer considerable advan- S5), in analogy to JSF-2026 derivation from JSF-2019.

tages over the cyclopropyl analogs. Secondary amines were JSF-2513 exhibited MIC values in excess of 120 mM versus

420 2

F H -dependent nitro-group activation of JSF-2513 pro-

2

also examined with azetidine JSF-2619 proving superior to strains of Klebsiella pneumoniae, Acinetobacter baumannii,

pyrrolidine JSF-2886. Aromatic amines were examined, begin- Pseudomonas aeruginosa, and Enterobacter cloacae, while

ning with aniline JSF-2513, which demonstrated a promising showing modest in vitro activity against Enterococcus faecium

MIC of 0.63 mM and S = 0.853 mM, and modest Vero cell (MIC = 15 mM) and S. aureus (MIC = 29 mM). The MBC of JSF-

CC50 of 3.9 mM. Introduction of a methyl, ﬂuoro, cyano, or me- 2513 was determined to be 1.6 mM. JSF-2513 exhibited an

2

thoxy group at the 2-, 3-, or 4-positions (cf. JSF-2804, -2805, IC50 value of 1.3 mM versus mc 6206-infected J774.1 cells.

-

2807, -2835–7, -2884, -2888, -2923, -2892, -2890, -2894, In the Hu-Coates model of non-replicating persistence that

2895) failed to enhance the MIC but did improve the Vero probes compound cidal activity versus 100-day-old cultures of

cell CC50. Homologation to the corresponding benzylamine M. tuberculosis (Hu et al., 2003), at a 100-mM concentration

with or without mono- or dimethylation of the benzylic carbon) JSF-2513 and JSF-2019 afforded ca. 7 and 4 log10 reductions

afforded compounds (cf. JSF-3546, -3401–3403) with an MIC in colony-forming units (CFUs), respectively, as compared with

1 mM. Methyl- or chloro-substituted benzyl analogs (cf. JSF- 6 log10 for pretomanid (Figure S3E).

457, -3458, -3585, -3474, -3586, -3473) were similarly unre- Proﬁling of the mouse and human plasma protein binding of

markable. Replacement of the benzene ring in benzyl analog JSF-2513 (Table S2) was conducted. JSF-2513 exhibited high,

(

>

3

6

Cell Chemical Biology 27, 1–14, January 16, 2020

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

$

Figure 3. JSF-2513 Intrabacterial Metabolism Releases NO with JSF-4328 Formation and FAS-II Inhibition

(

A) Proposed scheme for JSF-2513 activation.

B and C) M. tuberculosis strains H37Rv and fgd1::tn were treated with 20 mM compound followed by nitrite quantiﬁcation by Griess reagent. Numbers above each

data point indicate the molarity ratio of nitrite versus triazine dose. Gray dashed line indicates nitrite lower limit of detection (LLOD) as 0.80 mM. Data points are

shown as mean ± standard error with three independent experiments. Statistical signiﬁcance was analyzed by paired Student’s t test. *p < 0.05; **p < 0.01; n.s.,

not statistically signiﬁcant.

,

(D and E) H37Rv and fgd1::tn were treated with 20 mM JSF-2513 and the time courses for intrabacterial metabolism (JSF-4328 formation) and NO release were

followed. Data points were shown as mean ± standard error with three independent experiments. Statistical signiﬁcance was analyzed by paired multiple t tests

corrected for multiple comparison using the Holm-Sidak method. *p < 0.05; ***p < 0.001.

2

14

F and G) M. tuberculosis strains H37Rv, mc 4914, and fgd1:tn were treated with 103 MIC of JSF-2513 or INH, as a control, for 8 h and assessed for [ C]acetate

(

labeling after 16 h. FAMEs and MAMEs were extracted and analyzed via TLC. Dose of JSF-2513 in H37Rv: 13 (0.63 mM), 53, 103, and 403 MIC. Dose of

2

JSF-2513 in mc 4914: 13 (2.5 mM), 53, 103, and 403. Dose of JSF-2513 in fgd1::tn: 13 (10 mM), 53, and 103. INH was at 103 MIC.

(H and I) Grayscale densitometric analysis of MAMEs and FAMEs from (F) and (G), respectively, using ImageJ.

but still acceptable, binding to plasma proteins from mouse 300 mg/kg. Dosing of JSF-2513 at 300 mg/kg resulted in leth-

99.0%) and human (98.0%). Finally, JSF-2513 exhibited argy in the mice. The level of JSF-2513 in the mouse lungs was

(

acceptable human liver microsome stability (t1/2 = 61.7 min; near the limit of quantiﬁcation (25 ng/mL) 5 h after a single 25-

Clint = 11.2 mL/min/mg protein) and did not signiﬁcantly inhibit mg/kg dose. Similar experiments with 60- and 200-mg/kg

human cytochrome P450 isoforms (Table S3). Complete mouse dosing enabled more accurate determination of this parameter.

PK proﬁling for JSF-2513 required testing dose proportionality JSF-2513 achieved lung/plasma concentration ratios of 0.55

and tolerability in mice (Figure S3D) at single doses of 50 to and 0.67 at 60- and 200-mg/kg dosing, respectively. These

Cell Chemical Biology 27, 1–14, January 16, 2020

7

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

Figure 4. JSF-2019 Is an InhA Inhibitor

(

A) Mid-log phase M. tuberculosis cultures were

treated with 103 MIC of JSF-2019 or JSF-2026 for

h, followed by mRNA extraction and RNA-seq

6

analysis. Hierarchical clustering analysis with

Euclidean distance was applied to the gene-

expression proﬁles to compare transcriptional re-

sponses in FAS-II genes induced by JSF-2019 or

JSF-2026 to responses generated by other stress

conditions. RIF, rifampicin; INH, isoniazid; ETA,

ethionamide; DNP, 2,4-dinitrophenol; EMB,

ethambutol; GSNO, S-nitrosoglutathione; TRC,

triclosan.

(

B) The InhA in vitro enzyme assay scheme is de-

picted. JSF-2019 IC50 for InhA inhibition was

quantiﬁed with and without 1% CMC Tween 20.

Each data point is shown as mean ± standard er-

ror, and IC50 was determined via non-linear

regression model.

(

C) FAS TLC for M. tuberculosis H37Rv treated with

JSF-2019 at 13, 53, 103, and 403 MIC for 4 h,

with INH at 103 MIC and pretomanid at 103 MIC

as controls.

(

D) Grayscale densitometric analysis of MAMEs

and FAMEs from (C) using ImageJ.

M. tuberculosis treated with an intracel-

,

lular NO donor, such as pretomanid or

JSF-2019, or antitubercular agents such

as INH, RIF and des-nitro JSF-2026,

values were in our acceptable range of 0.5–1.0 and comparable with differing mechanisms of action (Figure 2G). Voskuil et al.

with other proﬁled analogs, but were less than those deter- (2011) reported 212 non-dosR genes that were sensitive to

mined for JSF-2019 and JSF-2032 (Table S4). To sum up, the reactive nitrogen species. Nitric oxide stress, regardless of

,

total of PK studies supported 60 and 200 mg/kg as the dosing the intracellular or extracellular donors of NO , speciﬁcally

levels for an acute infection model (Rao et al., 2013). JSF-2513 and signiﬁcantly differentiated expression of these 212 genes

and INH, as a positive control at 25 mg/kg, were compared in comparison with treatments with INH, RIF, or des-nitro

with vehicle alone in dosed Balb/c mice at their selected levels JSF-2026 (Figure 2H).

beginning 2 weeks post infection (t = 0), and the bacterial

Given that pretomanid has also been reported to affect my-

burden was quantiﬁed via the lung CFUs at selected time colic acid biosynthesis by depleting keto mycolates (Stover

points. After 4 weeks of dosing, JSF-2513 failed to demon- et al., 2000), we probed the effect of JSF-2019 on M. tubercu-

strate a reduction in M. tuberculosis CFUs in mouse lungs losis fatty acid biosynthesis (FAS) gene transcript levels. JSF-

and spleen as compared with the vehicle alone.

2019 treatment of M. tuberculosis resulted in a FAS expression

proﬁle similar to that of pretomanid according to hierarchical

clustering analysis, primarily due to the downregulation of

several FAS-II genes (hadABC, inhA, and fabH) (Figure 4A). In

,

The Transcriptional Proﬁle of JSF-2019 Supports NO

Release and FAS-II Inhibition

While plotting a strategy to further optimize the triazine series contrast to JSF-2019, des-nitro JSF-2026 did not signiﬁcantly

for in vivo efﬁcacy, we had the opportunity to further probe alter FAS-II gene expression with respect to the criteria fold

the mechanism of action of JSF-2019 as to better inform future change >2 and false discovery rate p value <0.05. Therefore, it

optimizations. The transcriptional response of M. tuberculosis was suggested that mycolic acid biosynthesis may be respon-

,

H37Rv cultures treated with 103 MIC of JSF-2019 or des-nitro sive to NO stress. Downregulation of several FAS-II genes in

,

compound JSF-2026 were quantiﬁed by RNA sequencing the presence of NO was not observed in the expression proﬁle

(

RNA-seq) and analyzed via hierarchical clustering (Data S1) of M. tuberculosis treated with FAS-II enzyme inhibitors such as

,

Boshoff et al., 2004). The expression proﬁles of NO -respon- INH and ethionamide (ETH). Intriguingly, some FAS-II genes,

sive genes, including the dosR regulon and non-dosR genes, such as kasA, kasB, acpM, and accD6, were induced by JSF-

were examined and compared with previously published micro- 2019 treatment, which was reminiscent of a typical FAS-II inhibi-

array data for diethylenetriamine/nitric oxide adduct (DETA/NO) tion proﬁle as mediated by INH or ETH (Wilson et al., 1999). Since

and pretomanid (Voskuil et al., 2011). DETA/NO, an extracel- this response has not been observed with pretomanid treatment

,

lular NO donor, strongly induced the dosR regulon as previ- (Manjunatha et al., 2009; Stover et al., 2000), we hypothesized

ously reported. This dosR regulon upregulation was speciﬁc that JSF-2019 may kill M. tuberculosis through FAS-II inhibition

,

for extracellular nitric oxide stress, in contrast to proﬁles for as well as NO release.

8

Cell Chemical Biology 27, 1–14, January 16, 2020

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

JSF-2019 Inhibits InhA

tion of puriﬁed InhA (its inhibition was abrogated in the 1%

Given our lab’s experience with InhA (Freundlich et al., 2009; CMC Tween 20) (Figure S7A) or perturb mycolic acid biosyn-

Stec et al., 2014; Vilcheze et al., 2011), we began by probing thesis in H37Rv as seen by TLC (Figures S6C and S6D), could

the interaction of JSF-2019 with InhA. JSF-2019 inhibited also play a role in FAS-II inhibition.

(

IC50 = 20 ± 2.4 mM) the functional activity of puriﬁed InhA, as

We further conﬁrmed JSF-2019 as an InhA inhibitor by as-

2

quantiﬁed by the reduction of the model substrate 2-dodece- sessing its efﬁcacy versus an M. tuberculosis strain mc 4914

noyl-coenzyme A in the presence of NADH (Figure 4B). We overexpressing inhA (Table 2). InhA overexpression in

2

further assayed for InhA inhibition by JSF-2019 in the presence mc 4914 led to an 8-fold loss of activity for JSF-2019 or the

of added detergent. JSF-2019 demonstrated an IC50 = 24 ± positive control INH compared with the wild-type H37Rv

3

.6 mM in the presence of 1% CMC Tween 20 (Figure 4B). strain. Further supporting the negligible role of metabolite

This minimal IC50 shift supported JSF-2019 as a modest InhA JSF-2026 as an InhA inhibitor was its lack of an MIC shift be-

inhibitor in vitro and ruled out promiscuous enzyme inhibition tween these strains. JSF-2019 showed reduced efﬁcacy

through the formation of aggregates (Feng and Shoichet, versus an fgd1::tn strain, as judged by a 17-fold MIC shift

2

006; Feng et al., 2007; Shoichet, 2006). This modest enzyme compared with the H37Rv strain. JSF-2019 exhibited a larger

inhibition was slightly depressed (43%–26%) when the hydra- MIC change (643) in strain JSF-Mtb-1, which featured both

zone linker in JSF-2019 was modiﬁed via methylation, substitu- an F420 deﬁciency (F567S mutation in FbiC) in addition to

H

2

tion to the corresponding hydrazide with or without N-methyl- inhA overexpression (inhA promoter c(-15)t) as seen with

2

ation, or reduction to the hydrazine with or without N- mc 4914. This susceptibility proﬁling supported a dual mech-

,

methylation (Table S1B). It should be noted that signiﬁcant ef- anism of action of JSF-2019 that is pertinent to NO release

forts to obtain an X-ray crystal structure of InhA with bound and InhA inhibition.

JSF-2019 were unsuccessful (unpublished data). The shared

inhibition of InhA and the commonality of the hydrazine Evidence Suggests that a JSF-2513 Metabolite Inhibits

(

-NHNH-) fragment between JSF-2019 and INH hinted at a InhA, and More Generally FAS-II, in M. tuberculosis

role for the catalase-peroxidase KatG (Rozwarski et al., 1998; JSF-2513 displayed a 4-fold MIC shift against the inhA overex-

2

Zhang et al., 1992) in the intrabacterial activation of JSF- pression strain mc 4914 compared with the H37Rv strain

2

019. However, KatG does not appear to have a signiﬁcant (Table 2), supportive of its InhA inhibition within the bacterium.

effect on the activity of JSF-2019 (or JSF-2026 or JSF-2513) Mycolic acid biosynthesis inhibition within the bacterium was

within M. tuberculosis given the lack of an MIC shift as further indicated by a TLC FAS-II inhibition pattern, judged by

compared with the wild-type H37Rv strain, versus a laboratory depletion of MAMEs and accumulation of precursor FAMEs in

strain (DRM12) (Kumar et al., 2018) with the KatG S315T muta- a JSF-2513 dose-dependent manner (Figures 3F and 3H).

2

tion that affords a >62-fold loss of efﬁcacy for INH (Table 2). Overexpression of inhA in the mc 4914 strain mitigated FAS-

Additionally, JSF-2019 maintained its wild-type strain activity II inhibition by JSF-2513 compared with the H37Rv strain. How-

versus three strains (TDR31, TDR36, and TDR116) in our collec- ever, JSF-2513 failed to demonstrate even modest inhibition of

tion of drug-resistant clinical isolates from the Special Program puriﬁed InhA in the enzyme assay with an IC50 >150 mM (Fig-

for Research and Training in Tropical Diseases established by ure S7B). Following a suspicion that the intrabacterial FAS-II in-

UNICEF/UNDP/World Bank/WHO Special Programs with the hibition may derive from the action of a metabolite of JSF-2513,

KatG S315T mutation (Kumar et al., 2018).

we tested the JSF-2513 inhibition of mycolate biosynthesis in

We questioned whether this modulation of the catalytic activ- the fgd1::tn strain, in which JSF-2513 intrabacterial metabolism

ity of InhA occurred within the bacterium. M. tuberculosis was reduced as compared with the H37Rv strain (Figures 3C

H37Rv was treated with increasing doses of JSF-2019 followed and 3D). JSF-2513 FAS-II inhibition, as judged by FAMEs and

1

4

by labeling of the cultures with [ C]acetate. As an InhA inhibi- MAMEs (Figures 3G and 3I), was decreased in the fgd1::tn

tor, INH at 103 MIC afforded the expected FAS-II inhibition strain as compared with the H37Rv strain, suggesting a corre-

proﬁle as judged by thin-layer chromatography (TLC) (Figures lation between F420

2

H -associated intrabacterial metabolism of

4C and 4D): reduction of mycolic acids (visualized as mycolic JSF-2513 and its InhA and, more generally, FAS-II inhibition.

acid methyl esters [MAMEs] as per the protocol) accompanied The inhibition does not appear to involve the des-nitro metab-

by an accumulation of upstream short-chain fatty acids (visual- olite JSF-4328, as the independently synthesized compound

ized as short-chain fatty acid methyl esters [FAMEs]) (Slayden did not exhibit signiﬁcant inhibition of puriﬁed InhA (29% ±

and Barry, 2001; Wilson et al., 2013). In contrast, pretomanid 0.79% inhibition at 50 mM compound in the presence of 1%

treatment at 103 MIC led to a decrease of MAMEs, purportedly CMC Tween 20), and its MIC was quantiﬁed as >250 mM versus

,

2

resulting from the downstream effect/s of NO release. JSF- the H37Rv, mc 4914, fgd1::tn, and JSF-Mtb-1 strains (Table 2).

019 treatment, ranging from 13 to 403 MIC, resulted in the

2

,

accumulation of FAMEs and decrease of MAMEs, consistent NO Release Drives Antitubercular Activity among a

with FAS-II inhibition. This JSF-2019-mediated mycolic acid in- Subset of Triazines

hibition was diminished in an inhA overexpression strain To further understand the relative contributions of InhA inhibition

2

,

(

mc 4914) (Vilcheze et al., 2006) (Figure S6), further supporting and NO release to whole-cell activity, we examined the activity

JSF-2019 as an InhA inhibitor within the bacterium. It was proﬁles of eight triazines, including JSF-2019 and JSF-2513, and

intriguing to note that mycolic acid inhibition was also mitigated also pretomanid (Table S5). The selected triazines exhibited

in the fgd1::tn strain, suggesting that a metabolite of JSF-2019, either potent (MIC < 1 mM) or moderate (1 < MIC < 10 mM) anti-

,

other than JSF-2026 which does not exhibit signiﬁcant inhibi- tubercular activities versus H37Rv. The amount of NO release

Cell Chemical Biology 27, 1–14, January 16, 2020

9

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

in H37Rv was measured over 4 days and quantiﬁed by an AUC0– ever, the signiﬁcantly smaller losses of whole-cell efﬁcacy of JSF-

4d

for all eight triazines. These analogs lose 4- to 64-fold in vitro 2019, as compared with pretomanid, versus M. tuberculosis

activity against the fgd1::tn strain as compared with H37Rv. The strains harboring mutations in fgd1, fbiB, or fbiC suggest differ-

potency of InhA inhibition was assessed via the percent inhibi- ences in their respective activations. Additionally, the large differ-

tion of puriﬁed InhA by a 50 mM concentration of each compound ential in their MIC shifts against the transposon mutagenized

in the presence of 1% CMC Tween 20 to obviate any aggregation ddn strain evidenced that while pretomanid primarily relies on

effects, with pretomanid serving as a negative control. A graph- reduction by the nitroreductase Ddn, JSF-2019 may require

,

ical analysis, though limited by a small sample size, demon- one or more other nitroreductases to release NO . Other nitrore-

,

strated a curvilinear relationship between MIC and NO AUC0– ductases with signiﬁcant sequence homology to Ddn include

4d

(Figure S7C), indicating that increasing bacterial growth inhibi- Rv1261c (Gurumurthy et al., 2013), Rv1558, and Rv3178 (Singh

,

tion correlated with increasing NO production. The data also et al., 2008). They have been suggested as activating enzymes

suggested a lack of a signiﬁcant relationship between MIC and for analogs of pretomanid and its parent CGI-17341 (Gurumurthy

percent InhA inhibition (Figure S7D). This latter observation et al., 2012). While the assay of Rv1261c and Rv1558 with regard

stands in contrast to the MIC shift of 2- to 8-fold for these ana- to the activation of nitroheterocycles has not been reported, they

2

logs when inhA was overexpressed (MIC values with mc 4914 and Ddn have been demonstrated to share quinone reductase

versus H37Rv).

activity (Gurumurthy et al., 2013). Although signiﬁcantly different

in sequence from the above nitroreductases, Rv2466c has

been reported by two groups (Albesa-Jove et al., 2014; Negri

et al., 2018; Rosado et al., 2017) to be a mycothiol-dependent ni-

DISCUSSION

The clinical need for a next generation of antitubercular agents is troreductase. Finally, Rv2032, Rv3131, and Rv3127 have been

driving chemical biology and medicinal chemistry efforts hypothesized as nitroreductases due to their sequence similarity

to explore novel chemotypes and mechanisms of action. We to annotated nitroreductases from other bacteria. rv2032 appears

have herein detailed efforts with a triazine series, rediscovered to be co-regulated with acr under multiple stress conditions

through our efforts with machine learning models (Ekins et al., including intracellular infection (Purkayastha et al., 2002) and is

2

013). The series exhibited the potential to move beyond essential for survival in macrophages and infected mice (Hu

issues with other nitro-containing compounds of clinical rele- and Coates, 2011). However, Hu and Coates (2011) provided

vance (pretomanid and delamanid). In particular, JSF-2019 dis- data that question the ability of Rv2032 to function as a nitrore-

played a lower frequency of resistance and a signiﬁcantly ductase and activate nitro-containing compounds such as nitro-

reduced loss of in vitro efﬁcacy versus these drug-resistant furan and nitrofurantoin. Clearly, much more is to be learned

strains compared with pretomanid. The optimization focused about these proteins with regard to their native function and

on parameters known to be relevant to compound PK proﬁle in involvement in the bioactivation of nitro-containing antitubercular

mice, which in turn inﬂuences in vivo efﬁcacy. Managing a agents. The potential exists to leverage our developing under-

multi-criteria optimization (MIC, CC50, S, MLM t1/2, mouse PK standing of multiple nitro-group reducing systems to rationally

AUC, and t > MIC) and also navigating a chemical stability issue develop antituberculars of clinical signiﬁcance that avoid the

with alkylaminotriazines led us to JSF-2513. Along the way the drug-resistance liabilities (both frequency of resistance and

importance of the morpholine substituent in modulating com- extent of loss of efﬁcacy) of pretomanid and delamanid.

pound solubility, and hence PK, was recognized, reafﬁrming

The metabolic lability of JSF-2019 and JSF-2513, due at least

the utility of this family of heterocycles (Allison et al., 2006; Brick- in part to nitro-group activation, highlights the importance of

ner et al., 1996; Frohlich and Tsogoeva, 2016; Scott et al., 2012; probing the intrabacterial metabolism of antituberculars. Small-

Summa et al., 2006). Despite this effort, JSF-2513 did not molecule inhibitors should not be considered to always be inert

demonstrate signiﬁcant efﬁcacy in the mouse model of acute within the bacterium; they may suffer intrabacterial metabolism,

infection.

including but not limited to hydrolysis, N-alkylation, amidation,

Aiding the continued optimization of these triazines will be the and, most relevant to this work, nitro-group activation (Awasthi

knowledge gained regarding their mechanism of action. These and Freundlich, 2017). With our IBDM assay, we were able to

compounds are noted to contain a nitrofuran, leading to the sup- reveal conversion of JSF-2019 and JSF-2513 to their respective

position that their activity resides primarily in their ability to des-nitro metabolites and study the metabolism kinetics. JSF-

,

release NO similar to pretomanid and delamanid. This hypothe- 2019 accumulation was greater in nitro-group metabolism-deﬁ-

sis has been proved correct, as JSF-2019 and JSF-2513 both cient strains (e.g., fgd1::tn) than in the H37Rv strain. Correspond-

,

release NO in a time-dependent fashion and the quantity of ingly, an increase in JSF-2019 level was accompanied by de-

,

NO release correlated signiﬁcantly with antitubercular MIC. creases in the des-nitro metabolite (JSF-2026) and in NO

,

NO release has been demonstrated to be cidal to M. tuberculosis release as measured by the Griess assay. At the same time, it

whether occurring within the bacterium, via the bioactivation of is important to acknowledge that we cannot discount the IBDM

pretomanid (Singh et al., 2008) or delamanid (Hoffmann et al., of JSF-2019 to provide other yet to be identiﬁed metabolites

2

016; Matsumoto et al., 2006), or within the context of an intracel- with a crucial role in mechanism of action. The decrease in the

lular infection (MacMicking et al., 1997). It is interesting to note FAS-II inhibitory activity of JSF-2019 in the fgd1::tn strain, as

,

that the respective NO release efﬁciencies of JSF-2019 and seen via TLC, suggests the potential role of other metabolites

,

JSF-2513 were less than that of pretomanid. Through resistant (including NO ) to inhibit InhA and/or other steps in fatty acid

mutant studies, the activation of JSF-2019 appeared to share biosynthesis. This is consistent with our study of a subset of

with pretomanid and delamanid the requirement for F420H

2

. How- JSF-2019 analogs, including JSF-2513, where the in vitro growth

10

Cell Chemical Biology 27, 1–14, January 16, 2020

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

,

inhibition increased with the amount of NO release. However,

the in vitro growth inhibition did not necessarily increase with

the extent of inhibition of puriﬁed InhA, measured in the absence

of the cell. This is despite an observed MIC increase when

comparing each JSF-2019 analog’s efﬁcacy against the

B Mouse Pharmacokinetics (PK) Studies

B Mouse Acute Infection Model and Antibacterial

Treatment

B Determination of InhA Percent Inhibition and IC50

B Thin-Layer Chromatography (TLC) Analysis of Fatty

Acids and Mycolic Acids

2

mc 4914 strain as compared with the H37Rv strain. An explana-

tion may be found in the potential for one or more metabolites of

each of these analogs to inhibit InhA within the bacterium. We

also cannot discount the inhibition of other FAS-II enzymes that

would contribute to the observed TLC proﬁle (MAMEs reduction

and FAMEs increase) for treated H37Rv. We assert that the IBDM

platform is positioned to make signiﬁcant contributions to these

future mechanistic studies. Overall, the inhibition of InhA

by these triazines (and/or their metabolites) differentiates them

from pretomanid and delamanid and offers a promising therapeu-

B Reduction of JSF-2019 to JSF-2026

B Synthetic Chemistry Methods

B Synthesis of Differentially Substituted Furans

B Syntheses of Differentially Linked Triazines

B Synthesis of Dialkylaminotriazines

B Synthesis of mono(amine)mono(morpholine)triazines

d QUANTIFICATION AND STATISTICAL ANALYSIS

d DATA AND CODE AVAILABILITY

,

tic strategy when considered in concert with NO release.

SUPPLEMENTAL INFORMATION

Supplemental Information can be found online at https://doi.org/10.1016/j.

chembiol.2019.10.010 .

SIGNIFICANCE

The nitro-containing antitubercular clinical compounds, de-

lamanid and pretomanid, do not appear to be ideal additions

to tuberculosis chemotherapy. In an effort to affect next-

generation compounds, we have presented studies on the

triazine JSF-2019 and its analogs. Optimization efforts

detailed herein emphasize the utility of a morpholine moiety,

present in evolved compounds such as JSF-2513, to improve

compound solubility and mouse plasma PK. Mechanistic

studies have relied on an intrabacterial drug metabolism

platform that has detailed the activation of select triazines

ACKNOWLEDGMENTS

J.S.F., N.C., and V.D. acknowledge support from award number U19AI109713

NIH/NIAID for the ‘‘Center to develop therapeutic countermeasures to high-

threat bacterial agents,’’ from the National Institutes of Health: Centers of

Excellence for Translational Research (CETR). J.S.F. and S.E. acknowledge

support from award number R41AI122434 ‘‘Optimization of small molecule

triazine antituberculars for in vivo efﬁcacy’’ from NIH/NIAID. Dr. John J. Piwin-

ski is thanked for helpful discussions. We gratefully acknowledge access to the

HPC facilities and support of the computational STEM and bioinformatics sci-

entists from the Ofﬁce of Advanced Research Computing (OARC) at Rutgers

University. We further acknowledge the critical work made possible through

access to the Perceval Linux cluster operated by OARC under NIH

1S10OD012346-01A1 and the Illumina NextSeq500 operated by the Geno-

mics Center under NIH 1S10OD018206-01A1. Dr. John Eng, Mr. Saw Kyin,

and Mr. Henry Shwe (Princeton University) are thanked for guidance with the

HRMS studies. Biovia is kindly acknowledged for providing Discovery Studio.

,

and its link to NO production. JSF-2019 is distinct from de-

lamanid and pretomanid in that its efﬁcacy is dependent on

,

both NO release and InhA inhibition. The intrabacterial

metabolism of JSF-2019 and its analogs may also lead to

InhA and, more generally, FAS-II inhibition. The ﬁndings

highlight a mechanism of action for nitro-containing antitu-

berculars that should prove helpful in the effort to supplant

delamanid and/or pretomanid.

AUTHOR CONTRIBUTIONS

X.W., D.I., R.R., S.-G.L., R.J., T.P.S., N.M., J.A.B., E.S., T.K., S.D.P., R.S.P.,

Y.-M.A., A.D.-P., S.K., C.G., S.H., M.D.Z., H.P.H., and S.P. performed the ex-

periments. X.W., D.I., R.R., P.S., M.D.Z., V.D., S.E., N.C., P.K., and J.S.F.

contributed to experimental design and data analysis. J.S.F., X.W., and D.I.

wrote the manuscript, which was edited by all authors.

STAR+METHODS

Detailed methods are provided in the online version of this paper

and include the following:

DECLARATION OF INTERESTS

d KEY RESOURCES TABLE

The authors declare no competing interests.

d LEAD CONTACT AND MATERIALS AVAILABILITY

d EXPERIMENTAL MODEL AND SUBJECT DETAILS

B Mice

Received: March 4, 2019

Revised: September 2, 2019

Accepted: October 22, 2019

Published: November 8, 2019

B Bacterial Strains and Culture Conditions

d METHOD DETAILS

B Minimum Inhibitory Concentration (MIC) Assay

B Minimum Bactericidal Concentration (MBC) Assay

B JSF-2019 Spontaneous Mutagenesis

B RNA-Seq Analysis Method

REFERENCES

Albesa-Jove, D., Chiarelli, L.R., Makarov, V., Pasca, M.R., Urresti, S., Mori, G.,

Salina, E., Vocat, A., Comino, N., Mohorko, E., et al. (2014). Rv2466c mediates

the activation of TP053 to kill replicating and non-replicating Mycobacterium

tuberculosis . ACS Chem. Biol. 9 , 1567–1575.

,

B Griess Assay for NO Quantiﬁcation

B Intrabacterial Drug Metabolism (IBDM) Assay

B Physiochemical and ADME Proﬁling

B Determination of Efﬁcacy in an Intracellular Infec-

tion Model

Allison, B.D., Phuong, V.K., McAtee, L.C., Rosen, M., Morton, M., Prendergast,

C., Barrett, T., Lagaud, G., Freedman, J., Li, L., et al. (2006). Identiﬁcation and

optimization of anthranilic sulfonamides as novel, selective cholecystokinin-2

receptor antagonists. J. Med. Chem. 49 , 6371–6390.

B 100-Day Culture Methods

Cell Chemical Biology 27, 1–14, January 16, 2020 11

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

Andries, K., Verhasselt, P., Guillemont, J., Gohlmann, H.W., Neefs, J.M.,

Winkler, H., Van Gestel, J., Timmerman, P., Zhu, M., Lee, E., et al. (2005). A di-

arylquinoline drug active on the ATP synthase of Mycobacterium tuberculosis .

Science 307 , 223–227.

Freundlich, J.S., Wang, F., Vilcheze, C., Gulten, G., Langley, R., Schiehser,

G.A., Jacobus, D.P., Jacobs, W.R., Jr., and Sacchettini, J.C. (2009).

Triclosan derivatives: towards potent inhibitors of drug-sensitive and drug-

resistant Mycobacterium tuberculosis . ChemMedChem 4 , 241–248.

Ashtekar, D.R., Costa-Perira, R., Nagrajan, K., Vishvanathan, N., Bhatt, A.D.,

and Rittel, W. (1993). In vitro and in vivo activities of the nitroimidazole CGI

Frohlich, T., and Tsogoeva, S.B. (2016). In vivo and in vitro optimization of

screening antimalarial hits toward lead molecules for preclinical development.

J. Med. Chem. 59 , 9668–9671.

17341 against Mycobacterium tuberculosis . Antimicrob. Agents Chemother.

3

7 , 183–186.

Geiter, L. (2017). Delamanid global clinical database and phase 3 trial results.

Paper presented at: Satellite symposium presentation at the 48th Union World

Conference on Lung Health (Guadalajara, Mexico).

Awasthi, D., and Freundlich, J.S. (2017). Antimycobacterial metabolism: illumi-

nating Mycobacterium tuberculosis biology and drug discovery. Trends

Microbiol. 25 , 756–767.

Gupta, A. (2017). SNPTB: nucleotide variant identiﬁcation and annotation in

Banerjee, A., Dubnau, E., Quemard, A., Balasubramanian, V., Um, K.S.,

Wilson, T., Collins, D., de Lisle, G., and Jacobs, W.R., Jr. (1994). inhA, a

gene encoding a target for isoniazid and ethionamide in Mycobacterium tuber-

culosis . Science 263 , 227–230.

Mycobacterium tuberculosis genomes. BioRxiv. https://doi.org/10.1101/

2

27066 .

Gurumurthy, M., Mukherjee, T., Dowd, C.S., Singh, R., Niyomrattanakit, P.,

Tay, J.A., Nayyar, A., Lee, Y.S., Cherian, J., Boshoff, H.I., et al. (2012).

Substrate speciﬁcity of the deazaﬂavin-dependent nitroreductase from

Mycobacterium tuberculosis responsible for the bioreductive activation of

bicyclic nitroimidazoles. FEBS J. 279 , 113–125.

Blaser, A., Palmer, B.D., Sutherland, H.S., Kmentova, I., Franzblau, S.G., Wan,

B., Wang, Y., Ma, Z., Thompson, A.M., and Denny, W.A. (2012). Structure-ac-

tivity relationships for amide-, carbamate-, and urea-linked analogues of the

tuberculosis drug (6S)-2-nitro-6-{[4-(triﬂuoromethoxy)benzyl]oxy}-6,7-dihy-

dro-5H-imidazo[2,1-b][1, 3]oxazine (PA-824). J. Med. Chem. 55 , 312–326.

Gurumurthy, M., Rao, M., Mukherjee, T., Rao, S.P., Boshoff, H.I., Dick, T.,

Barry, C.E., 3rd, and Manjunatha, U.H. (2013). A novel F(420)-dependent

anti-oxidant mechanism protects Mycobacterium tuberculosis against oxida-

tive stress and bactericidal agents. Mol. Microbiol. 87 , 744–755.

Boshoff, H.I., Myers, T.G., Copp, B.R., McNeil, M.R., Wilson, M.A., and Barry,

C.E., 3rd (2004). The transcriptional responses of Mycobacterium

tuberculosis to inhibitors of metabolism: novel insights into drug mechanisms

of action. J. Biol. Chem. 279 , 40174–40184.

Harper, J., Skerry, C., Davis, S.L., Tasneen, R., Weir, M., Kramnik, I., Bishai,

W.R., Pomper, M.G., Nuermberger, E.L., and Jain, S.K. (2012). Mouse model

of necrotic tuberculosis granulomas develops hypoxic lesions. J. Infect. Dis.

Brickner, S.J., Hutchinson, D.K., Barbachyn, M.R., Manninen, P.R.,

Ulanowicz, D.A., Garmon, S.A., Grega, K.C., Hendges, S.K., Toops, D.S.,

Ford, C.W., et al. (1996). Synthesis and antibacterial activity of U-100592

and U-100766, two oxazolidinone antibacterial agents for the potential treat-

ment of multidrug-resistant gram-positive bacterial infections. J. Med.

Chem. 39 , 673–679.

2

05 , 595–602.

Haver, H.L., Chua, A., Ghode, P., Lakshminarayana, S.B., Singhal, A.,

Mathema, B., Wintjens, R., and Bifani, P. (2015). Mutations in genes for the

F420 biosynthetic pathway and a nitroreductase enzyme are the primary resis-

tance determinants in spontaneous in vitro-selected PA-824-resistant mutants

of Mycobacterium tuberculosis . Antimicrob. Agents Chemother. 59 ,

Bruhin, H., B u € hlmann, X., Hook, W.H., Hoyle, W., Orford, B., and Vischer, W.

(1969). Antituberculosis activity of some nitrofuran derivatives. J. Pharm.

5

316–5323.

Pharmacol. 21 , 423–433.

Hoffmann, H., Kohl, T.A., Hofmann-Thiel, S., Merker, M., Beckert, P., Jaton, K.,

Nedialkova, L., Sahalchyk, E., Rothe, T., Keller, P.M., et al. (2016). Delamanid

and bedaquiline resistance in Mycobacterium tuberculosis ancestral Beijing

genotype causing extensively drug-resistant tuberculosis in a Tibetan refugee.

Am. J. Resp. Crit. Care Med. 193 , 337–340.

Chakraborty, S., Gruber, T., Barry, C.E., 3rd, Boshoff, H.I., and Rhee, K.Y.

(2013). Para-aminosalicylic acid acts as an alternative substrate of folate meta-

bolism in Mycobacterium tuberculosis . Science 339 , 88–91.

Chaudhuri, S., Li, L., Zimmerman, M., Chen, Y., Chen, Y.X., Toosky, M.N.,

Gardner, M., Pan, M., Li, Y.Y., Kawaji, Q., et al. (2018). Kasugamycin potenti-

ates rifampicin and limits emergence of resistance in Mycobacterium tubercu-

losis by speciﬁcally decreasing mycobacterial mistranslation. Elife 7, https://

doi.org/10.7554/eLife.36782 .

Hu, Y., and Coates, A.R. (2011). Mycobacterium tuberculosis acg gene is

required for growth and virulence in vivo. PLoS One 6 , e20958.

Hu, Y., Coates, A.R., and Mitchison, D.A. (2003). Sterilizing activities of ﬂuoro-

quinolones against rifampin-tolerant populations of Mycobacterium tubercu-

losis . Antimicrob. Agents Chemother. 47 , 653–657.

Conradie, F., Diacon, A.H., Everitt, D., Mendel, C., van Niekerk, C., Howell, P.,

Comins, K., and Spigelman, M. (2017). The Nix-TB trial of pretomanid, beda-

quiline and linezolid to treat XDR-TB. Paper presented at: Conference on

Retroviruses and Opportunistic Infections (Seattle, Washington).

Inoyama, D., Paget, S.D., Russo, R., Kandasamy, S., Kumar, P., Singleton, E.,

Occi, J., Tuckman, M., Zimmerman, M.D., Ho, H.P., et al. (2018). Novel pyrim-

idines as antitubercular agents. Antimicrob. Agents Chemother. 62, https://

doi.org/10.1128/AAC.02063-17 .

Ding, A.H., Nathan, C.F., and Stuehr, D.J. (1988). Release of reactive nitrogen

intermediates and reactive oxygen intermediates from mouse peritoneal mac-

rophages. Comparison of activating cytokines and evidence for independent

production. J. Immunol. 141 , 2407–2412.

Kumar, P., Capodagli, G.C., Awasthi, D., Shrestha, R., Maharaja, K., Sukheja,

P., Li, S.G., Inoyama, D., Zimmerman, M., Ho Liang, H.P., et al. (2018).

Synergistic lethality of a binary inhibitor of Mycobacterium tuberculosis

KasA. MBio 9, https://doi.org/10.1128/mBio.02101-17 .

Ekins, S., Reynolds, R.C., Kim, H., Koo, M.S., Ekonomidis, M., Talaue, M.,

Paget, S.D., Woolhiser, L.K., Lenaerts, A.J., Bunin, B.A., et al. (2013).

Bayesian models leveraging bioactivity and cytotoxicity information for drug

discovery. Chem. Biol. 20 , 370–378.

Lanoix, J.P., Tasneen, R., O’Brien, P., Sarathy, J., Saﬁ, H., Pinn, M., Alland, D.,

Dartois, V., and Nuermberger, E. (2016). High systemic exposure of pyrazinoic

acid has limited antituberculosis activity in murine and rabbit models of tuber-

culosis. Antimicrob. Agents Chemother. 60 , 4197–4205.

Feng, B.Y., and Shoichet, B.K. (2006). A detergent-based assay for the detec-

tion of promiscuous inhibitors. Nat. Protoc. 1 , 550–553.

Feng, B.Y., Simeonov, A., Jadhav, A., Babaoglu, K., Inglese, J., Shoichet, B.K.,

and Austin, C.P. (2007). A high-throughput screen for aggregation-based inhi-

bition in a large compound library. J. Med. Chem. 50 , 2385–2390.

Li, S.Y., Tasneen, R., Tyagi, S., Soni, H., Converse, P.J., Mdluli, K., and

Nuermberger, E.L. (2017). Bactericidal and sterilizing activity of a novel

regimen with bedaquiline, pretomanid, moxiﬂoxacin, and pyrazinamide in a

murine model of tuberculosis. Antimicrob. Agents Chemother. 61, https://

doi.org/10.1128/AAC.00913-17 .

Franzblau, S.G., Witzig, R.S., McLaughlin, J.C., Torres, P., Madico, G.,

Hernandez, A., Degnan, M.T., Cook, M.B., Quenzer, V.K., Ferguson, R.M.,

et al. (1998). Rapid, low-technology MIC determination with clinical

Mycobacterium tuberculosis isolates by using the microplate Alamar Blue

assay. J. Clin. Microbiol. 36 , 362–366.

MacMicking, J.D., North, R.J., LaCourse, R., Mudgett, J.S., Shah, S.K., and

Nathan, C.F. (1997). Identiﬁcation of nitric oxide synthase as a protective locus

against tuberculosis. Proc. Natl. Acad. Sci. U S A 94 , 5243–5248.

12 Cell Chemical Biology 27, 1–14, January 16, 2020

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

Manjunatha, U., Boshoff, H.I., and Barry, C.E. (2009). The mechanism of action

of PA-824: novel insights from transcriptional proﬁling. Commun. Integr. Biol.

Sarathy, J., Dartois, V., Dick, T., and Gengenbacher, M. (2013). Reduced drug

uptake in phenotypically resistant nutrient-starved nonreplicating

Mycobacterium tuberculosis . Antimicrob. Agents Chemother. 57 , 1648–1653.

2

, 215–218.

Scott, J.S., Gill, A.L., Godfrey, L., Groombridge, S.D., Rees, A., Revill, J.,

Schoﬁeld, P., Sorme, P., Stocker, A., Swales, J.G., et al. (2012).

Optimisation of pharmacokinetic properties in a neutral series of 11beta-

HSD1 inhibitors. Bioorg. Med. Chem. Lett 22 , 6756–6761.

Manjunatha, U.H., Boshoff, H., Dowd, C.S., Zhang, L., Albert, T.J., Norton,

J.E., Daniels, L., Dick, T., Pang, S.S., and Barry, C.E., 3rd (2006).

Identiﬁcation of a nitroimidazo-oxazine-speciﬁc protein involved in PA-824

resistance in Mycobacterium tuberculosis . Proc. Natl. Acad. Sci. U S A 103 ,

431–436.

Shoichet, B.K. (2006). Interpreting steep dose-response curves in early inhib-

itor discovery. J. Med. Chem. 49 , 7274–7277.

Matsumoto, M., Hashizume, H., Tomishige, T., Kawasaki, M., Tsubouchi, H.,

Sasaki, H., Shimokawa, Y., and Komatsu, M. (2006). OPC-67683, a nitro-dihy-

dro-imidazooxazole derivative with promising action against tuberculosis

in vitro and in mice. PLoS Med. 3 , e466.

Singh, R., Manjunatha, U., Boshoff, H.I., Ha, Y.H., Niyomrattanakit, P.,

Ledwidge, R., Dowd, C.S., Lee, I.Y., Kim, P., Zhang, L., et al. (2008). PA-824

kills nonreplicating Mycobacterium tuberculosis by intracellular NO release.

Science 322 , 1392–1395.

Mehta, P.K., King, C.H., White, E.H., Murtagh, J.J., and Quinn, F.D. (1996).

Comparison of in vitro models for the study of Mycobacterium tuberculosis in-

vasion and intracellular replication. Infect. Immun. 64 , 2673–2679.

Sivaraman, S., Zwahlen, J., Bell, A.F., Hedstrom, L., and Tonge, P.J. (2003).

Structure-activity studies of the inhibition of FabI, the enoyl reductase from

Escherichia coli , by triclosan: kinetic analysis of mutant FabIs. Biochemistry

Murray, S. (2016). NC-005: Phase 2 clinical trial results of bedaquiline, moxi-

ﬂoxacin, pretomanid, and pyrazinamide for drug-sensitive and drug-resistant

TB. Paper presented at: Satellite symposium presentation at the 47th Union

World Conference on Lung Health (Liverpool, England).

4

2 , 4406–4413.

Slayden, R.A., and Barry, C.E., 3rd (2001). Analysis of the lipids of

Mycobacterium tuberculosis . Methods Mol. Med. 54 , 229–245.

Stec, J., Vilcheze, C., Lun, S., Perryman, A.L., Wang, X., Freundlich, J.S.,

Bishai, W., Jacobs, W.R., Jr., and Kozikowski, A.P. (2014). Biological evalua-

tion of potent triclosan-derived inhibitors of the enoyl-acyl carrier protein

reductase InhA in drug-sensitive and drug-resistant strains of

Mycobacterium tuberculosis . ChemMedChem 9 , 2528–2537.

Negri, A., Javidnia, P., Mu, R., Zhang, X., Vendome, J., Gold, B., Roberts, J.,

Barman, D., Ioerger, T., Sacchettini, J.C., et al. (2018). Identiﬁcation of a my-

cothiol-dependent nitroreductase from Mycobacterium tuberculosis . ACS

Infect. Dis. 4 , 771–787.

Palmer, B.D., Sutherland, H.S., Blaser, A., Kmentova, I., Franzblau, S.G., Wan,

B., Wang, Y., Ma, Z., Denny, W.A., and Thompson, A.M. (2015). Synthesis and

structure-activity relationships for extended side chain analogues of the anti-

tubercular drug (6S)-2-nitro-6-{[4-(triﬂuoromethoxy)benzyl]oxy}-6,7-dihydro-

Stover, C.K., Warrener, P., VanDevanter, D.R., Sherman, D.R., Arain, T.M.,

Langhorne, M.H., Anderson, S.W., Towell, J.A., Yuan, Y., McMurray, D.N.,

et al. (2000). A small-molecule nitroimidazopyran drug candidate for the treat-

ment of tuberculosis. Nature 405 , 962–966.

5

H-imidazo[2,1-b][1, 3]oxazine (PA-824). J. Med. Chem. 58 , 3036–3059.

Parikh, S., Moynihan, D.P., Xiao, G., and Tonge, P.J. (1999). Roles of tyrosine

58 and lysine 165 in the catalytic mechanism of InhA, the enoyl-ACP reduc-

Summa, V., Petrocchi, A., Matassa, V.G., Gardelli, C., Muraglia, E., Rowley,

M., Paz, O.G., Laufer, R., Monteagudo, E., and Pace, P. (2006). 4,5-

Dihydroxypyrimidine carboxamides and N-alkyl-5-hydroxypyrimidinone

carboxamides are potent, selective HIV integrase inhibitors with good

pharmacokinetic proﬁles in preclinical species. J. Med. Chem. 49 ,

1

tase from Mycobacterium tuberculosis . Biochemistry 38 , 13623–13634.

Purkayastha, A., McCue, L.A., and McDonough, K.A. (2002). Identiﬁcation of a

Mycobacterium tuberculosis putative classical nitroreductase gene whose

expression is coregulated with that of the acr aene within macrophages, in

standing versus shaking cultures, and under low oxygen conditions. Infect.

Immun. 70 , 1518–1529.

6

646–6649.

Tan, M.P., Sequeira, P., Lin, W.W., Phong, W.Y., Cliff, P., Ng, S.H., Lee, B.H.,

Camacho, L., Schnappinger, D., Ehrt, S., et al. (2010). Nitrate respiration pro-

tects hypoxic Mycobacterium tuberculosis against acid- and reactive nitrogen

species stresses. PLoS One 5 , e13356.

Rao, S.P.S., Lakshminarayana, S.B., Kondreddi, R.R., Herve, M., Camacho,

L.R., Bifani, P., Kalapala, S.K., Jiricek, J., Ma, N.L., Tan, B.H., et al. (2013).

Indolcarboxamide is a preclinical candidate for treating multidrug-resistant

tuberculosis. Sci. Transl. Med. 5 , 214ra168.

Thompson, A.M., Bonnet, M., Lee, H.H., Franzblau, S.G., Wan, B., Wong, G.S.,

Cooper, C.B., and Denny, W.A. (2017). Antitubercular nitroimidazoles revis-

ited: synthesis and activity of the authentic 3-nitro isomer of pretomanid.

ACS Med. Chem. Lett. 8 , 1275–1280.

Rawat, R., Whitty, A., and Tonge, P.J. (2003). The isoniazid-NAD adduct is a

slow, tight-binding inhibitor of InhA, the Mycobacterium tuberculosis enoyl

reductase: adduct afﬁnity and drug resistance. Proc. Natl. Acad. Sci. U S A

Thompson, A.M., Sutherland, H.S., Palmer, B.D., Kmentova, I., Blaser, A.,

Franzblau, S.G., Wan, B., Wang, Y., Ma, Z., and Denny, W.A. (2011).

Synthesis and structure-activity relationships of varied ether linker analogues

of the antitubercular drug (6S)-2-nitro-6-{[4-(triﬂuoromethoxy)benzyl]oxy}-6,7-

dihydro-5h-imidazo[2,1-b][1, 3]oxazine (PA-824). J. Med. Chem. 54 ,

100 , 13881–13886.

Rengarajan, J., Bloom, B.R., and Rubin, E.J. (2005). Genome-wide require-

ments for Mycobacterium tuberculosis adaptation and survival in macro-

phages. Proc. Natl. Acad. Sci. U S A 102 , 8327–8332.

6

563–6585.

Twarog, N.R., Stewart, E., Hammill, C.V., and Shelat, A.A. (2016). BRAID: a

unifying paradigm for the analysis of combined drug action. Sci. Rep.

Rifat, D., Li, S.-Y., Ioerger, T., Lanoix, J.-P., Lee, J., Bashiri, G., Sacchettini, J.,

and Nuermberger, E. (2018). Mutations in Rv2983 as a novel determinant of

resistance to nitroimidazole drugs in Mycobacterium tuberculosis. bioRxiv.

https://doi.org/10.1101/457754 .

6

, 25523.

van Soolingen, D., Hermans, P.W., de Haas, P.E., Soll, D.R., and van Embden,

J.D. (1991). Occurrence and stability of insertion sequences in Mycobacterium

tuberculosis complex strains: evaluation of an insertion sequence-dependent

DNA polymorphism as a tool in the epidemiology of tuberculosis. J. Clin.

Microbiol. 29 , 2578–2586.

Robinson, M.D., McCarthy, D.J., and Smyth, G.K. (2010). edgeR:

a

Bioconductor package for differential expression analysis of digital gene

expression data. Bioinformatics 26 , 139–140.

Vilcheze, C., Baughn, A.D., Tufariello, J., Leung, L.W., Kuo, M., Basler, C.F.,

Alland, D., Sacchettini, J.C., Freundlich, J.S., and Jacobs, W.R., Jr. (2011).

Novel inhibitors of InhA efﬁciently kill Mycobacterium tuberculosis under aer-

obic and anaerobic conditions. Antimicrob. Agents Chemother. 55 ,

Rosado, L.A., Wahni, K., Degiacomi, G., Pedre, B., Young, D., de la Rubia,

A.G., Boldrin, F., Martens, E., Marcos-Pascual, L., Sancho-Vaello, E., et al.

(2017). The antibacterial prodrug activator Rv2466c is a mycothiol-dependent

reductase in the oxidative stress response of Mycobacterium tuberculosis .

J. Biol. Chem. 292 , 13097–13110.

3

889–3898.

Vilcheze, C., Wang, F., Arai, M., Hazbon, M.H., Colangeli, R., Kremer, L.,

Weisbrod, T.R., Alland, D., Sacchettini, J.C., and Jacobs, W.R., Jr. (2006).

Transfer of a point mutation in Mycobacterium tuberculosis inhA resolves the

target of isoniazid. Nat. Med. 12 , 1027–1029.

Rozwarski, D.A., Grant, G.A., Barton, D.H.R., Jacobs, W.R., Jr., and

Sacchettini, J.C. (1998). Modiﬁcation of the NADH of the isoniazid target

(InhA) from Mycobacterium tuberculosis . Science 279 , 98–102.

Cell Chemical Biology 27, 1–14, January 16, 2020 13

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

Voskuil, M.I., Bartek, I.L., Visconti, K., and Schoolnik, G.K. (2011). The

response of mycobacterium tuberculosis to reactive oxygen and nitrogen spe-

cies. Front. Microbiol. 2 , 105.

Wilson, R., Kumar, P., Parashar, V., Vilcheze, C., Veyron-Churlet, R.,

Freundlich, J.S., Barnes, S.W., Walker, J.R., Szymonifka, M.J., Marchiano,

E., et al. (2013). Antituberculosis thiophenes deﬁne a requirement for Pks13

in mycolic acid biosynthesis. Nat. Chem. Biol. 9 , 499–506.

WHO (2018). Global Tuberculosis Report 2018 (World Health Organization).

Wilson, M., DeRisi, J., Kristensen, H.H., Imboden, P., Rane, S., Brown, P.O.,

and Schoolnik, G.K. (1999). Exploring drug-induced alterations in gene

expression in Mycobacterium tuberculosis by microarray hybridization. Proc.

Natl. Acad. Sci. U S A 96 , 12833–12838.

Zhang, Y., Heym, B., Allen, B., Young, D., and Cole, S. (1992). The catalase-

peroxidase gene and isoniazid resistance of Mycobacterium tuberculosis .

Nature 358 , 591–593.

14 Cell Chemical Biology 27, 1–14, January 16, 2020

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE

Bacterial and Virus Strains

M. tuberculosis strain H37Rv

M. tuberculosis strain CDC1551

SOURCE

IDENTIFIER

Lab stock

BEI NR-13648

BEI NR-13649

N/A

Lab stock

M. tuberculosis transposon library with H37Rv

background (H37Rv::tn)

Professor Christopher Sassetti’s Lab

M. tuberculosis Dleu DpanCD auxotroph

2

strain mc 6206

Professor William R. Jacobs’ Lab

Professor David Alland’s Lab

N/A

M. tuberculosis katG mutant (KatG S315T)

DRM12

TDR31

M. tuberculosis clinical strain TDR31 resistant

Special Programme for Research and

Training in Tropical Diseases (TDR)

established by UNICEF/UNDP/World

Bank/WHO Special Programs (Through

Pradeep Kumar in Professor David

Alland’s lab)

to INH, RIF, EMB, KAN, SM, CAP

M. tuberculosis clinical strain TDR36 resistant

Special Programme for Research and

Training in Tropical Diseases (TDR)

established by UNICEF/UNDP/World

Bank/WHO Special Programs (Through

Pradeep Kumar in Professor David

Alland’s lab)

TDR36

to INH, RIF, EMB

M. tuberculosis clinical strain TDR116 resistant

Special Programme for Research and

Training in Tropical Diseases (TDR)

established by UNICEF/UNDP/World

Bank/WHO Special Programs (Through

Pradeep Kumar in Professor David

Alland’s lab)

TDR116

to INH, EMB, PAS

E. coli chemically competent TOP10

E. coli chemically competent BL21(DE3)pLysE

Chemicals, Peptides, and Recombinant Proteins

Small molecules labeled as JSF-#

Pretomanid

ThermoFisher

Cat# C40005

C656503

This paper; Freundlich Lab

AdooQ Bioscience

Sigma-Aldrich

Cat# A11401-50

Cat# 75182-50MG

Cat# AR11351

Isoniazid (INH)

Rifampicin (RIF)

Carbosynth

b-Nicotinamide adenine dinucleotide, reduced

dipotassium salt (b-NADH)

Sigma-Aldrich

Cat# N4505-500MG

trans-2-dodecenoyl-CoA (DD-CoA)

Freundlich Lab

N/A

Resazurin sodium salt

TM

TRIzol Reagent

Sigma-Aldrich

Cat# R7017-5G

Cat# 15596018

N/A

ThermoFisher

M. tuberculosis protein InhA expressed in E. coli

Critical Commercial Assays

This paper; Freundlich Lab

Griess Reagent Kit. for nitrite quantitation

Vybrant MTT Cell Proliferation Assay Kit

TM

ThermoFisher

Qiagen

Cat# G7921

Cat# V13154

alamarBlue Dye

Cat# Y00-025

Cat# 74106

RNeasy Mini Kit

Nextera XT DNA Library Kit

Nextera XT Index Kit (24 indexes, 96 samples)

Ribo Zero kit

Illumina

Cat# FC-131-1096

Cat# FC-131-1001

Cat# MRZB12424

Cat# 7770

Illumina

NEBNext Ultra II RNA library prep kit

New England Biolabs

(Continued on next page)

Cell Chemical Biology 27, 1–14.e1–e11, January 16, 2020 e1

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

Continued

REAGENT or RESOURCE

Deposited Data

SOURCE

IDENTIFIER

Raw and analyzed RNA-seq data

This paper

NCBI Gene Expression Omnibus

(GEO), GSE126718

Transcriptional responses of M. tuberculosis

NCBI Gene Expression Omnibus

(Boshoff et al., 2004)

GEO: GSE1642

to inhibitors of metabolism

Transcriptional response of M. tuberculosis

NCBI Gene Expression Omnibus

(Voskuil et al., 2011)

GEO: GSE16146

to reactive oxygen and nitrogen species

Whole-genome sequencing data of M.

tuberculosis mutants against JSF-2019

This paper

NCBI Sequence Read Archive (SRA),

access code PRJNA521574

Experimental Models: Cell Lines

J774.1 mouse macrophage

ATCC

ATCC TIB-67

ATCC CCL-81

Vero cell (African green monkey kidney)

Experimental Models: Organisms/Strains

Mouse: 6-week-old-female outbred CD-1 IGS

Mouse: 9-week-old female BALB/c

Oligonucleotides

Charles River Labs

Crl:CD1(ICR), strain code 022

BALB/cAnNCrl, strain code 028

Primer for fgd1 ampliﬁcation from M. tuberculosis

This paper

N/A

Forward: GAGGCATTCTCCCGGTATTC

Primer for fgd1 ampliﬁcation from M. tuberculosis

Reverse: GCAGAGAGCCGCGTAATC

Primer for cloning M. tuberculosis inhA

Forward: GACGCATATGACAGGACTGCTGGAC

Primer for cloning M. tuberculosis inhA

Reverse: GGCGGATCCTAGAGCAATTGGGTG

Recombinant DNA

Vector pET15b

Millipore sigma

Cat# 69661

Software and Algorithms

GraphPad Prism

GraphPad software Inc

https://www.graphpad.com/scientiﬁc-

software/prism/

SnapGene

GSL Biotech LLC

Raivo Kolde

https://www.snapgene.com/

R package ‘pheatmap’

https://CRAN.R-project.org/

package=pheatmap

R package ‘braidrm’

Twarog et al., 2016

Gupta, 2017

https://CRAN.R-project.org/

package=braidrm

R package ‘braidReports’

https://CRAN.R-project.org/

package=braidReports

SNPTB for mapping Illumina whole-genome

sequencing data to reference

https://github.com/aditi9783/SNPTB

LEAD CONTACT AND MATERIALS AVAILABILITY

Further information and requests for reagents may be forwarded to the corresponding author Joel S. Freundlich (freundjs@rutgers.

edu ). All unique/stable reagents generated in this study are available from the Lead Contact without restriction.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Mice

Animal studies were carried out in accordance with the guide for the care and use of Laboratory Animals of the National Institutes of

Health, with approval from the Institutional Animal Care and Use Committee (IACUC) of the New Jersey Medical School, Rutgers

University, Newark. All animals were maintained under speciﬁc pathogen-free conditions and fed water and chow ad libitum, and

all efforts were made to minimize suffering or discomfort. Mouse PK studies used 6-week-old female outbred CD-1 mice (Charles

River Labs, Wilmington, MA). 9-week-old female BALB/c mice (19-20 g, Charles River Labs, Wilmington, MA) were used for the

mouse acute infection model.

e2 Cell Chemical Biology 27, 1–14.e1–e11, January 16, 2020

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

Bacterial Strains and Culture Conditions

M. tuberculosis strains H37Rv (BEI NR-13648) and CDC1551 (BEI NR-13649) are from our laboratory’s stock. M, tuberculosis trans-

poson library with H37Rv background (H37Rv::tn) was a kind gift from Professor Christopher Sassetti’s laboratory. M. tuberculosis

2

Dleu DpanCD auxotroph strain mc 6206 and inhA promoter mutation (c(-15)t) strain mc 4914 were kind gifts from the laboratory

2

ꢂ

of Professor William R. Jacobs, Jr. M. tuberculosis strains were grown at 37 C in Difco Middlebrook 7H9 (BD) medium with 0.2%

(

v/v) glycerol, 10% (v/v) ADS (0.5% bovine serum albumin (BSA, Fisher), 0.2% dextrose, 0.085% NaCl), and 0.05% tyloxapol

7H9+ADS+tyloxapol). Transposon strains with the kanamycin resistance marker were cultured with 7H9+ADS+tyloxapol media

supplemented with kanamycin at 20 mg/mL.

METHOD DETAILS

Minimum Inhibitory Concentration (MIC) Assay

MIC values of the compounds were determined following the microplate-based Alamar Blue assay (MABA) method as previously

described (Franzblau et al., 1998). Twofold series dilutions of compounds were prepared in sterile polystyrene 96-well round-bottom

plate (CLS3795, Corning, NY) with Middlebrook 7H9+ADS media (no tyloxapol) as 100 mL per well. M. tuberculosis strains were

1

:1000 diluted in 7H9+ADS medium at mid-logarithmic stage of growth (OD595 = 0.4). 50 mL of diluted bacteria suspensions were

ꢂ

inoculated into each well, followed by incubation at 37 C for 7 d. 20 mL alamarBlueꢀ reagent (Invitrogen, Frederick, MD), freshly

mixed with 12.5 mL 20% Tween 80, was added into each well, followed by 24-h incubation at 37 C. Absorbance was read at

ꢂ

5

70 nm, with reference wavelength 600 nm, using a microplate reader (ELX808, Biotek Instruments). The MIC endpoint was deﬁned

as the lowest concentration of the test agent that produced at least 90% reduction in absorbance compared with that of the drug-free

control.

Minimum Bactericidal Concentration (MBC) Assay

To determine the minimum bactericidal concentration (MBC) against M. tuberculosis, the bacterial cultures from the 96-well plates

utilized for the compound MIC determination instead of undergoing Alamar Blue addition were re-suspended, serially diluted with

sterile PBS and plated on Middlebrook 7H11 plates. Colony-forming units (CFUs) were enumerated following 21-d incubation at

ꢂ

3

compared to the no-compound control.

7 C. The MBC was reported as the minimum compound concentration at which a 2 log10 reduction in CFUs was observed as

JSF-2019 Spontaneous Mutagenesis

Compound JSF-2019 was supplemented into 7H10 agar plates with 10% (v/v) ADS and 0.5% glycerol at 5x, 10x, 20x, and 30x MIC.

9

Mid-log phase of M. tuberculosis H37Rv culture (OD595 = 0.4) was harvested and concentrated to ꢀ10 CFU/mL in fresh medium

8

7

H9+ADS followed by CFU enumeration. 100 mL of culture (ꢀ10 CFU) was streaked on JSF-2019 containing agar plates followed

ꢂ

by incubation at 37 C for 4 to 6 weeks. Single colonies were isolated followed by liquid MIC test for resistance veriﬁcation. For

resistant colonies of interest, genomic DNA was isolated (van Soolingen et al., 1991). Genomic libraries were prepared using the Nex-

tera XP Library Prep Kit (Illumina, San Diego, CA) prior to sequencing on the Illumina NextSeq Platform (Illumina, San Diego, CA).

Sequence reads were aligned to reference strain H37Rv (AL123456.3) and analyzed for single nucleotide polymorphisms (SNPs) us-

ing the SNPTB platform (Gupta, 2017).

RNA-Seq Analysis Method

Total RNA was extracted by using Trizol (Invitrogen) followed by Qiagen RNeasy kit puriﬁcation using the standard protocol. The

quality of RNA was checked on an Agilent 2100 Bioanalyzer using the RNA pico6000 kit; samples with RNA integrity number >7.0

were used for subsequent processing. Illumina Ribo-Zero rRNA Removal Kit (Bacteria) was used for the removal of ribosomal

RNA according to the manufacturer’s protocol. The Illumina compatible RNA-seq library was prepared using the NEBNext ultra

RNAseq library preparation kit. The cDNA libraries were puriﬁed using AmpureXP beads and quantiﬁed on an Agilent 2100 Bio-

analyzer as well as a Qubit 2.0 Fluorometer (Life Technologies, Carlsbad, CA). An equimolar amount of barcoded libraries were

pooled and sequenced on an Illumina NextSeq 500 (Illumina, San Diego, CA) with 1x75 conﬁguration. CLC Genomics Workbench

1

0.0.1 version (CLC, Bio-QIAGEN, Aarhus, Denmark) was used for RNA-Seq analysis. De-multiplexed FASTQ ﬁles from RNA-Seq

libraries were imported into the CLC software. Bases with low quality were trimmed and reads were mapped to the reference

genome, M. tuberculosis H37Rv (GenBank ID: NC_000962.3). The aligned reads were obtained and differential expression for

RNA-seq data was carried out using multi-factorial statistics based on a negative binomial Generalized Linear Model (GLM) (Robin-

son et al., 2010), an RNA-seq tool in the CLC Genomic Workbench. Replicates were averaged and differentially expressed signiﬁcant

genes with FDR p-value <0.05 and fold change of an absolute value >1.5 for the three comparisons were calculated.

,

Griess Assay for NO Quantiﬁcation

Griess reagent (Invitrogen, G7921) was applied to quantify NO release from the M. tuberculosis strain in the presence of compound.

,

M. tuberculosis strains were grown to mid-log phase (OD595 = 0.3) followed by compound treatment. At each time point, the super-

natant of the culture aliquot was added to a 96-well plate in triplicate (200 mL/well). 20 mL of Griess reagent mix was added into each

Cell Chemical Biology 27, 1–14.e1–e11, January 16, 2020 e3

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

well followed by incubation at room temperature for 30 min. Results were read at an absorbance of 548 nm, and sample nitrite

concentration was converted from absorbance reading according to a nitrite calibration curve.

Intrabacterial Drug Metabolism (IBDM) Assay

8

An M. tuberculosis culture was grown to mid-log phase (OD595 = 0.6; ꢀ2x10 CFU/mL) in 7H9+ADS+tyloxapol for each compound

ꢂ

treatment at a desired concentration. After 24 h, the cell pellet was harvested by centrifugation (10,000 rpm for 10 min at 4 C). The

3 3

washed pellet was quenched with CH CN/CH OH/water (2:2:1) pre-chilled on dry ice, followed by lysis via bead beating (6.5 m/s, 30

s, 6 times). In between each round of bead beating, the sample was chilled on ice for 2 min to avoid overheating. The pellet metabolite

extract in organic solvent was collected via 0.22 mm ﬁltration. After a proper decontamination process, both culture supernatant and

pellet extract were brought out of the BSL-3 for further analysis.

We typically applied an Agilent 1260 HPLC coupled with an Agilent 6120 quadrupole mass spectrum for metabolomics analysis.

2

Metabolites were separated on a Chromolith SpeedRod column with a gradient of H O and acetonitrile acidiﬁed with 0.1% formic

acid. The mass resolution ranged from 10 to 2000 Da with an accuracy of ± 0.13 Da within the calibrated mass range in scan

mode. After extraction and puriﬁcation of a certain metabolite from cell lysate, its structure was conﬁrmed by comparison of its

1

H NMR spectrum (Bruker Avance 500 MHz spectrometer), LC-MS spectrum (Agilent 6120 single quadrupole LC/MS system) and

high-resolution mass (Agilent 6220 accurate-mass time-of-ﬂight or Thermo LTQ Orbitrap XL) with those for an authentic/indepen-

dently synthesized sample. Signal intensity was quantiﬁed by standard curve for an authentic/independently synthesized sample,

and normalized by sample protein concentration determined via the Pierce BCA protein assay kit.

Physiochemical and ADME Proﬁling

This set of assays was performed by BioDuro, Incorporated. Mouse and human liver microsomal stability were determined via the

following protocol. Working solutions of test compound were prepared in DMSO and diluted to a ﬁnal concentration of 100 mM in

5

tubes using a multichannel pipette. Positive control (midazolam) and test compound working solutions were transferred into the

0 mM phosphate buffer (pH 7.4). Aliquots of mouse or human liver microsome working solution were transferred into Eppendorf

ꢂ

tubes. The mixtures were vortexed gently and then pre-incubated at 37 C. Buffer with or without 5 mM NADPH was aliquoted

into the tubes using a multichannel pipette and vortexed gently. At each time point of 0, 5, 15, 30, and 60 min with NADPH or 0,

3

0, and 60 min without NADPH, terfenadine/tolbutamide in acetonitrile/MeOH (1:1 v/v) was added to the reaction mixture to quench

ꢂ

and precipitate the microsomal incubations. Samples were capped and vigorously vortexed and then centrifuged at 4 C. An aliquot

of each supernatant was transferred for LC-MS/MS analysis. The MS detection was performed by using a SCIEX API 4000 QTRAP

˚

instrument. Each compound was analyzed by reverse-phase HPLC using a Kinetex 2.6m C18 100A column (3.0 mm X 30 mm, Phe-

nomenex) with the mobile phase consisting of solvent A: water with 0.1% formic acid, solvent B: acetonitrile with 0.1% formic acid.

The amount of parent compound was determined on the basis of the peak area ratio (compound area to internal standard area) at

each time point, enabling the determination of the compound half-life, t1/2. The estimation of Clint (in mL/min/mg protein) was calcu-

lated using Equation 1:

lnð2Þ 3 1000 3 ½proteinꢃ

Clint =

(Equation 1)

t1=2

Kinetic aqueous solubility was quantiﬁed by the following approach. Dilutions of test compound solution were prepared in DMSO.

mL of each dilution of the test compound in DMSO was added to 396 mL of the universal aqueous buffer (pH = 7.4; 45 mM etha-

4

nolamine, 45 mM KH

2 4

PO , 45 mM potassium acetate, 75 mM KCl) to afford a ﬁnal DMSO concentration ranging between

0

.002 mM and 200 mM. Three replicates of each test compound were prepared per concentration. After 4 h shaking at rt, the mixture

was further incubated without shaking for 30 min at rt and then was ﬁltered. The ﬁltrate was diluted 10x and 30x with DMSO before

LC-MS/MS analysis. Standard solutions were prepared as follows: stock solutions were diluted to ten deﬁned concentration points

from 60 mM to 0.002 mM with DMSO. Aliquots of samples and standard solutions were ﬁltered and mixed with acetonitrile/H

2

O, then

vortexed and used for LC-MS/MS analysis. The MS detection was performed by using a SCIEX API 4000 QTRAP instrument. Each

˚

compound was analyzed by reverse-phase HPLC using a Kinetex 2.6m C18 100 A column (3.0 mm X 30 mm, Phenomenex) with the

mobile phase consisting of solvent A: water with 0.1% formic acid, solvent B: acetonitrile with 0.1% formic acid. The amount of parent

compound was determined on the basis of the peak area ratio (compound area to internal standard area) for each time point. The

solubility of the test compound was determined based on the largest calculated concentration amongst the samples.

Mouse and human plasma protein binding and stability were measured with the following procedure. Working solutions (1 mM in

DMSO) were prepared for each test and control compound. The dosing solutions were prepared by diluting the working solutions to

5

mM in plasma. The dialysis plate was prepared by adding buffer to one chamber and dosing solution to the other chamber. The plate

ꢂ

was sealed with an adhesive ﬁlm and incubated at 37 C while shaking for 5 h. Equal volumes of post dialysis samples were removed

from both the plasma and the buffer chambers and placed in separate microcentrifuge tubes and equal volumes (50 mL) of fresh phos-

phate buffer and plasma were added to the tubes, respectively. Plasma samples were diluted 5-fold and then all samples were

treated with quenching solution (terfenadine/tolbutamide in 1:1 v/v methanol/acetonitrile). Sample mixtures were then centrifuged,

ꢂ

and the supernatant was subjected to LC-MS/MS analysis. To assess plasma stability, aliquots of dosing solution were stored at 4 C

ꢂ

(t = 0 h sample) and at 37 C for 5 h (t = 5 h sample). Following incubation, aliquots were subjected to LC-MS/MS analysis. The MS

detection was performed by using a SCIEX API 4000 QTRAP instrument. Each compound was analyzed by reverse-phase HPLC

e4 Cell Chemical Biology 27, 1–14.e1–e11, January 16, 2020

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

˚

using a Kinetex 2.6m C18 100 A column (3.0 mm X 30 mm, Phenomenex) with the mobile phase consisting of solvent A: water with

.1% formic acid, solvent B: acetonitrile with 0.1% formic acid. The amount of parent compound was determined on the basis of the

0

peak area ratio (compound area to internal standard area) for each time point. The percent plasma protein binding was calculated

according to Equation 2, where Cpe is the concentration of test compound in plasma at equilibrium and Cb is the concentration

of test compound in buffer at equilibrium, and the percent plasma stability was determined via Equation 3:

Cpe ꢁ Cb

%

Binding =

3 100

(Equation 2)

Cpe

½

stability sampleꢃ

3 100

%

Stability of test compound =

(Equation 3)

½

time zero sampleꢃ

Human cytochrome P450 inhibition was assayed via the following methodology. Pooled human liver microsomes were used as the

enzyme source, and phenacetin (CYP1A2, 10 mM), diclofenac (CYP2C9, 10 mM), omeprazole (CYP2C19, 0.5 mM), dextromethorphan

(

pound (each with ﬁnal concentrations in the 0 – 50 mM range) and human liver microsomes (ﬁnal concentration of 0.25 mg protein per

CYP2D6, 5 mM), and midazolam (CYP3A4, 5 mM) as probe substrates. The assay mixture (200 mL total volume) contained test com-

ꢂ

mL) with or without NADPH (ﬁnal concentration of 1.0 mM) in 100 mM phosphate buffer (pH 7.4). After a 20 min incubation at 37 C, the

mixture was quenched by adding 300 mL of methanol/acetonitrile (1:1 v/v) containing terfenadine and tolbutamide. The sample was

ꢂ

then centrifuged at 4,000 rpm for 15 min at 4 C. 100 mL supernatant was subjected to LC-MS/MS analysis. The MS detection was

performed by using a SCIEX API 4000 QTRAP instrument. Each compound was analyzed by reverse-phase HPLC using a Kinetex

˚

2

.6m C18 100 A column (3.0 mm X 30 mm, Phenomenex) with the mobile phase consisting of solvent A: water with 0.1% formic acid,

solvent B: acetonitrile with 0.1% formic acid. The amount of parent compound was determined on the basis of the peak area ratio

compound area to internal standard area) for each time point. Residual enzyme activity was monitored by measuring area ratio with

(

respect to the internal standard of the corresponding metabolite for each substrate. The IC50 was ﬁt using the GraphPad Prism soft-

ware program (version 6.0) according to Equation 4:

1

%

Residual activity =

3 100

(Equation 4)

lnIC50ꢁln½Iꢃ

1

+ e

P

where [I] and P are inhibitor concentration and Hill slope, respectively.

Determination of Efﬁcacy in an Intracellular Infection Model

The activity of a test compound against intracellular bacteria was determined by infecting J774.1 mouse macrophages (ATCC TIB-

2

7) with the mc 6206 DleuCD DpanCD strain of M. tuberculosis transformed with an mLux plasmid (kindly provided by Professor

6

Jeffery Cox, UC Berkeley) based on published protocols (Mehta et al., 1996; Rengarajan et al., 2005). The macrophages were sus-

pended in Dulbecco’s Modiﬁed Eagle Medium (Sigma-Aldrich D6429) supplemented with 10% Fetal Bovine Serum (Sigma-Aldrich

5

F6178) to a concentration of 2.0 x 10 cells/mL. 96-well white ﬂat-bottomed assay plates were seeded with 100 mL of the macrophage

suspension and incubated overnight to allow cells to adhere to the plate. The assay plates were then inoculated with 100 mL of lumi-

2

ꢂ

2

nescent mc 6206 M. tuberculosis at a multiplicity of infection of 1:10. The plates were incubated for 4 h at 37 C and 5% CO to allow

the bacteria to infect the macrophages and then washed twice with 100 mL of DMEM supplemented with FBS, pantothenic acid

and leucine. After the second wash, 100 mL of DMEM with gentamicin was added to each well and the plates were incubated for

an additional 2 h to kill any remaining extracellular bacteria. The plates were washed twice with 100 mL of DMEM supplemented

with FBS, pantothenic acid and leucine, and then test compound was added to the plates at the desired concentrations. The plates

ꢂ

were incubated at 37 C and 5% CO

ega). Each treatment was done in triplicate and the experiment was repeated twice.

2

for 72 h. Luminescence was measured every 24 h using the GloMaxꢀ Detection System (Prom-

1

00-Day Culture Methods

As seen in the Hu-Coates protocol (Hu et al., 2003), the media was obtained from Difco (Becton Dickinson Laboratories, Sparks, MD,

USA) and consisted of 7H9 liquid media containing 20% Tween 80, supplemented with an albumin, dextrose, and salt (ADC) com-

TM

plex. Cultures of M. tuberculosis strain H37Rv were grown in 25 mL plastic ‘Universal’ Nunc containers with caps (Thermo Scien-

ꢂ

tiﬁc, Waltham, MA, USA) incubated at 37 C placed stationary and upright in a rack for 100-115 d. After 100-115 d incubation, each

tube was vortexed with sterile beads. After breaking up clumps by vortex, cultures were pooled together in single sterile ﬂask and

sonicated in a water bath (Branson Ultrasonics, CT, USA). For day 0, aliquots of pooled culture were diluted and plated on 7H11-glyc-

erol-ADC agar plates (Becton Dickinson Laboratories, Sparks, MD, USA). In separate ‘Universal’ containers, drugs and DMSO

(

Sigma-Aldrich, St Louis, MO, USA) were prepared to ﬁnal concentration of 100 mM in triplicate. From the pooled ﬂask, 8 mL of culture

ꢂ

were added to new drug tubes and incubated at 37 C placed stationary and upright in a rack for 5 d. On day 5, the Nunc tubes were

spun at 4000 rpm for 10 min in a Jouan CR4-12 high-speed centrifuge (Thermo Scientiﬁc, Waltham, MA, USA) and washed three

times with 7H9-ADC media. After the third wash, the ﬁnal pellets were resuspended with 8 mL of 7H9-ADC. CFU dilutions were pre-

pared in 7H9-ADC media using 2 mL screw cap tubes (Fisher Scientiﬁc, Hampton, NH, USA). In between dilutions, screw-cap tubes

Cell Chemical Biology 27, 1–14.e1–e11, January 16, 2020 e5

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

were vortexed and culture was pipetted vigorously to ensure recovery of cells. Dilutions were plated on 7H11-ADC agar plates and

ꢂ

were incubated in a 37 C incubator for two - three weeks until colonies were visible. After visible growth, the colonies were counted

and the CFU/mL for each test condition was determined.

Mouse Pharmacokinetics (PK) Studies

In the 5 h PK studies, two female CD-1 mice received a single dose of experimental compound administered orally at 25 mg/kg in 5%

2

DMA/60% PEG300/35% D5W (5% dextrose in water), and blood samples were collected in K EDTA coated tubes pre-dose, 0.5, 1, 3

and 5 h post-dose. In iv/po PK studies, groups of three female CD-1 mice received a single dose of experimental compound admin-

istered orally at 25 mg/kg in 0.5% CMC/0.5% Tween 80 suspension, or intravenously at 5 mg/kg in 5% DMA/95% (4 % Cremophor

EL). Blood samples were collected in K

2

EDTA coated tubes typically 0.25, 0.5, 1, 3, 5 and 8 h post-dose in the oral arm, and typically

0

.033, 0.25, 0.5, 1 and 3 h post dose in the intravenous arm. Blood was kept on ice and centrifuged to recover plasma, which was

ꢂ

stored at -80 C until analyzed by HPLC coupled to tandem mass spectrometry (LC-MS/MS). LC/MS-MS quantitative analysis for all

molecules was performed on a Sciex Applied Biosystems Qtrap 4000 triple-quadrupole mass spectrometer coupled to an Agilent

1

260 HPLC system, and chromatography was performed on an Agilent Zorbax SB-C8 column (2.1x30 mm; particle size, 3.5 mm)

using a reverse phase gradient elution. Milli-Q deionized water with 0.1% formic acid (A) was used for the aqueous mobile phase

and 0.1% formic acid in acetonitrile (B) for the organic mobile phase. The gradient was: 5-90% B over 2 min, 1 min at 90% B, followed

by an immediate drop to 5% B and 1 min at 5% B. Multiple-reaction monitoring of parent/daughter transitions in electrospray pos-

itive-ionization mode was used to quantify all molecules. Sample analysis was accepted if the concentrations of the quality control

samples and standards were within 20% of the nominal concentration. Data processing was performed using Analyst software

(

Version 1.6.2; Applied Biosystems Sciex). Neat 1 mg/mL DMSO stocks for all compounds were ﬁrst serial diluted in 50/50 acetoni-

trile/water and subsequently serial diluted in drug free CD-1 mouse plasma (K EDTA, Bioreclamation IVT, NY) to create standard

2

curves (linear regression with 1/x^2 weighting) and quality control (QC) spiking solutions. 20 mL of standards, QCs, control plasma,

and study samples were extracted by adding 200 mL of acetonitrile/methanol 50/50 protein precipitation solvent containing the in-

ternal standard (10 ng/mL verapamil). Extracts were vortexed for 5 min and centrifuged at 4000 rpm for 5 min. 100 mL of supernatant

was transferred for HPLC-MS/MS analysis and diluted with 100 mL of Milli-Q deionized water. Mouse lungs were homogenized by

adding 4 parts PBS buffer:1 part tissue and shaking the diluted samples using a SPEX Sample Prep Geno/Grinder 2010 for 5 min

at 1500 rpm with steel beads. Mouse lung homogenates were processed and treated the same as plasma for compound

quantiﬁcation.

Mouse Acute Infection Model and Antibacterial Treatment

All mouse infection and treatment experiments were approved by the Rutgers University Institutional Animal Care and Use commit-

tee. A well-established low dose aerosol infection using a Glas-Col Inhalation Exposure System was utilized to infect inbred female

Balb/C mice (19-20 g) with approximately 50-100 bacilli/mouse with M. tuberculosis strain H37Rv strain (Chaudhuri et al., 2018; Lan-

oix et al., 2016). At 3 h post exposure, 4 mice were humanely euthanized and lungs aseptically removed for bacterial enumeration to

verify infection dose. After 14 d, 4 additional mice were humanely euthanized and lungs assessed for bacterial burdens to verify acute

phase of M. tuberculosis infection. The remaining mice were randomized into groups consisting of 12 mice that were given single

daily oral doses of vehicle (0.5% CMC/0.5% Tween-80), JSF-2513 at 200 and 60 mg/kg or INH at 25 mg/kg via oral gavage. Lungs

and spleens were aseptically removed and bacterial burdens were assessed via viable counts on Middlebrook 7H11 agar supple-

mented with OADC on days 28 and 42 to assess treatment efﬁcacy relative to the vehicle controls. For statistical analysis, the

CFUs were converted to logarithms, and evaluated by a one-way ANOVA followed by a multiple comparison analysis of variance

by Tukey and/or Dunnett’s test (GraphPad Prism software program version 6.0). Differences were considered signiﬁcant at the

9

5% level of conﬁdence.

Determination of InhA Percent Inhibition and IC50

Enzyme kinetics, following a published procedure (Sivaraman et al., 2003; Stec et al., 2014), were determined in 150 mM NaCl and

PIPES buffer at pH 6.8 with a Shimadzu UV-2500 UV-visible spectrophotometer. NADH (20 mM), InhA (20 nM, expressed and puriﬁed

following a literature protocol (Rawat et al., 2003)) and inhibitor (different concentrations dissolved in DMSO) were mixed and incu-

bated for 5 min before the addition of trans-2-dodecenoyl-CoA (prepared from trans-2-dodecenoic acid, via a mixed anhydride

ꢂ

method as described by Parikh (Parikh et al., 1999)) to initiate the reaction. Assays were followed spectrophotometrically at 25 C,

+

tracking the consumption of NADH, to form NAD . For the determination of a molecule’s percent inhibition of InhA catalytic activity,

the inhibitor concentration was chosen to be 50 mM. For an IC50 determination, inhibitor concentrations were varied from 10 nM to

+

1

00 mM as described earlier (Freundlich et al., 2009). Equation 5 was utilized to determine the NAD production curve where NNAD+

+

was the NAD concentration, A

0 t

and A were the 340 nm absorbance at time t and time 0, and CNADH was the initial NADH

concentration.

A

0

ꢁ A

t

N

NAD +

=

3 CNADH

(Equation 5)

A

0

The InhA percent inhibition and/or IC50 for each inhibitor were calculated with Prism GraphPad version 6.0, and reported as the

mean ± standard error.

e6 Cell Chemical Biology 27, 1–14.e1–e11, January 16, 2020

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

Thin-Layer Chromatography (TLC) Analysis of Fatty Acids and Mycolic Acids

ꢂ

Mid-log phase M. tuberculosis (OD595 = 0.3) incubated at 37 C were pre-treated by compounds at different fold MIC for 8 h (5 mL

14

culture per compound treatment) in 7H9+ADS media, and 1 mCi/mL of C-acetate (56 mCi/mmol) was added to each culture. After

1

4

6 h of C-acetate labeling, bacteria were harvested and washed with PBS. Bacterial lipids were hydrolyzed by incubation of the

1

bacterial pellet with 2 mL tetra-n-butylammonium hydroxide (TBAH) at 100 C overnight. Fatty acids and mycolic acids were esteriﬁed

ꢂ

by adding 4 mL CH

FAMEs) and mycolic acid methyl esters (MAMEs). After centrifugation (1500 rpm, 10 min), the upper phase was discarded, and sam-

ples were washed twice with ddH O. The lower phase was dried with a stream of air overnight, and FAMEs/MAMEs were extracted

by resuspending the pellet with 3 mL diethyl ether and transferring the supernatant to new collection tubes after centrifugation

1500 rpm, 10 min). After drying the organic phase with a stream of air, the lipids were resuspended in 200 mL CH Cl , and equal

2 2 3 2

Cl , 300 mL CH I and 2 mL distilled water (ddH O) and mixing at rt for 1 h to generate fatty acid methyl esters

(

2

(

2

counts (50,000 cpm) were loaded on a silica gel 60 F254 thin-layer chromatography (TLC) plate and resolved using hexane/ethyl

acetate (19:1, v/v, 2 runs). The FAMEs and MAMEs were detected by Typhoon 9400 storage phosphoimager (GE Health Sciences).

Reduction of JSF-2019 to JSF-2026

To a solution of JSF-2019 (5.0 mg, 0.012 mmol) in methanol (1.0 mL) was added sodium borohydride (4.0 mg, 0.11 mmol). The

mixture was stirred at room temperature for 1 h. The reaction was monitored by LC/MS, which showed the formation of JSF-

2026 by comparison with the ion extraction spectra (positive ion m/z 370.0) of independently synthesized JSF-2026 and via co-in-

jection of the reaction mixture with this synthesized JSF-2026.

Synthetic Chemistry Methods

All reaction reagents were obtained from Sigma-Aldrich, Acros, Alfa Aesar, Tokyo Chemical Industry (TCI), or Fisher Scientiﬁc. The

reaction solvents were purchased from either Sigma-Aldrich, Fisher Scientiﬁc, or Acros. Whenever necessary, reactions were per-

formed under a nitrogen atmosphere and anhydrous solvents were used. Microwave reactions were performed in a CEM Discover

microwave reactor. NMR spectra of the synthesized compounds were recorded on an Avance 500 MHz spectrometer from the

Bruker Corporation (Billerica, MA, USA). Reverse-phase high performance liquid chromatography (HPLC) and electrospray ionization

(

ESI) mass spectra were obtained on an Agilent 6120 single quadrupole LC/MS system using a reverse-phase EMD Millipore Chro-

molith SpeedRod RP-18e column (50 3 4.6 mm). In general, a 10 - 100% gradient of acetonitrile/water containing 0.1% formic acid

was used for the analysis of the samples. All compounds were puriﬁed to R95% peak area (i.e., purity) via an HPLC UV trace at

2

20 nm or 250 nm with observation of a low-resolution MS m/z consistent with each compound. Puriﬁcation of samples by ﬂash chro-

matography was performed on a Teledyne ISCO CombiFlash Rf+ system using a Teledyne RediSep normal phase silica gel column.

For TLC, aluminum plates coated by silica gel 60 with F254 ﬂuorescent indicator from EMD Millipore were used. Preparative reverse-

phase HPLC was performed on a Varian (now Agilent) SD-1 preparative HPLC system equipped with an Agilent Pursuit (10 mm, 250 x

2

1.2 mm) C-18 column with detection UV wavelength set at 220 nm or 250 nm. A gradient of acetonitrile in water at a ﬂow rate of

0 mL/min was used for the separation.

Synthesis of Differentially Substituted Furans

JSF-2026

6

-hydrazineyl-N2,N4-diphenyl-1,3,5-triazine-2,4-diamine (Ekins et al., 2013) (336 mg, 1.14 mmol) was dissolved in methanol

6.0 mL). Furfural (1.59 equiv, 1.81 mmol, 0.150 mL) was added to the reaction mixture, which was then stirred at room temperature

overnight. The solvent was removed in vacuo and the crude material was subjected to ﬂash column chromatography over silica gel to

(

1

6

afford JSF-2126 as an off-white solid (169 mg, 0.456 mmol, 40.0% yield): H NMR (500 MHz, d -DMSO) d10.9 (s, 1), 9.30 (br s , 1),

8

.14 (s, 1), 7.81 (m, 5), 7.27 (m, 5), 6.97 (t, J = 10 Hz), 2), 6.76 (d, J = 5 Hz, 1), 6.60 (s, 1).

By a similar synthetic route the following were prepared:

1

JSF-2389: H NMR (500 MHz, d

.00 (s), 1.93 (s), 1.24 (m), 1.19 (t), 0.96 – 0.78 (m).

6

-DMSO)d11.6 (s, 1), 9.79 (br m, 2), 8.18 (s, 1), 7.81 (s, 4), 7.34 (m, 5), 7.13 – 7.00 (m, 3). Also noted

2

0

1

JSF-2390: H NMR (500 MHz, d

.93 – 0.76 (m).

6

-DMSO)d11.6 (s, 1), 9.80 (s, 2), 8.17 (s, 1), 7.78 (m, 5), 7.33 (s, 4), 7.08 (m, 3). Also noted 1.24 (s),

1

JSF-4328: H NMR (500 MHz, d

6

-DMSO)d10.9 (s, 1), 9.60 (br s, 1), 8.03 (s, 1), 7.81 (s, 1), 7.76 (br s, 2), 7.27 (t, J = 7.9 Hz, 2), 6.95 (t,

J = 7.3 Hz, 1), 6.77 (d, J = 3.3 Hz, 1), 6.61 (dd, J = 3.2, 1.7 Hz, 1), 3.77 – 3.72 (m, 4), 3.68 – 3.62 (m, 4).

Syntheses of Differentially Linked Triazines

JSF-2111

6

-hydrazineyl-N2,N4-diphenyl-1,3,5-triazine-2,4-diamine (120 mg, 0.409 mmol) (Ekins et al., 2013) was dissolved in dichloromethane

7.0 mL). 1 N NaOH aq. (1.0 equiv, 0.410 mmol, 0.410 mL) and 5-nitrofurfuryl chloride (1.0 equiv, 0.410 mmol, 72.0 mg) were added to

(

the reaction mixture, which was then stirred for 3 h. The resulting mixture was extracted with ethyl acetate (100 mL). The organic

phase was washed with saturated aqueous brine solution (50 mL). After drying over anhydrous sodium sulfate, the organics were

concentrated in vacuo and puriﬁed by ﬂash column chromatography on silica gel, eluting with 0-50% ethyl acetate/hexanes, to afford

1

JSF-2111 as a brown solid (41.0 mg, 0.0948 mmol, 23.2% yield): H NMR (500 MHz, DMSO-d

6

) d 10.8 (s, 1), 9.44-9.18 (m, 2), 7.99-

7

.54 (m, 5), 7.28 (s, 2), 6.99 (t, J=52.1 Hz, 3), 2.88 (s, 1), 2.72 (s, 1), 1.22 (s, 1).

Cell Chemical Biology 27, 1–14.e1–e11, January 16, 2020 e7

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

JSF-2113

The mixture of 5-nitrofuran-2-carbaldehyde (444 mg, 3.15 mmol) and tert-butyl 1-methylhydrazine-1-carboxylate (1.01 equiv,

ꢂ

3

.18 mmol, 0.470 mL) in acetonitrile (1.0 mL) was heated at 120 C in a microwave reactor for 10 min. Then the mixture was heated

ꢂ

at 170 C for 2 h. The resulting mixture was extracted with ethyl acetate (200 mL). The organic phase was washed with saturated

aqueous brine solution (50 mL), dried over anhydrous sodium sulfate, concentrated in vacuo, and puriﬁed by ﬂash column chroma-

tography on silica gel, eluting with 0-30% ethyl acetate/dichloromethane, to afford (E)-1-methyl-2-((5-nitrofuran-2-yl)methylene)hy-

drazine as a red solid (300 mg, 1.77 mmol, 56.2% yield). In keeping with our standard practices, this intermediate was characterized

by R95% purity via HPLC and the expected parent ion via MS.

(E)-1-methyl-2-((5-nitrofuran-2-yl)methylene)hydrazine (169 mg, 1.00 mmol) was dissolved in acetonitrile (2.0 mL). Cyanuric chlo-

ride (1.0 equiv, 1.00 mmol, 185 mg) and N,N-diisopropylethylamine (2.0 equiv, 2.00 mmol, 0.348 mL) were added to the mixture at

ꢂ

0

C, which was then stirred at room temperature for 30 min. Aniline (2.0 equiv, 2.00 mmol, 0.182 mL) and N,N-diisopropylethylamine

ꢂ

(2.0 equiv, 2.00 mmol, 0.348 mL) were added to the mixture, which was then heated at 120 C for 40 min. The resulting mixture was

extracted with ethyl acetate (80 mL). The organic phase was washed with saturated aqueous brine solution (20 mL). After drying over

anhydrous sodium sulfate, the organic solution was concentrated in vacuo and puriﬁed by ﬂash column chromatography on silica gel,

1

eluting with 0-30% ethyl acetate/ dichloromethane, to afford JSF-2113 as a brown solid (128 mg, 0.298 mmol, 29.8% yield): H NMR

(

500 MHz, CDCl

.27 (s, 2).

JSF-2114

3

) d 7.72 – 7.59 (m, 5), 7.43 (d, J = 3.7 Hz, 1), 7.41 – 7.35 (m, 4), 7.13 (t, J = 7.3 Hz, 2), 7.01 (d, J = 3.2 Hz, 1), 3.68 (s, 3),

1

To a mixture of tert-butyl 1-methylhydrazine-1-carboxylate (0.296 mL, 2.00 mmol) in acetonitrile (10.0 mL) was added N,N-diisopro-

pylethylamine (1.0 equiv, 2.00 mmol, 0.348 mL) and 5-nitrofurfuryl chloride (1.0 equiv, 2.00 mmol, 351 mg). The mixture was stirred at

room temperature for 3 h. The resulting mixture was extracted with ethyl acetate (60 mL). The organic phase was washed with water

(

3 x 10 mL) and saturated aqueous brine solution (10 mL). After drying over anhydrous sodium sulfate, the solvent was removed in

vacuo and the crude material was dissolved in dichloromethane (1 mL). Triﬂuoroacetic acid (1.0 mL) was added to the mixture, which

was then stirred at room temperature for 1 h. The solvent was removed in vacuo and the crude material was subjected to ﬂash column

chromatography, eluting with 0-100% ethyl acetate/dichloromethane, over silica gel to afford N’-methyl-5-nitrofuran-2-carbohydra-

zide as a yellow solid (290 mg, 1.57 mmol, 78.5% yield). In keeping with our standard practices, this intermediate was characterized

by R95% purity via HPLC and the expected parent ion via MS.

N’-methyl-5-nitrofuran-2-carbohydrazide (50.0 mg, 0.270 mmol) was dissolved in acetonitrile (1.0 mL). Cyanuric chloride (1.0

equiv, 0.270 mmol, 49.8 mg) and N,N-diisopropylethylamine (1.0 equiv, 0.270 mmol, 0.0470 mL) were added to the mixture at

ꢂ

0

C, which was then stirred at room temperature for 1 h. Aniline (2.0 equiv, 0.542 mmol, 0.0490 mL) and N,N-diisopropylethylamine

ꢂ

(2.0 equiv, 0.540 mmol, 0.0940 mL) were added to the mixture, which was then heated at 50 C for 1 h. The resulting mixture was

extracted with ethyl acetate (80 mL). The organic phase was washed with saturated aqueous brine solution (20 mL). After drying

over anhydrous sodium sulfate, the organic solution was concentrated in vacuo and puriﬁed by ﬂash column chromatography on

silica gel, eluting with 0-30% ethyl acetate/ dichloromethane, to afford JSF-2114 as a brown solid (24.0 mg, 0.0538 mmol, 19.9%

1

yield). H NMR (500 MHz, CDCl

3

) d 8.76 (s, 1), 7.90 – 6.73 (m, 14), 3.51 (s, 3).

JSF-2116

JSF-2113 (20.0 mg, 0.0465 mmol) was dissolved in acetonitrile (1.0 mL). Sodium cyanoborohydride (3.42 equiv, 10.0 mg,

.159 mmol) and acetic acid (0.200 mL) were added to the mixture, which was then stirred at room temperature overnight. The solvent

was removed in vacuo and the crude material was subjected to ﬂash column chromatography over silica gel, eluting with 0-30% ethyl

0

1

acetate/dichloromethane, to afford JSF-2116 as a brown solid (4.6 mg, 0.011 mmol, 23% yield): H NMR (500 MHz, CDCl

J = 7.8 Hz, 4), 7.38 – 7.30 (m, 5), 7.25 (d, J = 3.6 Hz, 1), 7.12 (t, J = 7.4 Hz, 2), 4.18 (s, 2), 3.32 (s, 3), 2.12 (s, 1).

JSF-2118

3

) d 7.56 (d,

6

-chloro-N2,N4-diphenyl-1,3,5-triazine-2,4-diamine (91.0 mg, 0.306 mmol) was dissolved in acetonitrile (1.50 mL), to which was

added N,N-diisopropylethylamine (1.01 equiv, 0.310 mmol, 0.0539 mL) and tert-butyl 1-methylhydrazine-1-carboxylate (1.01 equiv,

.310 mmol, 45.3 mg). The mixture was stirred at room temperature overnight. The solvent was removed in vacuo and the crude ma-

0

terial was subjected to ﬂash column chromatography over silica gel to afford tert-butyl 2-(4,6-bis(phenylamino)-1,3,5-triazin-2-yl)-1-

methylhydrazine-1-carboxylate as a colorless liquid (112 mg, 0.275 mmol, 89.9% yield). In keeping with our standard practices, this

intermediate was characterized by R95% purity via HPLC and the expected parent ion via MS.

tert-butyl 2-(4,6-bis(phenylamino)-1,3,5-triazin-2-yl)-1-methylhydrazine-1-carboxylate (90.0 mg, 0.221 mmol, 1.00 equiv.) was dis-

solved in dichloromethane (1.00 mL), to which was added triﬂuoroacetic acid (0.500 mL, 6.53 mmol, 29.5 equiv). The mixture was

stirred at room temperature for 1 hour. The solvent was removed in vacuo and the crude material was subjected to ﬂash column chro-

matography over silica gel, eluting with 0-5% methanol/ dichloromethane, to afford 6-(2-methylhydrazineyl)-N2, N4-diphenyl-1,3,5-

triazine-2,4-diamine as a light-yellow liquid (110 mg, 0.221 mmol, >99% yield). In keeping with our standard practices, this interme-

diate was characterized by R95% purity via HPLC and the expected parent ion via MS.

6

-(2-methylhydrazineyl)-N2,N4-diphenyl-1,3,5-triazine-2,4-diamine (50.0 mg, 0.100 mmol, 1.00 equiv.) was dissolved in dichloro-

methane (1.00 mL), to which was added 5-nitro-2-furoic acid (35.6 mg, 0.136 mmol, 1.36 equiv), EDC (31.1 mg, 0.163 mmol, 1.63

equiv) and DMAP (20.0 mg, 0.163 mmol, 1.63 equiv). The mixture was stirred at room temperature for 1.5 hour. The resulting mixture

was extracted with ethyl acetate (100 mL). The organic phase was washed with water (20.0 mL), then saturated aqueous brine so-

lution (20.0 mL). After drying over anhydrous sodium sulfate, the organic solution was concentrated and puriﬁed by ﬂash column

e8 Cell Chemical Biology 27, 1–14.e1–e11, January 16, 2020

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

chromatography on silica gel, eluting with 0-4% methanol/ dichloromethane, to afford JSF-2118 as a brown solid (17.0 mg,

0

1

.0381 mmol, 38% yield): H NMR (500 MHz, CDCl3) d 7.78 – 7.00 (m, 12), 5.09 (br s, 2), 3.38 (s, 3).

Synthesis of Dialkylaminotriazines

JSF-2189

4

,4’-(6-chloro-1,3,5-triazine-2,4-diyl)dimorpholine: Cyanuric chloride (900 mg, 4.88 mmol) in 25 mL dry acetonitrile under N

ꢂ

2

was

cooled to 0 C in an ice bath. To this solution, a mixture of morpholine (932 mg, 10.7 mmol) and N,N-di-isopropylethylamine

1.70 mL, 9.76 mmol) was added dropwise over the period of 10 min. The reaction slowly increased turbidity until turning to a paste.

(

At that time the reaction was slowly warmed to rt. The reaction was continued to stir overnight at rt and then concentrated in vacuo to

a crude oil. The reaction mixture was puriﬁed by ﬂash column chromatography using 0 – 50% gradient of EtOAc in hexanes to give-

the title compound as a white solid (1.24 g, 89.0%). In keeping with our standard practices, this intermediate was characterized

by R95% purity via HPLC and the expected parent ion via MS.

4

,4’-(6-hydrazineyl-1,3,5-triazine-2,4-diyl)dimorpholine

To 4,4’-(6-chloro-1,3,5-triazine-2,4-diyl)dimorpholine (1.24 g, 4.34 mmol) in dry DMSO was added hydrazine monohydrate

0.842 mL, 17.4 mmol) in one portion and the reaction stirred at rt for 24 h. The reaction was slowly added to ice cold water and

the crude precipitate was collected by ﬁltration. The crude solid was washed with acetonitrile and dichloromethane to give

62 mg white solid (62.4%). In keeping with our standard practices, this intermediate was characterized by R95% purity via

HPLC and the expected parent ion via MS.

E)-4,4’-(6-(2-((5-nitrofuran-2-yl)methylene)hydrazineyl)-1,3,5-triazine-2,4-diyl)dimorpholine

(

7

(

To a solution of 4,4’-(6-hydrazineyl-1,3,5-triazine-2,4-diyl)dimorpholine (400 mg, 1.42 mmol) in 20 mL methanol was added 5-nitro-2-

furaldehyde (210 mg, 1.49 mmol) and stirred overnight at rt. The reaction mixture was concentrated in vacuo and the crude product

puriﬁed by ﬂash column chromatography using a 0 - 35% gradient of acetone in dichloromethane to give the product as a crude yel-

low solid. A portion of the crude product (80 mg) was puriﬁed by RP-HPLC using a gradient of 30 - 75% acetonitrile in water to give

1

6 mg yellow solid: H NMR (500 MHz, d

3

6

-DMSO) d 11.3 (s, 1), 8.04 (s, 1), 7.78 (d, J = 3.9 Hz, 1), 7.11 (d, J = 3.9 Hz, 1), 3.72 (s, 8), 3.63

(

d, J = 4.5 Hz, 8).

By a similar synthetic route the following were prepared:

1

JSF-2343: H NMR (500 MHz, d

6

-DMSO) d 11.3 (s, 1), 8.04 (s, 1), 7.78 (d, J = 3.8 Hz, 1), 7.11 (d, J = 3.6 Hz, 1), 4.03 (br s, 8), 2.62 (s,

O), 2.0 (s, EtOAc), 1.1 (t, EtOAc).

-DMSO) d 11.1 (s, 1), 8.05 (s, 1), 7.78 (d, J = 4.0 Hz, 1), 7.14 (s, 1), 7.04 (s, 1), 6.83 (d, J = 7.6 Hz, 1),

.79-3.64 (m, 2), 1.92-1.67 (m, 8), 1.63-1.54 (m, 2), 1.30-1.18 (m, 7), 1.15-1.06 (m, 2). One H was unaccounted for in the aliphatic re-

O), 2.1 (s, acetone), 1.15 (s).

-DMSO) d 11.0 (d, J = 42.5 Hz, 1), 8.02 (d, J = 18.4 Hz, 1), 7.77 (d, J = 3.9 Hz, 1), 7.32 (br s, 1), 7.10 –

.92 (comp, 2), 3.05 (t, J = 6.2 Hz, 4), 1.90 – 1.77 (m, 2), 0.86 (d, J = 6.7 Hz, 12). Also noted 3.3 (s, H O).

-DMSO) d 11.3 (s, 1), 8.08 (s, 1), 7.78 (d, J = 3.8 Hz, 1), 7.53 (s, 1), 7.29 (s, 1), 7.06 (d, J = 3.2 Hz, 1),

8

). Also noted 5.7 (s, DCM), 4.1 (q, EtOAc), 3.3 (s, H

2

1

JSF-2380: H NMR (500 MHz, d

6

3

gion. Also noted 10.9 (br s), 4.56 (s), 3.33 (s, H

2

1

JSF-2356: H NMR (500 MHz, d

6

2

1

JSF-2377: H NMR (500 MHz, d

6

2

2 2 2

.78 (m, 2), 0.68 (m, 4), 0.52 (m, 4). Also noted 5.77 (s, CH Cl ), 5.03 (s), 4.03 (q, EtOAc), 3.3 (s, H O), 2.1 (s, acetone), 2.0 (s, EtOAc),

1

.25 (s), 1.19 (t, EtOAc).

1

JSF-2378: H NMR (500 MHz, d

m, 2), 2.25-2.12 (m, 4), 2.04-1.91 (m, 4), 1.69-1.51 (m, 4). Also noted 11.0 (br s), 5.77 (s, DCM), 5.03 (s), 4.03 (q, EtOAc), 3.33 (s, H

6

-DMSO) d 11.1 (s, 1), 8.04 (s, 1), 7.78 (d, J = 4.0 Hz, 1), 7.67 (s, 1), 7.32 (s, 1), 7.07 (s, 1), 4.46-4.33

O),

(

2

.1 (s, acetone), 1.25 (s), 1.19 (t, EtOAc), 1.15 (s).

1

JSF-2379: H NMR (500 MHz, d

.20 (m, 2), 1.92-1.79 (br m, 4), 1.73-1.61 (br m, 4), 1.56-1.42 (br m, 8). Also noted 10.9 (s), 5.03 (s), 4.56 (s), 3.33 (s, H

6

-DMSO) d 11.1 (s, 1), 8.05 (s, 1), 7.78 (d, J = 3.9 Hz, 1), 7.29 (s, 1), 7.05 (d, J = 2.4 Hz, 1), 6.97 (s, 1),

O) 2.12 (s,

4

2

acetone), 1.25 (s), 1.15 (s).

1

JSF-2404: H NMR (500 MHz, d

6

-DMSO) d 11.1 (s, 0.7), 10.9 (s, 0.3), 8.05 (s, 1), 7.78 (d, J = 3.9 Hz, 1), 7.39-7.31 (br s, 1), 7.08-7.00

(

br m, 2), 4.00-3.91 (br m, 2), 3.87 (d, J = 10.3 Hz, 4), 3.38-3.28 (br m, 4), 1.84-1.71 (m, 4), 1.56-1.46 (m, 4). Noted that the broad multi-

plet at 3.38-3.28 ppm overlaps with the water signal. Also noted 5.7 (s, DCM) 3.33 (s, H O), 1.24 (s), 0.84 (m).

-DMSO) d 11.2 (s, 0.7), 11.0 (s, 0.3), 8.05 (s, 1), 7.78 (d, J = 4.0 Hz, 1), 7.33-7.24 (br s, 1), 7.06 (d, J =

.6 Hz, 1), 6.98 (d, J = 7.9 Hz, 1), 3.94-3.80 (br m, 4), 3.75 (d, J = 10.3 Hz, 2), 3.27-3.17 (br m, 2), 3.12-2.99 (br m, 2), 1.95-1.86 (br s, 2),

.73-1.64 (m, 2), 1.58-1.47 (m, 4). Also noted 5.78 (s, DCM) 3.33 (s, H O), 1.24 (s), 0.84 (m).

-DMSO) d 11.2 (s, 1), 8.04 (s, 1), 7.77 (d, J = 3.9 Hz, 1), 7.06 (d, J = 3.9 Hz, 1), 5.00 (d, J = 60.4 Hz, 2),

2

1

JSF-2405: H NMR (500 MHz, d

6

3

1

2

1

JSF-2407: H NMR (500 MHz, d

6

2

1

2

.91 (d, J = 16.1 Hz, 7), 1.12 (d, J = 6.7 Hz, 15). Integrations for methyl groups were a bit high (by 1 and 3 H). Also noted 3.3 (s, H O),

.23 (s), 0.85 (s).

1

JSF-2511: H NMR (500 MHz, d

6

-DMSO) d 11.0 (d, J = 73.4 Hz, 1), 8.03 (d, J = 13.8 Hz, 1), 7.77 (d, J = 3.8 Hz, 1), 7.30 (br s, 1), 7.17

O peak, proposed 4), 2.67-2.36 (m underneath DMSO solvent peak, proposed 2),

.06 – 1.91 (m, 4), 1.91 – 1.79 (m, 4), 1.79 – 1.58 (m, 4). Also noted 1.24 (s).

(

s, 1), 7.04 (s, 1), 3.31 – 3.21 (m overlapped with H

2

1

JSF-2514: H NMR (500 MHz, d

6

-DMSO) d 11.2 (d, J = 29.7 Hz, 1), 8.22 (br s, 1), 8.05 (s, 1), 7.82 (s, 1), 7.78 (d, J = 3.7 Hz, 1), 7.08

O).

6

-DMSO) d 12.2 (br s, 1), 8.14 (s, 1), 7.81 (d, J = 3.0 Hz, 1), 7.25 (s, 1), 4.15 (br s, 8), 2.32 (br s, 4).

(

s, 1), 5.00 – 4.92 (m, 1), 4.92 – 4.83 (m, 1), 4.73 (t, 4), 4.52 (t, J = 5.9 Hz, 4). Also noted 5.79 (s, DCM), 3.33 (s, H

2

1

JSF-2589: H NMR (500 MHz, d

Cell Chemical Biology 27, 1–14.e1–e11, January 16, 2020 e9

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

1

JSF-2592: H NMR (500 MHz, d

6

-DMSO) d 11.1 (d, J = 96.6 Hz, 1), 8.05 (s, 1), 7.84 (br s, 1), 7.78 (d, J = 3.6 Hz, 1), 7.49 (s, 1), 7.07 (s,

1

2

), 5.27 (d, J = 57.2 Hz, 2), 4.71 – 4.56 (m, 2), 2.75 – 2.25 (br m, NMR solvent + 8). Also noted 5.7 (s, DCM), 3.31 (s, H O), 1.24 (br s),

0

.86 (m).

1

JSF-2594: H NMR (500 MHz, DMSO) d 11.2 (s, 1), 8.06 (s, 1), 7.77 (s, 1), 7.00 (s, 1), 5.03 – 4.61 (br s, 4), 2.85 – 2.58 (br s, 8), 2.19 –

2

.01 (br s, 8), 1.92 – 1.75 (br s, 4), 1.75 – 1.57 (m, 4). Also noted 3.33 (s, H O).

Synthesis of mono(amine)mono(morpholine)triazines

JSF-2513

tert-butyl 2-(4,6-dichloro-1,3,5-triazin-2-yl)hydrazine-1-carboxylate. Cyanuric chloride (5.00 g, 27.1 mmol) dissolved in 100 mL dry

ꢂ

ACN was cooled to -15 C in a salt/ice bath. To this solution, tert-butyl carbazate (3.77 g, 27.1 mmol) in 10 mL dry ACN was added

ꢂ

dropwise over a period of 10 min. The reaction temperature was kept under -5 C during the addition and then slowly warmed to rt as

the turbidity of the reaction increased after the addition. The reaction was continued to stir overnight at rt and then concentrated in

vacuo. The crude product was dissolved in 150 mL EtOAc and washed with water and saturated aqueous brine solution. The organic

2 4

layer was dried over anhydrous Na SO and concentrated in vacuo to give 6.60 g white solid (87%). In keeping with our standard

practices, this intermediate was characterized by R95% purity via HPLC and the expected parent ion via MS.

tert-butyl 2-(4-chloro-6-(phenylamino)-1,3,5-triazin-2-yl)hydrazine-1-carboxylate. A suspension of tert-butyl 2-(4,6-dichloro-1,3,5-

triazin-2-yl)hydrazine-1-carboxylate (1.00 g, 3.57 mmol) in dry THF was added N,N-di-isopropylethylamine (0.746 mL, 4.28 mmol)

and aniline (0.343 mL, 3.75 mmol). The reaction was stirred at rt overnight and then concentrated in vacuo. The reaction mixture

was suspended in 100 mL EtOAc and washed with saturated aqueous NH

4

Cl and saturated aqueous brine solution. The organic frac-

tion was dried over anhydrous Na SO and concentrated in vacuo to give the product as a white solid (1.19 g, 99%). In keeping with

2

4

our standard practices, this intermediate was characterized by R95% purity via HPLC and the expected parent ion via MS.

tert-butyl 2-(4-morpholino-6-(phenylamino)-1,3,5-triazin-2-yl)hydrazine-1-carboxylate. Tert-butyl 2-(4-chloro-6-(phenylamino)-

1

,3,5-triazin-2-yl)hydrazine-1-carboxylate (200 mg, 0.594 mmol) in 3 mL dry acetonitrile was added N,N-di-isopropylethylamine

0.114 mL, 0.653 mmol), followed by morpholine (54 mL, 0.62 mmol). The reaction was stirred at rt for 24 h and concentrated in vacuo.

The crude product was suspended in EtOAc and washed with saturated aqueous NH Cl and saturated aqueous brine solution. The

organic layer was dried over Na SO and puriﬁed by ﬂash column chromatography using a gradient of 0 – 50% EtOAc in hexanes to

(

4

2

4

give the title compound as a white solid (186 mg, 80.9%). In keeping with our standard practices, this intermediate was characterized

by R95% purity via HPLC and the expected parent ion via MS.

(E)-4-morpholino-6-(2-((5-nitrofuran-2-yl)methylene)hydrazineyl)-N-phenyl-1,3,5-triazin-2-amine. Acetyl chloride (92 mL, 1.3 mmol)

was added dropwise to 4 mL methanol while cooling in an ice bath. The solution was warmed to rt upon addition of acetyl chloride and

continued to stir for 5 min at rt. Tert-butyl 2-(4-morpholino-6-(phenylamino)-1,3,5-triazin-2-yl)hydrazine-1-carboxylate (100 mg,

ꢂ

0

.268 mmol) was dissolved in this MeOH solution and stirred for 4 h at 50 C. The Boc-deprotected product was obtained as a white

solid upon concentration in vacuo and was then dissolved in 5 mL methanol and 5-nitro-2-furaldehyde (51 mg, 0.29 mmol) was

added. The reaction was stirred overnight at rt and concentrated in vacuo. The crude mixture was diluted with EtOAc and washed

with saturated aqueous NaHCO

3 2 4

solution. The crude product was dried over anhydrous Na SO and puriﬁed by ﬂash column

chromatography using a gradient of 0 – 10% methanol in dichloromethane to give the product as a dark yellow solid (93 mg,

1

6%): H NMR (500 MHz, d

8

6

-DMSO) d 11.4 (s, 1), 9.65 (s, 1), 8.09 (s, 1), 7.80 (d, J = 3.8 Hz, 3), 7.30 (t, J = 7.6 Hz, 2), 7.13 (d, J =

3

.8 Hz, 1), 6.98 (t, J = 7.2 Hz, 1), 3.86 – 3.57 (m, 8).

JSF-2619

tert-butyl 2-(4-(azetidin-1-yl)-6-morpholino-1,3,5-triazin-2-yl)hydrazine-1-carboxylate. To a suspension of tert-butyl 2-(4-chloro-6-

morpholino-1,3,5-triazin-2-yl)hydrazine-1-carboxylate (83 mg, 0.25 mmol) in 3 mL dry ACN was added DIEA (96 mL, 0.55 mmol) and

ꢂ

azetidine HCl (26 mg, 0.28 mmol). The reaction was stirred at 50 C overnight and then concentrated in vacuo. The reaction mixture

was suspended in 10 mL EtOAc and washed with saturated aqueous NH

4

Cl and saturated aqueous brine. The organic fraction was

dried over anhydrous Na SO and concentrated in vacuo. The product was puriﬁed by ﬂash column chromatography using a gradient

4

2

of 0 – 70% EtOAc in hexanes to give the title compound as a white solid (49 mg, 56%). In keeping with our standard practices, this

intermediate was characterized by R95% purity via HPLC and the expected parent ion via MS.

(E)-4-(4-(azetidin-1-yl)-6-(2-((5-nitrofuran-2-yl)methylene)hydrazineyl)-1,3,5-triazin-2-yl)morpholine. Acetyl chloride (40 mL, 0.56 mmol)

was added dropwise to 2 mL methanol with cooling in an ice bath. The solution was warmed to rt upon addition of AcCl and continued to

stir for 5 min at rt. Tert-butyl 2-(4-(azetidin-1-yl)-6-morpholino-1,3,5-triazin-2-yl)hydrazine-1-carboxylate (49 mg, 0.14 mmol) was dis-

ꢂ

solved in this MeOH solution and stirred for 4 h at 50 C. The Boc-deprotected product was obtained as a white solid upon concentration

in vacuo. Without further puriﬁcation, the crude product was dissolved in 2 mL methanol and 5-nitro-2-furaldehyde (23 mg, 0.16 mmol)

was added. The reaction was stirred overnight at rt and concentrated in vacuo. The crude mixture was dissolved in EtOAc and washed

with saturated aqueous NaHCO

tography using a gradient of 0 – 5% methanol in dichloromethane to give the product as a yellow solid (34 mg, 62%): H NMR (500 MHz,

-DMSO) d 11.3 (s, 1), 8.03 (s, 1), 7.77 (d, J = 3.9 Hz, 1), 7.09 (d, J = 4.0 Hz, 1), 4.02 (t, J = 6.8 Hz, 4), 3.78 – 3.66 (m, 4), 3.66 – 3.53 (m, 4),

.32 – 2.21 (m, 2).

JSF-2625

3 2 4

solution. The crude product was dried over anhydrous Na SO and puriﬁed by ﬂash column chroma-

1

d

6

2

4-hydrazineyl-N-(1-methylcyclopropyl)-6-morpholino-1,3,5-triazin-2-amine. To a solution of 4-(4,6-dichloro-1,3,5-triazin-2-yl)mor-

ꢂ

pholine (150 mg, 0.638 mmol) in dry acetonitrile at 0 C were added N,N-di-isopropylethylamine (122 mL, 0.702 mmol) and

e10 Cell Chemical Biology 27, 1–14.e1–e11, January 16, 2020

Please cite this article in press as: Wang et al., Antitubercular Triazines: Optimization and Intrabacterial Metabolism, Cell Chemical Biology (2019),

https://doi.org/10.1016/j.chembiol.2019.10.010

1

-methyl-cyclopropanamine HCl (69 mg, 0.638 mmol). The reaction was allowed to warm to rt and stirred overnight. The reaction

mixture was concentrated in vacuo and the residue was taken up in 25 mL EtOAc. The organic layer was washed with saturated

aqueous NH Cl and saturated aqueous brine solution. The organic layer was dried over anhydrous Na SO and concentrated in va-

4

2

4

cuo. The intermediate was obtained as crude white solid with >95% purity by LC/MS analysis. The crude solid was dissolved in 4 mL

methanol and hydrazine hydrate (123 mL, 2.55 mmol) was added in one portion. The reaction was stirred at rt for overnight and then

concentrated in vacuo. A white solid was obtained in quantitative yield (336 mg). In keeping with our standard practices, this inter-

mediate was characterized by R95% purity via HPLC and the expected parent ion via MS.

(

E)-N-(1-methylcyclopropyl)-4-morpholino-6-(2-((5-nitrofuran-2-yl)methylene)hydrazineyl)-1,3,5-triazin-2-amine. To a solution of

-hydrazineyl-N-(1-methylcyclopropyl)-6-morpholino-1,3,5-triazin-2-amine (336 mg, 1.26 mmol) in 5 mL methanol was added 5-

nitro-2-furaldehyde (197 mg, 1.39 mmol). The reaction was stirred overnight at rt and concentrated in vacuo. The crude product

was suspended in 25 mL EtOAc and washed with saturated aqueous NH Cl and saturated aqueous NaHCO solutions. The crude

product was dried over anhydrous Na SO and puriﬁed by ﬂash column chromatography using a gradient of 0 – 5% methanol in di-

chloromethane to give the product as a yellow solid (189 mg, 76% over 3 steps): H NMR (500 MHz, d

4

3

2

4

1

6

-DMSO) d 11.22 (s, 0.25),11.16

s, 0.68), 8.22 (s, 0.28), 8.02 (s, 0.82), 7.77 (d, J = 3.0 Hz, 1), 7.72 (s, 1), 7.32 (s, 0.22), 7.07 (s, 0.91), 3.75 (s, 4), 3.65 (s, 4), 1.37 (s, 3), 0.70

s, 2), 0.56 (s, 2).

(

QUANTIFICATION AND STATISTICAL ANALYSIS

Data were presented as means ± standard error determined from biological triplicates. Statistical analysis was performed with

GraphPad Prism (version 6.0). Results in Figures 2B, 2C, 3B, and 3C were analyzed by paired Student’s t-test. Results in Figures

2D, 2E, 2F, 3D, and 3E were analyzed by paired multiple t-tests corrected for multiple comparison using the Holm-Sidak method.

Results in Figure S3E were analyzed with the unpaired Student’s t-test. BRAID analysis regarding drug-drug interactions (Figure S2)

was performed via R package ‘braidrm’, and interactions were categorized as antagonism (k < 0), no interaction (neither synergy nor

antagonism) (k = 0) or synergy (k > 0). The heatmaps (Figures 2G, 2H, and 4A) were generated and analyzed via R package ‘pheat-

map’ by hierarchical clustering with Euclidean distance. The grey scale quantiﬁcation (Figures 3H, 3I, and 4D) was performed with

ImageJ.

DATA AND CODE AVAILABILITY

Whole-genome sequencing data for the M. tuberculosis mutants in this paper have been deposited in the NCBI Sequence Read

Archive (SRA) with access code PRJNA521574. RNAseq data for M. tuberculosis strains in this paper have been deposited to

NCBI Gene Expression Omnibus (GEO) with access code GSE126718.

Cell Chemical Biology 27, 1–14.e1–e11, January 16, 2020 e11

Article Doi

Antitubercular Triazines: Optimization and Intrabacterial Metabolism

DOI: 10.1016/j.chembiol.2019.10.010

Source and publish data:

Authors:

Article abstract of DOI:10.1016/j.chembiol.2019.10.010

Full text of DOI:10.1016/j.chembiol.2019.10.010

Products guided by the article

R&D Labs maybe for 13017-47-5

Relevant to this article

Hot Product