Purification and characterization of a novel GH1 beta-glucosidase from Jeotgalibacillus malaysiensis

Article abstract of DOI:10.1016/j.ijbiomac.2018.04.156

Beta-glucosidase (BGL) is an important industrial enzyme for food, waste and biofuel processing. Jeotgalibacillus is an understudied halophilic genus, and no beta-glucosidase from this genus has been reported. A novel beta-glucosidase gene (1344 bp) from J. malaysiensis DSM 28777^T was cloned and expressed in E. coli. The recombinant protein, referred to as BglD5, consists of a total 447 amino acids. BglD5 purified using a Ni-NTA column has an apparent molecular mass of 52 kDa. It achieved the highest activity at pH 7 and 65 °C. The activity and stability were increased when CaCl₂ was supplemented to the enzyme. The enzyme efficiently hydrolyzed salicin and (1 → 4)-beta-glycosidic linkages such as in cellobiose, cellotriose, cellotetraose, cellopentose, and cellohexanose. Similar to many BGLs, BglD5 was not active towards polysaccharides such as Avicel, carboxymethyl cellulose, Sigmacell cellulose 101, alpha-cellulose and xylan. When BglD5 blended with Cellic Ctec2, the total sugars saccharified from oil palm empty fruit bunches (OPEFB) was enhanced by 4.5%. Based on sequence signatures and tree analyses, BglD5 belongs to the Glycoside Hydrolase family 1. This enzyme is a novel beta-glucosidase attributable to its relatively low sequence similarity with currently known beta-glucosidases, where the closest characterized enzyme is the DT-Bgl from Anoxybacillus sp. DT3-1.

Full text of DOI:10.1016/j.ijbiomac.2018.04.156

Accepted Manuscript
Purification and characterization of a novel GH1 beta-glucosidase
from Jeotgalibacillus malaysiensis
Kok Jun Liew, Lily Lim, Hui Ying Woo, Kok-Gan Chan, Mohd
Shahir Shamsir, Kian Mau Goh
PII:
S0141-8130(18)30602-0
doi:10.1016/j.ijbiomac.2018.04.156
BIOMAC 9564
DOI:
Reference:
To appear in:
Received date:
Revised date:
Accepted date:
6 February 2018
24 April 2018
28 April 2018
Please cite this article as: Kok Jun Liew, Lily Lim, Hui Ying Woo, Kok-Gan Chan, Mohd
Shahir Shamsir, Kian Mau Goh , Purification and characterization of a novel GH1 beta-
glucosidase from Jeotgalibacillus malaysiensis. The address for the corresponding author
was captured as affiliation for all authors. Please check if appropriate. Biomac(2017),
doi:10.1016/j.ijbiomac.2018.04.156
This is a PDF file of an unedited manuscript that has been accepted for publication. As
a service to our customers we are providing this early version of the manuscript. The
manuscript will undergo copyediting, typesetting, and review of the resulting proof before
it is published in its final form. Please note that during the production process errors may
be discovered which could affect the content, and all legal disclaimers that apply to the
journal pertain.

ACCEPTED MANUSCRIPT
Purification and characterization of a novel GH1
beta-glucosidase from Jeotgalibacillus malaysiensis
a
a
a
b,c
a
Kok Jun Liew , Lily Lim , Hui Ying Woo , Kok-Gan Chan , Mohd Shahir Shamsir , Kian
Mau Goh *
a,
a
Faculty of Biosciences and Medical Engineering, Universiti Teknologi Malaysia, 81310 Skudai, Johor, Malaysia
Institute of Biological Sciences, Faculty of Science, University of Malaya, 50603 Kuala Lumpur, Malaysia
Vice Chancellor Office, Jiangsu University, Zhenjiang 212013, PR China
b
c
*
Corresponding author.
Email address: gohkianmau@utm.my (K.M. Goh)
Abstract
Beta-glucosidase (BGL) is an important industrial enzyme for food, waste and biofuel processing.
Jeotgalibacillus is an understudied halophilic genus, and no beta-glucosidase from this genus has been reported. A
T
novel beta-glucosidase gene (1344 bp) from J. malaysiensis DSM 28777 was cloned and expressed in E. coli.
The recombinant protein, referred to as BglD5, consists of a total 447 amino acids. BglD5 purified using a
Ni-NTA column has an apparent molecular mass of 52 kDa. It achieved the highest activity at pH 7 and 65°C. The
activity and stability were increased when CaCl was supplemented to the enzyme. The enzyme efficiently
2
hydrolyzed salicin and (1→4)-beta-glycosidic linkages such as in cellobiose, cellotriose, cellotetraose,
cellopentose, and cellohexanose. Similar to many BGLs, BglD5 was not active towards polysaccharides such as
Avicel, carboxymethyl cellulose, Sigmacell cellulose 101, alpha-cellulose and xylan. When BglD5 blended with
®
Cellic Ctec2, the total sugars saccharified from oil palm empty fruit bunches (OPEFB) was enhanced by 4.5%.
Based on sequence signatures and tree analyses, BglD5 belongs to the Glycoside Hydrolase family 1. This
enzyme is a novel beta-glucosidase attributable to its relatively low sequence similarity with currently known
beta-glucosidases, where the closest characterized enzyme is the DT-Bgl from Anoxybacillus sp. DT3-1.
1
. Introduction
Lignocellulose feedstock such as agricultural and forest residues are rich in carbohydrates, and could thus
serve as potential raw materials for large-scale bioethanol production [1]. Cellulases, i.e exoglucanase,
endoglucanase and beta-glucosidase are glycoside hydrolase (GH) enzymes that depolymerize cellulose into
fermentable glucose for value-added bioethanol [2]. Among the aforementioned list, beta-glucosidase (EC
3
.2.1.21, synonym gentiobiase; cellobiase; β-D-glucosidase) plays a key role in the biomass deconstruction
pipeline, as it reduces cellobiose (two glucose units) or short chain cello-oligosaccharides to glucose.
A total of 153 GH families are currently listed on the Carbohydrate Active enzyme (CAZy) website
(
http://www.cazy.org). Beta-glucosidases (BGLs) are categorized in families GH1, GH3, GH5, GH9, GH30, and
GH116. A notable exception is that GH9 enzymes adopt an inverting mechanism, while BGLs in other families
use the retaining mechanism [3, 4]. Besides, BGLs are usually classified into three groups according to their
substrate specificity: (i) aryl-beta-glucosidases, which acts on aryl beta-glucosides; (ii) cellobiases, which
hydrolyze oligosaccharides only; and (iii) wide range beta-glucosidases, which exhibit broad activities on various
types of substrates [5]. BGLs are important enzymes in various biotechnological processes, including wine, food,
and saccharification of lignocellulosic materials for biofuels [6-8]. A recent work suggests that BGLs from
Bacillus licheniformis could potentially be used to degrade polysaccharide bioflocculant [9]. Detail reviews
regarding beta-glucosidase are available elsewhere [10-14].
T
Jeotgalibacillus is a mesophilic and halophilic genus. J. malaysiensis sp. nov. (strain D5 =DSM
T
T
2
8777 =KCTC33550 ) was isolated from a sandy beach in Johor state, Malaysia [15]. The genome and
transcriptome analyses of this bacterium were performed earlier by our team [16]. A total of 25 GHs and six
carbohydrate esterase genes were annotated in the genome of this strain. J. malaysiensis does not harbor any gene
for GH3, GH5, GH9, GH30, and GH116 BGL. However, a GH1 gene was present in its genome. Beta-glucosidase
from this genus has not been characterized, and we hypothesize that this enzyme has important implications
towards the biotechnological industry. This report describes the biochemical properties of this unexplored BGL.
2
. Methods
2
.1 Gene cloning of beta-glucosidase BglD5

ACCEPTED MANUSCRIPT
The stock culture of J. malaysiensis [15] was cultured on Marine Agar (Pronadisa Laboratorios Conda,
Spain) at 50°C for two days. The genomic DNA was isolated using a Wizard Genomic DNA Purification Kit
(
Promega, USA) according to the manufacturer’s instructions. Specific primers for bglD5 gene amplification
were designed according to locus-tag JMA_34740 annotated in a completed genome sequencing project
DDBJ/EMBL/GenBank: CP009416) [17]. Gene amplification was performed using KAPA HiFi HotStart
ReadyMix (KAPA Biosystems, USA) with forward primer (5’-
(
GCCGGATCCATGAGAAAGTTTCCTGAACATTTC G -3’) and reverse primer (5’- GCGGCTCGAGAG
TATATTGTTGTTGAATCTTTAACC C -3’), and the underlined sequences were restriction sites for BamHI and
XhoI, respectively. The gene was cloned into pET28a and maintained in E. coli BL21 (DE3).
2
.2 Expression and purification of BglD5
The recombinant E. coli BL21 (DE3) with pET28a-bglD5 gene was cultured overnight on Luria-Bertani
(
LB) medium, supplemented with 50 μg/mL kanamycin at 37°C with 200rpm shaking. Next, two milliliters of the
overnight culture were inoculated into 200 mL of fresh LB/Kanamycin broth, and the fresh culture was grown in
the same shaking incubator. When the culture’s OD600nm reached between 0.5~0.6, protein expression was induced
by the addition of 1.0 mM isopropyl-β-D-thiogalactopyranoside into the culture, and growth continued for another
3
hours at 37°C with 200rpm shaking. The cultures were then harvested by centrifugation at 5000 × g for 10
minutes. The crude enzyme was extracted from the harvested cell using a B-PER Direct Bacterial Protein
Extraction Kit (Thermo Scientific, USA) according to the supplier’s protocol. The crude enzyme was then
subjected to purification, which was conducted on a ÄKTA Start chromatography system (GE Healthcare,
Sweden) connected with a Qiagen Ni-NTA Superflow column. The column resin was equilibrated with a binding
buffer (20 mM sodium phosphate buffer, pH 7.4, containing 500 mM NaCl and 60 mM imidazole), and the bound
proteins were eluted with the elution buffer (20 mM sodium phosphate buffer, pH 7.4, containing 500 mM NaCl
and 350 mM imidazole). The purified BglD5 was dialyzed against 100 mM sodium phosphate buffer (pH 7.4) at
4
°C overnight, prior to further analyses.
2
.3 Enzyme assay
The enzyme activity of purified BglD5 was determined using substrate p-nitrophenyl-beta
-D-glucopyranoside (pNPG). The purified BglD5 (0.05 mL) was mixed with 5 mM of pNPG (0.5 mL) in a 100
mM sodium phosphate buffer (pH 7.4). After being incubated at 65°C for 15 minutes, the enzyme reaction was
stopped by adding 0.5 mL 1M sodium hydroxide (NaOH). The absorbance was detected by using a
spectrophotometer at 405 nm. One unit (U) of enzyme activity is defined as the amount of enzyme that catalyzed
the formation of 1 µmol pNP per minute under the conditions of the assay. Enzyme assays were performed in at
least triplicates for each analysis.
2
2
.4 Characterization of BglD5
.4.1 Effects of temperature and pH on BglD5 activity
The optimum temperature for BglD5 was determined by incubating the enzyme reactions at various
temperatures ranging from 20-90°C for 15 minutes. The effects of pH on purified BglD5 was determined by
conducting the reactions in various buffers, with pH ranging from 2-11. The buffers employed were glycine-HCl
buffer (pH 2-3), sodium acetate buffer (pH 4-5.5), sodium phosphate buffer (pH 6-7.5), Tris-HCl buffer (pH 8-9)
and carbonate-bicarbonate buffer (pH 10-11). The relative activity of each of the reactions was calculated by using
enzyme activity at the optimum temperature or pH as reference. Thermostability of BglD5 (with and without 5
mM CaCl ) was conducted by incubating the purified enzyme at 65°C, without the addition of pNPG. At a specific
2
time interval, the incubated enzyme was withdrawn and subjected to enzyme reaction, and the residual activity of
the incubated enzyme was measured by using an enzyme activity at time zero as reference.
2
.4.2 Effects of glucose on BglD5 activity
The purified BglD5 was subjected to glucose inhibition evaluation by reacting pNPG substrates in the
presence of glucose (concentration ranging from 0 mM to 2500 mM). The relative activity of each reaction was
calculated against the reaction tube with the highest activity.
2
.4.3 Effects of metal ions and chemical reagents on BglD5 activity

ACCEPTED MANUSCRIPT
The enzyme activity of BglD5 was evaluated by conducting the standard enzyme reactions with
supplementation of 5 mM calcium chloride, sodium chloride, potassium chloride, magnesium chloride, iron (III)
chloride, nickel (II) chloride, cobalt (II) chloride, ammonium chloride, zinc sulfate, manganese sulfate, copper (II)
sulfate, rubidium chloride, strondium chloride, and barium chloride. Besides, enzymatic reactions were also tested
with 5% (v/v) urea, sodium dodecyl sulfate (SDS), Ethylenediaminetetraacetic acid (EDTA), Tween-20,
Tween-80, Triton X-100, and dimethyl sulfoxide (DMSO). The residual activity of BglD5 in each reaction tube
was calculated with using enzyme reactions without any salts or chemical reagents as reference.
2
.4.4 Enzyme kinetic
The enzyme kinetic parameters of the purified BglD5, for instance, Michaelis-Menten constant (Km),
maximum velocity (Vmax), and turnover number (k ) were assessed by measuring the hydrolysis rate of pNPG at
cat
various concentrations (0.05-3.0 mM) at 65°C for 15min in 100 mM sodium phosphate buffer (pH 7). The data
obtained was used for Michaelis-Menten plotting.
2
.4.5 HPLC analyses
Substrate specificity of BglD5 was determined by incubating 100 μL purified enzyme (0.2 U) in various 1%
(
w/v) substrates, for instance, cellodextrins (cellobiose – cellohexaose), sucrose, salicin, maltose, lactose,
gentibiose, alpha-cellulose, xylan, Avicel, Sigmacell cellulose and carboxymethyl cellulose. All the reactions
were conducted at 65°C, and pH 7 for 24 hours, and the reactions were stopped by boiling for 5 min. Upon
stopping the enzyme reaction, the samples were analyzed in an Agilent 1260 Infinity high performance liquid
chromatography (HPLC), coupled with an Agilent 385-Evaporative Light Scattering Detector (Agilent
2+
Technologies, USA) with a Rezex RPM-Monosaccharide Pb column (Phenomenex Inc, USA) connected.
Unless specified, enzyme activity was measured by quantifying the amount of glucose released, and the relative
hydrolysis rate of each reaction was calculated by using cellobiose reaction tube as reference.
In an independent experiment, the hydrolysis of oil palm empty fruit bunches (OPEFB) was carried out for
one hour at 65°C and pH 7. The raw OPEFB biomass was obtained from a local oil palm mill, and then washed,
dried, and cut to the size of about 0.1 mm ~ 5.0 mm. It was then autoclaved prior to being used. The following
enzymatic hydrolyses were setup in which 1% (v/v) of OPEFB in a total volume of 5 mL was reacted with (i) 875
®
®
U BglD5; (ii) 250 µL Cellic Ctec2 (Novozymes, Denmark); and (iii) 875 U BglD5+ 250 µL Cellic Ctec2. The
total sugar production was measured using the HPLC.
2
.4.6 Bioinformatic analyses of BglD5
Sequences of beta-glucosidases from 70 different species were retrieved using the Uniprot database.
Phylogenetic relationships of BglD5 with those BGLs sequences were inferred using the Maximum-Parsimony
MP) methods with the help of Molecular Evolutionary Genetic Analysis (MEGA 6) program [18]. The SPRINT
database that collected five motifs of BGLs was used as reference to determine the location of motifs in BglD5
19]. A Weblogo representation was generated using an online generator [20]. The crystal structures of proteins
were obtained from PDB database.
(
[
3
. Results
3
.1 Characterization of purified BglD5
Our team sequenced and discussed the genomes of a several type strains of Jeotgalibacillus [16, 17, 21, 22].
In the genome of J. malaysiensis, we identified the presence of a gene (1344 bp) that encodes a beta-glucosidase
BglD5) with 447 amino acids (Uniprot ID: A0A0B5ARU7). This gene was cloned and expressed in E. coli. In
(
order to eliminate the effect of other factors which may be presented in the crude enzyme preparation, and may
thus interfere with the BglD5 function, the purification of the recombinant protein was carried out by a single step
immobilized metal affinity chromatography (IMAC) using Ni-NTA, according to the method previously reported
[
23]. According to Fig. 1, the SDS-PAGE analysis results indicate the high purity of BglD5 with the molecular
weight of approximately 52kDa (calculated based on protein sequence).
TM
Fig 1. SDS-PAGE analysis of purified BglD5. Lane M: Benchmark Protein Ladder (Thermo Scientific, USA);
lane 1: cell lysate from recombinant E. coli BL21 (DE3); lane 2: flowthrough (uncaptured) fraction from
purification column; lane 3: purified BglD5. A 5 μL of each sample was loaded into each well and the gel was
TM
stained by Imperial Protein Stain (Thermo Scientific, USA).

ACCEPTED MANUSCRIPT
The enzymatic and physiological characterization of the recombinant enzyme elucidated that recombinant
BglD5 demonstrates optimal activity at a temperature of 65°C (Fig. 2a) and maintains approximately 95% of the
maximal activity at 70°C. BglD5 also shows high activity at pH in the range of 6 ~ 7.5 (85 ~ 100% of the maximal
activity), with the highest at pH 7 (Fig. 2b). Several buffers (pH 7.0) were tested to examine the buffer that was
better for BglD5 activity. The optimal buffer was the sodium phosphate buffer, but the activity in the potassium
phosphate buffer was similarly good. BglD5 also worked well in citrate-phosphate, HEPES and MOPS buffers,
with an approximately 8% lower activity compared to that of the sodium phosphate buffer. Retardation in the
activity of BglD5 in the Tris-HCl buffer is likely due to the inhibition effect caused by Tris that could bind to the
active site cavity [24-26]. Fig 2c showed that BglD5 was activated by the addition of glucose at low concentration,
the enzyme activity gradually increased from 0 mM to 250 mM of glucose. Yet, it was able to tolerate glucose
concentration up to 2500 mM, retaining about 80% of its maximal activity. Using pNPG as a substrate and a
reaction conducted at optimum temperature and pH, BglD5 indicated the K value of 0.50 ± 0.02 mM, a V of
m
max
-
1
3
9.48 ± 0.63 U/mg, and a kcat value of 33.93 ± 0.54s , using a Michaelis-Menten function (Fig. 2e). A comparison
of biochemical properties and kinetic performance of BglD5 with some other BGLs is shown in Table 1.
Table 2 summarizes the overall effects of metal ions and detergents on the activity of BglD5. With the
supplementation of 5 mM calcium chloride, the relative activity of BglD5 increased to 121%. Besides, calcium
chloride has a positive effect on thermostability (Fig. 2d). A slight increment of activity was also observed when
magnesium chloride was introduced into the reaction (Table 2), while iron chloride, nickel chloride, cobalt
chloride, zinc sulfate, manganese sulfate, and copper sulfate inhibited BglD5 activity.
The substrate specificity of BglD5 was determined by reacting the enzyme with various substrates (10
mg/mL each) (Table 3). The enzyme efficiently hydrolyzed substrates with (1→4)-beta-glycosidic bond. For an
example, cellobiose was effectively hydrolyzed, and yielded glucose. The effeciency of BglD5 against
longer-chains, for instance cellotriose, cellotetraose and cellopentose, was equally good. Although the cleavage of
cellohexanose (with 6 glucose units) was possible, the relative hydrolysis activity was significantly reduced; thus
suggesting that BglD5 is more suitable to cleave short-length cellodextrins. The enzyme was unable to hydrolyze
sucrose and maltose that consist of alpha-glycosidic bonds. Besides, BglD5 was not active against
polysaccharides such as Avicel, carboxymethyl cellulose, sigmacell cellulose, alpha-cellulose and xylan. This
result is in line with previous findings, which also indicate that long chains of polysaccharides hinder the activity
of BGLs due to substrates complexity [23, 27]. The enzyme exhibited a high activity against salicin (117.5%
relative activity to cellobiose). This finding is in agreement with the report by Riou, et al. [28] since salicin is
typically a good substrate for BGLs. Biomass OPEFB is a very common agricultural waste generated in Malaysia
by the palm oil industry. Due to the highly complex structure of the raw OPEFB, BglD5 alone was unable to
saccharify the non-chemical treated OPEFB. However, the addition of BglD5 into a commercial enzyme cocktail
(
(
Cellic® Ctec2) was able to successfully increase the total sugar production from OPEFB by approximately 4.5%
Appendix A1).
Fig 2. Enzymatic characterization of recombinant BglD5. (a) The optimal temperature of BglD5. Reactions were
conducted in 100 mM sodium phosphate buffer (pH 7.4) at various temperatures for 15 min. (b) The optimal pH of
BglD5. Reactions were conducted at 65°C for 15 min in various buffers, pH ranging from 2 to 11. (c) Effects of
glucose (0 to 2500 mM) on BglD5 activity towards pNPG substrate. The reactions were conducted at 65°C and pH
7
for 15 min. (d) Thermostability of BglD5. After preincubation of BglD5 at 65°C (supplemented either with or
without calcium chloride), the enzyme was withdrawn and subjected for enzyme assay, which was conducted at
5°C and pH 7 for 15 min. (e) Nonlinear Michaelis-Menten plot of the purified BglD5. The reactions were
6
conducted at 65°C and pH 7 for 15 min, with pNPG concentration ranging from 0.05 to 3.00 mM.
Table 1. Properties of GH1 beta-glucosidase from various microorganism
Table 2. Effects of metal ions and chemical reagents to the activity of BglD5
Table 3. Hydrolysis of various substrates by purified BglD5
3
.2 Bioinformatic analyses of beta-glucosidase BglD5
BglD5 is an intracellular enzyme in the wild type of J. malaysiensis due to the lack of a signal peptide. BglD5
is a member of GH1, as the protein sequence contained a GH1-specific domain. It shared the closest sequence
similarity of 55.0-56.2% to BGLs from Anoxybacillus spp., followed by 54.3% to Caldanaerobius fijiensis,
5
1.0-54.1% to Alicyclobacillus, 52.3-53.7% to Thermoanaerobacter, 52.8% to Pontibacillus halophilus, 52.3% to
Tumebacillus flagellatus, 52.3% to Roseiflexus castenholzii, 51.8-52.0% to Orenia spp., and 51.8% to

ACCEPTED MANUSCRIPT
Halobacteroides halobius. The majority of the aforementioned homologous BGLs were annotated in
whole-genome sequencing projects, and have not been biochemically characterized, with the exception of DT-Bgl
from Anoxybacillus sp. DT3-1, which was previously reported by our team [23].
The differences between the motifs of BglD5 to 70 GH1 beta-glucosidases were generated using a Weblogo
representation (Fig 3). It appeared that the motifs of BglD5 were slightly different at certain positions. The
putative active sites and important substrate binding sites for BglD5 were predicted based on the well-investigated
BGL sequence of fungi Oryza sativa subsp. japonica (Q7XKV4) [26]. Residue Glu 162 was identified as the acid
base catalyst, while residue Glu 348 corresponded to the nucleophile. BglD5 is a genuine GH1 beta-glucosidase
with the presence of dual glutamic acid as the catalytic site. The locations of five motifs in BglD5 were deduced
by comparison to the BGL sequence of Thermotoga maritima (Q08638) (Fig 4).
A maximum-Parsimony phylogenetic tree was constructed to gain insight on the relationship among GH1
beta-glucosidases (Fig 5). BglD5 formed a cluster with BGLs from thermophilic Anoxybacillus spp. Interestingly,
BglD5 shared a low similarity to GH1 beta-glucosidases identified in the genomes of J. soli (A0A0C2RQE4) and
J. campisalis (A0A0C2W2Y2) (39-44%) [21, 22]; despite them belonging to the same genus. In addition, BGLs
from J. soli and J. campisalis fall into other groups in the tree (Fig. 5). It is thus concluded that BglD5 is a novel
beta-glucosidase that is closer to thermostable or thermophilic sources.
Fig 3. The consensus motif and signature of BglD5 and other 70 GH1 beta-glucosidases. Weblogo representation
was generated using an online generator [20].
Fig 4. Multiple sequence alignment of BglD5 with GH1 beta-glucosidases from different microorganisms.
Abbreviations: Jeotgali- J. malaysiensis BglD5 (this study), Anoxybacil: Anoxybacillus sp. DT3-1 (Uniprot id:
M5QUM2), Thermoanae: Thermoanaerobacter brockii (Q60026) [12], Thermotoga: Thermotoga maritima
(
Q08638, PDB id 5N6S) [47], Paenibacil: Paenibacillus polymyxa (P22505, PDB id 2O9P) [48], Oryza: Oryza
sativa subsp. japonica (Q7XKV4, PDB id 3PTK, 3PTM, and 3PTQ) [26], Trichoderma: Trichoderma harzianum
A0A127SA86, PDB id 5BWF) [31] and Humicola: Humicola insolens (A0A076JRL8, PDB id 4MDO) [25]. The
(
active site is shown in the box. The underlined sequences are the locations of motifs and GH1 N-terminal signature.
Amino acids shown with a yellow (subsite -1), blue (subsite +1), and green (subsite +2) background are the
locations of subsites in the structure of 2O9P or 3PTQ. Red background residues functioned as gatekeepers in
4
MDO. The grey colour background for BGL Thermoanae represents highly conserved residues that may be
important for glucose tolerant characteristics [12].
Fig 5. Phylogenetic analysis of BglD5 with other BGLs. The Maximum-Parsimony (MP) tree was constructed
using MEGA 6 program to elucidate the relationship of BglD5 and other enzymes across bacteria, archaea, and
eukaryote.
4
. Discussion
Beta-glucosidase is an enzyme that hydrolyzes glycosidic bonds to release non-reducing terminal glucosyl
residues from glycosides and oligosaccharides [3]. In the past, detailed investigations have been performed for
fungi BGLs [31, 35, 36]. Fungi such as T. harzianum has multiple genes encoded for GH1 and GH3 BGLs. The
expression of GH1 BGL genes under biomass degradation was significantly higher compared to GH3 genes [31],
and two of the highly expressed GH1 BGLs were previously discussed [49]. Due to the merit of thermostability,
BGLs from hyper- and thermophiles were cloned, expressed and biochemically investigated [8, 33, 38].
According to Pei, et al. [8], thermostable BGLs could potentially facilitate the rates of the cellulose hydrolysis in
biomass degradation. In addition, by using thermostable BGLs in cellulose hydrolysis, the product formation
could be increased, while microbial contamination could be decreased, since the enzymatic hydrolysis process
could be carried out at a higher temperature. Some BGLs from marine sources were also reported [37, 40, 50].
GH1 BGLs from various sources were characterized, and demonstrated diverse biochemical properties (Table 1).
Jeotgalibacillus is a rarely explored halophile. J. malaysiensis is gram-stain-positive, endospore-forming,
rod-shaped, that optimally grew at a pH of 7 to 8 and 37°C [15]. To date, BGL from this genus has not been
biochemically characterized. Despite the wild type J. malaysiensis being a mesophilic bacterium, BglD5 exhibited
a relatively high enzymatic optimum temperature of 65°C, comparable to BGLs found in thermophilic
counterparts such as Anoxybacillus sp. DT3-1 [23] and Thermoanaerobacterium spp. [8, 40]. BglD5 remained
active at a pH range of 6 – 7.5, and this characteristic is similar to BGLs found in R. flavipes [34] and F.
islandicum [38], whereby the enzymes were also highly active at a neutral pH.
The activity and stability of BglD5 was enhanced in the presence of calcium chloride. BglD5 had an activity
half-life of 70 min at 65°C, in the presence of CaCl . Therefore, thermostable BglD5 is an attractive candidate to
2
be applied in cellulase cocktails, in order to improve the biomass hydrolysis. The addition of CaCl has a positive
2
effect on other enzymes as well, for instance, BGLs obtained from R. flavipes, Exiguobacterium sp. DAU5 and
Weissella cibaria 37 [34, 42, 43]. However, CaCl did not improve the activity of BGLs obtained from B.
2
licheniformis, P. roxburghii, H. insolens RP86, Clostridium cellulovorans, Trichorderma reesei and Neotermes

ACCEPTED MANUSCRIPT
2
+
koshunensis [9, 24, 30, 35]. The binding pocket for Ca for GHs such as endoglucanase, α-amylase, pullulanase,
2+
and CGTase have been well-studied [51-55]. There is lack of studies in the literature on the Ca binding site for
2
+
BGLs. In one particular study, a Ca ligand was identified in the crystal structure of GH1 BGL from Thermotoga
2+
maritima [56]. This particular structure consists of 4 chains (PDB id 2WC4). However, Ca bound only to
chain-C interacted by a single amino acid, Glu329 (T. maritima numbering). It is likely that the interaction
2
+
2+
between Ca and Glu329 was unspecific. In another structure of T. maritima BGL (PDB id 2J7B), the Ca
interacted with Asp278, Ser281, and Glu282 [57]. Nevertheless, these residues were not conserved for BglD5. It is
2
+
thus at this point that the Ca binding pocket for BglD5 remains to be determined.
A slight increment in BglD5 enzyme activity was also observed when magnesium chloride was added to
the reaction tube. A similar effect was previously reported, where MgCl2 enhanced the BGLs from
2+
Cellulomonasmicrobium cellulans and T. thermosaccharolyticum [8, 29]. Similar to that of the Ca cation, the
2
+
binding site for the Mg cation was not emphasized in any earlier studies. The protein structure of GH1 BGLs
2
+
that were found to have an Mg binding site are 3VKK and 2ZOX, both of which originate from humans [58].
2
+
The physiological relevance of Mg to BGL is yet to be confirmed.
To date, over 330 BGL structures of various GH families are available at the PDB database. GH1 BGLs
consist of a typical TIM-barrel fold similar to BGL from P. polymyxa (PDB id 2O9P), H. orenii (4PTX) or T.
harzianum (5BWF), and the active site pocket is located near the C-terminal region of the (α/β) barrel [31]. Based
8
on template 4PTX, the predicted structure of BglD5 has a similar overall structure to the template (Appendix A2).
The sequences of GH1 BGLs are very diverse. Among the examined 70 sequences (Appendix A3), only 17
residues are completely identical at designated positions. Almost all GH1 BGLs had a NEP amino acid stretch
(
161-163 BglD5 numbering), where the Glu is the catalytic sites (acid/base). Interestingly, enzymes identified in
some Bacillus spp. and J. soli (A0A0C2RQE, A0A0Q6HVV2, D5E2L2, A0A0M1NP20, and A0A098FCN7;
formed a group in Fig. 5) had the stretch NET (Threonine instead of Proline) following the acid/base catalytic
site. Besides, stretch TENG (347-350 BglD5 numbering, where the Glu is among the catalytic sites (nucleophile),
is another conserved region in GH1 BGLs from bacteria, archaea and eukaryotes. Exceptionally, vegetative weed
Arabidopsis thaliana (AAB64244.1) had a sequence of MENG.
SPRINT cataloged the presence of five motifs for BGLs [19]. Nucleophile Glu348 was placed in motif 2.
Motifs 1, 4, and 5 consist of several important substrate interacting residues (Fig. 3). These five motifs are very
diversifying in amino acid selection (Fig. 4). Interestingly, we notice the presence of a highly conserved region
11
19
(
BglD5: GTATSSFQI ) near the N-terminal of GH1 beta-glucosidase that was not curated in the SPRINT
database. ScanProsite predicted that this conserved region is Glycosyl Hydrolases family 1 N-terminal signature
(
(
Fig. 3 and 4). Based on earlier findings related to BGL obtained from O. sativa subsp. japonica, a residue Gln
Q29) in protrude to the direction of glycon residue and formed hydrogen bond around subsite -1 [26]. It is thus
possible that N-terminal signature may be important for substrate recognition or catalytic reaction.
As mentioned previously, the BGL superfamily was grouped into four GH families. Pei, et al. [8] proposed 5
clades for BGLs affiliated to GH1 and GH3. Accordingly, the report suggested that Clade I is represented by GH1
enzymes from mesophilic bacteria; Clade II is grouped by GH1 BGL from fungi; Clade III by GH3 BGL from
bacteria; Clade IV by GH3 enzyme from fungi; and Clade V contains a mixture of GH1 BGL from thermophilic
bacteria and Bacillus. As the analysis applied limited datasets, it may not comprehensively provide clear insight.
Besides, the proposed grouping may be confusing, as the existing clade-groupings for GH3 beta-glucosidase [59]
have not been considered in the analysis [8]. In fact, CAZy has already classified families GH1, GH5, and GH30
to the Clan GH-A [3]. Therefore, classification suggested by Pei, et al. [8] should be relooked, since, indeed, there
is a need to propose more comprehensive groupings. In this work, we constructed a Maximum Parsimony tree
using 70 sequences of genuine GH1 (Criteria: (i) contains 2 highly conserved Glu as catalytic residues, and (ii)
consisted of GH1 domain). The tree (Fig. 5) is robust, as the placement of taxa is similar to when a
Neighbour-Joining tree was used (not shown). BglD5 was clustered together with the BGLs from thermophilic
Anoxybacillus spp. Interestingly, two other uncharacterized BGLs from J. soli (closer to Bacillus megaterium
beta-glucosidase) and J. campisalis (closer to Bacillus halodurans) were located far away from BglD5, suggesting
that BglD5 had evolved more rapidly compared to other counterparts. BGLs from hyperthermophiles, in
particular, archaea, were clustered at the base of the tree, while enzymes from eukaryotic sources (fungi, termites,
plants, and silkworms) formed a distinctive group. The rest of the trees were mainly BGL sequences from
bacteria. For the current tree, we could only suggest a relative relationship among these enzymes, and it is not
possible to propose defined clades, since BGLs (in particular, bacteria origin) were not grouped according to
taxonomy, optimum growth temperature, or salinity requirements. Instead of sequence classification, functional
classification summarized by a review article [13] may be more appropriate. According to the authors, BGLs are
categorized as class I (aryl beta-glucosidases), class II (true cellobiases), and class III (broad substrate specificity
enzymes), and we agree that this functional classification is important to differentiate BGLs. For the group that
consists of BglD5 from J. malaysiensis, DT-Bgl from Anoxybacillus sp. DT3-1, and other uncharacterized BGLs
from Anoxybacillus spp. (Fig. 5), these BGLs can be classified as class III.

ACCEPTED MANUSCRIPT
Similar to BGLs isolated from B. subtilis and T. thermarum DSM 5069T [32, 33], BglD5 exhibited
glucose-tolerant characteristics. BglD5 tolerated up to 2500 mM glucose and retained about 80% of its maximum
activity, yet the tolerance level is far lower to that of DT-Bgl from Anoxybacillus sp. DT3-1, which was previously
reported by our team [23]. It has been reported that GH1 BGLs are 10- to 1000- fold more glucose-tolerant
compared to GH3 BGLs, due to the architecture of active site pocket [10, 60]. GH1 enzymes harbor a deeper and
narrower active site at (α/β) barrel, while GH3 BGLs have relatively shallower cavity where glucose easily binds
8
at the catalytic pocket, and results in a competitive inhibition with real substrates [25]. In fact, the location of the
active site for GH1 and GH3 enzymes is different. In GH3 BGLs, the catalytic center is located at the interface
between (α/β) barrel and (α/β) domain [59]. Collectively, GH1 BGLs are more suitable to be used for the final
8
6
step of cellulose saccharification to form fermentable glucose. Mariano, et al. [12] performed a bioinformatic
analysis of 23 protein sequences of glucose-tolerant BGLs. Collectively, the team suggested that 11 residues,
namely, H121, W122, N166, E167, N297, Y299, E355, W402, E409, W410, and F418 (based on the numbering
of T. brockii beta-glucosidase Q60026), may be crucial for glucose tolerant behaviors (Fig. 4). Through protein
engineering of two BGLs, Yang, et al. [61] have elucidated that glucose tolerance is determined by more than a
single site. This finding complied with the findings of work [62], where a mutant with three replacement sites
(
W174C/A404V/L441F) exhibited greater thermostability, glucose tolerance and activity. In another report, Liu,
et al. [50] suggest that the replacement of H184 with Phe significantly increased glucose tolerance for a
metagenome-derived enzyme [61]. The shape and electrostatic properties of the deep active-site entrance, and the
+
2 subsite, in particular, Trp168 and Leu173 (H. insolens A0A076JRL8 numbering), determined the degree of
tolerance to glucose in GH1 members [25]. Besides, for H. insolens BGL, three phenylalanine residues (Phe325,
Phe333 and Phe348), along with another four residues (highlighted in red in Fig. 4), functioned as gatekeepers,
and demarcated a restricted entrance to the active site [25]. Nevertheless, these residues are not conserved in
BglD5. In a separate finding, residual adjacent to subsite +2 may also regulate glucose tolerance, as reported by
mutagenesis H183F (equivalent to 176 in BglD5 numbering) in a marine metagenome derived BGL [50].
5
. Conclusions
In conclusion, the bglD5 gene from a marine bacterium J. malaysiensis coding for beta-glucosidase was
successfully expressed in E. coli, and it was found out that CaCl enhanced the activity of the heterologous
2
enzyme. BglD5 demonstrates its advantageous application in the saccharification process of cellulosic materials,
attributable to good thermostability and low glucose inhibition. The enzyme is classified as class III BGL.
Conflicts of Interest
The authors declare no conflict of interest. The founding sponsors had no role in the design of the study; in
the collection, analyses, or interpretation of data; in the writing of the manuscript, and in the decision to publish
the results.
Acknowledgments
This work was supported by Universiti Teknologi Malaysia Research Grants (Grant No. 16H89, & 14H67)
awarded to M.S. Shamsir and K.M. Goh. The authors gratefully acknowledge the financial support provided by
grants from JBK, NRE, University of Malaya (GA001-2016, GA002-2016) awarded to Kok-Gan Chan, FASc .
K.J. Liew thanks the Zamalah Program of Universiti Teknologi Malaysia for scholarship support.
Appendix A. Supplementary Data
Please refer to the link provided for supplementary data.
®
Appendix A1 Comparison of sugar production from OPEFB, treatment with (i) BglD5, (ii) Cellic Ctec2,
®
and (iii) BglD5+Cellic Ctec2 (https://figshare.com/s/a53a86b97be931b6df53)
Appendix A2 3D model structure of BglD5 predicted by I-TASSER with its secondary structure labelled in
pink – alpha-helix; yellow – beta-sheet; and grey – loops. (https://figshare.com/s/e2e7c49b2d126fce75dc)
Appendix A3 Multiple sequence alignment of 70 selected GH1 beta-glucosidases.
(
https://figshare.com/s/984a967f2a261dd7e1ea)
References
[1] S. Banerjee, S. Mudliar, R. Sen, B. Giri, D. Satpute, T. Chakrabarti, R. Pandey, Commercializing lignocellulosic
bioethanol: technology bottlenecks and possible remedies, Biofuels Bioprod. Bioref. 4 (2010) 77–93.

ACCEPTED MANUSCRIPT
[2] Y. Han, H. Chen, Characterization of β-glucosidase from corn stover and its application in simultaneous saccharification
and fermentation, Bioresour. Technol. 99 (2008) 6081–6087.
[3] J.R.K. Cairns, A. Esen, β-Glucosidases, Cell. Mol. Life Sci. 67 (2010) 3389–3405.
[4] A. White, D.R. Rose, Mechanism of catalysis by retaining β-glycosyl hydrolases, Curr. Opin. Struct. Biol. 7 (1997) 645–
6
51.
[
[
[
5] Y. Guo, Q. Yan, Y. Yang, S. Yang, Y. Liu, Z. Jiang, Expression and characterization of a novel β-glucosidase, with
transglycosylation and exo-β-1, 3-glucanase activities, from Rhizomucor miehei, Food Chem. 175 (2015) 431–438.
6] M.A. Villena, J.F.U. Iranzo, A.I.B. Pérez, β-Glucosidase activity in wine yeasts: application in enology, Enzyme Microb.
Technol. 40 (2007) 420–425.
7] G.P. Maitan-Alfenas, G.d.A. Lorena, M.N. de Almeida, E.M. Visser, S.T. de Rezende, V.M. Guimarães, Hydrolysis of
soybean isoflavones by Debaryomyces hansenii UFV-1 immobilised cells and free β-glucosidase, Food Chem. 146
(2014) 429–436.
[
[
[
[
[
8] J. Pei, Q. Pang, L. Zhao, S. Fan, H. Shi, Thermoanaerobacterium thermosaccharolyticum β-glucosidase: a
glucose-tolerant enzyme with high specific activity for cellobiose, Biotechnol. Biofuels 5 (2012) 31.
9] Z. Chen, T. Meng, Z. Li, P. Liu, Y. Wang, N. He, D. Liang, Characterization of a beta-glucosidase from Bacillus
licheniformis and its effect on bioflocculant degradation, AMB Express 7 (2017) 197.
10] R.R. Singhania, A. Patel, A. Pandey, E. Gnasounou, Genetic modification: a tool for enhancing beta-glucosidase
production for biofuel application, Bioresour. Technol. (2017).
11] R.R. Singhania, A.K. Patel, R.K. Sukumaran, C. Larroche, A. Pandey, Role and significance of beta-glucosidases in the
hydrolysis of cellulose for bioethanol production, Bioresour. Technol. 127 (2013) 500–507.
12] D. Mariano, C. Leite, L. Santos, L. Marins, K. Machado, A. Werhli, L. Lima, R. de Melo-Minardi, Characterization of
glucose-tolerant β-glucosidases used in biofuel production under the bioinformatics perspective: a systematic review,
Genet. Mol. Res. 16 (2017).
[
[
[
13] P. Tiwari, B. Misra, N.S. Sangwan, β-Glucosidases from the fungus Trichoderma: an efficient cellulase machinery in
biotechnological applications, BioMed Res. Int. 2013 (2013) e203735.
14] Y. Bhatia, S. Mishra, V. Bisaria, Microbial β-glucosidases: cloning, properties, and applications, Crit. Rev. Biotechnol.
2
2 (2002) 375–407.
15] A.S. Yaakop, K.-G. Chan, R. Ee, U.M. Kahar, W.C. Kon, K.M. Goh, Isolation of Jeotgalibacillus malaysiensis sp. nov.
from a sandy beach, and emended description of the genus Jeotgalibacillus, Int. J. Syst. Evol. Microbiol. 65 (2015)
2
215–2221.
[
16] K.M. Goh, K.-G. Chan, A.S. Yaakop, R. Ee, Complete genome of Jeotgalibacillus malaysiensis D5(T) consisting of a
chromosome and a circular megaplasmid, J. Biotechnol. 204 (2015) 13–14.
[
17] A.S. Yaakop, K.-G. Chan, R. Ee, Y.L. Lim, S.-K. Lee, F.A. Manan, K.M. Goh, Characterization of the mechanism of
prolonged adaptation to osmotic stress of Jeotgalibacillus malaysiensis via genome and transcriptome sequencing
analyses, Sci. Rep. 6 (2016) 33660.
[
[
[
18] K. Tamura, G. Stecher, D. Peterson, A. Filipski, S. Kumar, MEGA6: molecular evolutionary genetics analysis version
6
.0, Mol. Biol. Evol. 30 (2013) 2725–2729.
19] T.K. Attwood, P. Bradley, D.R. Flower, A. Gaulton, N. Maudling, A.L. Mitchell, G. Moulton, A. Nordle, K. Paine, P.
Taylor, PRINTS and its automatic supplement, prePRINTS, Nucleic Acids Res. 31 (2003) 400–402.
20] G.E. Crooks, G. Hon, J.-M. Chandonia, S.E. Brenner, WebLogo: a sequence logo generator, Genome Res. 14 (2004)
1
188–1190.

ACCEPTED MANUSCRIPT
[
[
[
[
21] A.S. Yaakop, K.-G. Chan, H.M. Gan, K.M. Goh, Draft genome of Jeotgalibacillus campisalis SF-57(T), a moderate
halophilic bacterium isolated from marine saltern, Mar. Genomics 23 (2015) 59–60.
22] K.M. Goh, K.-G. Chan, A.S. Yaakop, C.S. Chan, R. Ee, W.-S. Tan, H.M. Gan, Draft genome sequence of
Jeotgalibacillus soli DSM 23228, a bacterium isolated from alkaline sandy soil, Genome Announc. 3 (2015) e00512–15.
23] C.S. Chan, L.L. Sin, K.-G. Chan, M.S. Shamsir, F.A. Manan, R.K. Sani, K.M. Goh, Characterization of a
glucose-tolerant β-glucosidase from Anoxybacillus sp. DT3-1, Biotechnol. Biofuels 9 (2016) 174.
24] W.-Y. Jeng, N.-C. Wang, M.-H. Lin, C.-T. Lin, Y.-C. Liaw, W.-J. Chang, C.-I. Liu, P.-H. Liang, A.H.-J. Wang,
Structural and functional analysis of three β-glucosidases from bacterium Clostridium cellulovorans, fungus
Trichoderma reesei and termite Neotermes koshunensis, J. Struct. Biol. 173 (2011) 46–56.
[
25] P.O. de Giuseppe, T.d.A. Souza, F.H.M. Souza, L.M. Zanphorlin, C.B. Machado, R.J. Ward, J.A. Jorge, R.d.P.M.
Furriel, M.T. Murakami, Structural basis for glucose tolerance in GH1 β-glucosidases, Acta Crystallogr. D Biol.
Crystallogr. 70 (2014) 1631–1639.
[
26] S. Sansenya, R. Opassiri, B. Kuaprasert, C.-J. Chen, J.R.K. Cairns, The crystal structure of rice (Oryza sativa L.)
Os4BGlu12, an oligosaccharide and tuberonic acid glucoside-hydrolyzing β-glucosidase with significant
thioglucohydrolase activity, Arch. Biochem. Biophys. 510 (2011) 62–72.
[27] S. Paavilainen, J. Hellman, T. Korpela, Purification, characterization, gene cloning, and sequencing of a new
beta-glucosidase from Bacillus circulans subsp. alkalophilus, Appl. Environ. Microbiol. 59 (1993) 927–932.
[28] C. Riou, J.-M. Salmon, M.-J. Vallier, Z. Günata, P. Barre, Purification, characterization, and substrate specificity of a
novel highly glucose-tolerant β-glucosidase from Aspergillus oryzae, Appl. Environ. Microbiol. 64 (1998) 3607–3614.
[29] Y. Yuan, F. Xu, J. Yao, Y. Hu, J. Wang, T. Zhao, Y. Zhou, J. Gao, Cloning, expression and biochemical
characterization of a GH1 β-glucosidase from Cellulosimicrobium cellulans, Biocatal. Biotransformation (2017) 1–10.
[30] B. Kar, P. Verma, G.K. Patel, A.K. Sharma, Molecular cloning, characterization and in silico analysis of a thermostable
β-glucosidase enzyme from Putranjiva roxburghii with a significant activity for cellobiose, Phytochemistry 140 (2017)
1
51–165.
[
31] C.A. Santos, L.M. Zanphorlin, A. Crucello, C.C. Tonoli, R. Ruller, M.A. Horta, M.T. Murakami, A.P. Souza, Crystal
structure and biochemical characterization of the recombinant ThBgl, a GH1 β-glucosidase overexpressed in
Trichoderma harzianum under biomass degradation conditions, Biotechnol. Biofuels 9 (2016) 71.
[
32] S. Chamoli, P. Kumar, N.K. Navani, A.K. Verma, Secretory expression, characterization and docking study of
glucose-tolerant β-glucosidase from B. subtilis, Int. J. Biol. Macromol. 85 (2016) 425–433.
[
33] L. Zhao, J. Xie, X. Zhang, F. Cao, J. Pei, Overexpression and characterization of a glucose-tolerant β-glucosidase from
Thermotoga thermarum DSM 5069T with high catalytic efficiency of ginsenoside Rb1 to Rd, J. Mol. Catal. B Enzym.
9
5 (2013) 62–69.
[
[
[
34] M.E. Scharf, E.S. Kovaleva, S. Jadhao, J.H. Campbell, G.W. Buchman, D.G. Boucias, Functional and translational
analyses of a beta-glucosidase gene (glycosyl hydrolase family 1) isolated from the gut of the lower termite
Reticulitermes flavipes, Insect Biochem. Mol. Biol. 40 (2010) 611–620.
35] F.H.M. Souza, L.P. Meleiro, C.B. Machado, A.L.R.L. Zimbardi, R.F. Maldonado, T.A.C.B. Souza, D.C. Masui, M.T.
Murakami, J.A. Jorge, R.J. Ward, Gene cloning, expression and biochemical characterization of a glucose-and
xylose-stimulated β-glucosidase from Humicola insolens RP86, J. Mol. Catal. B Enzym. 106 (2014) 1–10.
36] B. Benoliel, M.J. Poças-Fonseca, F.A.G. Torres, L.M.P. de Moraes, Expression of a glucose-tolerant β-glucosidase
from Humicola grisea var. thermoidea in Saccharomyces cerevisiae, Applied Biochem. Biotechnol. 160 (2010) 2036–
2
044.

ACCEPTED MANUSCRIPT
[37] Z. Fang, W. Fang, J. Liu, Y. Hong, H. Peng, X. Zhang, B. Sun, Y. Xiao, Cloning and characterization of a
β-glucosidase from marine microbial metagenome with excellent glucose tolerance, J. Microbiol. Biotechnol. 20 (2010)
1
351–1358.
[
[
[
[
[
38] D. Jabbour, B. Klippel, G. Antranikian, A novel thermostable and glucose-tolerant β-glucosidase from
Fervidobacterium islandicum, Applied Biochem. Biotechnol. 93 (2012) 1947–1956.
39] J. Lu, L. Du, Y. Wei, Y. Hu, R. Huang, Expression and characterization of a novel highly glucose-tolerant
β-glucosidase from a soil metagenome, Acta Biochim. Biophys. Sin. 45 (2013) 664–673.
40] F. Yang, X. Yang, Z. Li, C. Du, J. Wang, S. Li, Overexpression and characterization of a glucose-tolerant β-glucosidase
from T. aotearoense with high specific activity for cellobiose, Applied Biochem. Biotechnol. 99 (2015) 8903–8915.
41] P. Ramachandran, M.K. Tiwari, R.K. Singh, J.-R. Haw, M. Jeya, J.-K. Lee, Cloning and characterization of a putative
β-glucosidase (NfBGL595) from Neosartorya fischeri, Process Biochem. 47 (2012) 99–105.
42] J. Chang, I.-H. Park, Y.-S. Lee, S.-C. Ahn, Y. Zhou, Y.-L. Choi, Cloning, expression, and characterization of
[beta]-glucosidase from Exiguobacterium sp. DAU5 and transglycosylation activity, Biotechnol. Bioprocess Eng. 16
(2011) 97.
[
[
[
[
[
[
43] K.W. Lee, N.S. Han, J.H. Kim, Purification and characterization of beta-glucosidase from Weissella cibaria 37, J.
Microbiol. Biotechnol. 22 (2012) 1705–1713.
44] N.A. Spiridonov, D.B. Wilson, Cloning and biochemical characterization of BglC, a β-glucosidase from the cellulolytic
actinomycete Thermobifida fusca, Curr. Microbiol. 42 (2001) 295–301.
45] S. Naz, N. Ikram, M. Rajoka, S. Sadaf, M. Akhtar, Enhanced production and characterization of a [beta]-glucosidase
from Bacillus halodurans expressed in Escherichia coli, Biochemistry 75 (2010) 513.
46] C. Schröder, S. Elleuche, S. Blank, G. Antranikian, Characterization of a heat-active archaeal β-glucosidase from a
hydrothermal spring metagenome, Enzyme Microb. Technol. 57 (2014) 48–54.
47] T.J. Beenakker, D.P. Wander, W.A. Offen, M. Artola, L. Raich, M.J. Ferraz, K.-Y. Li, J.H. Houben, E.R. van Rijssel, T.
Hansen, Carba-cyclophellitols are neutral retaining-glucosidase inhibitors, J. Am. Chem. Soc. 139 (2017) 6534–6537.
48] P. Isorna, J. Polaina, L. Latorre-García, F.J. Cañada, B. González, J. Sanz-Aparicio, Crystal structures of Paenibacillus
polymyxa β-glucosidase B complexes reveal the molecular basis of substrate specificity and give new insights into the
catalytic machinery of family I glycosidases, J. Mol. Biol. 371 (2007) 1204–1218.
[
49] R.N. Florindo, V.P. Souza, H.S. Mutti, C. Camilo, L.R. Manzine, S.R. Marana, I. Polikarpov, A.S. Nascimento,
Structural insights into β-glucosidase transglycosylation based on biochemical, structural and computational analysis of
two GH1 enzymes from Trichoderma harzianum, N. Biotechnol. 40 (2018) 218–227.
[
[
[
50] J. Liu, X. Zhang, Z. Fang, W. Fang, H. Peng, Y. Xiao, The 184th residue of β-glucosidase Bgl1B plays an important
role in glucose tolerance, J. Biosci. Bioeng. 112 (2011) 447–450.
51] S. Chauvaux, P. Beguin, J.-P. Aubert, K.M. Bhat, L.A. Gow, T.M. Wood, A. Bairoch, Calcium-binding affinity and
calcium-enhanced activity of Clostridium thermocellum endoglucanase D, Biochem. J. 265 (1990) 261–265.
52] K.P. Chai, N.F.B. Othman, A.-H. Teh, K.L. Ho, K.-G. Chan, M.S. Shamsir, K.M. Goh, C.L. Ng, Crystal structure of
Anoxybacillus α-amylase provides insights into maltose binding of a new glycosyl hydrolase subclass, Sci. Rep. 6 (2016)
2
3126.
[
53] E. Boel, L. Brady, A.M. Brzozowski, Z. Derewenda, G.G. Dodson, V.J. Jensen, S.B. Petersen, H. Swift, L. Thim, H.F.
Woldike, Calcium binding in α-amylases: an x-ray diffraction study at 2.1-Å resolution of two enzymes from Aspergillus,
Biochemistry 29 (1990) 6244–6249.

ACCEPTED MANUSCRIPT
[54] J. Xu, F. Ren, C.H. Huang, Y. Zheng, J. Zhen, H. Sun, T.P. Ko, M. He, C.C. Chen, H.C. Chan, Functional and structural
studies of pullulanase from Anoxybacillus sp. LM18‐11, Proteins: Structure, Function, and Bioinformatics 82 (2014)
1
685–1693.
55] C. Klein, G.E. Schulz, Structure of cyclodextrin glycosyltransferase refined at 2.0 Å resolution, J. Mol. Biol. 217 (1991)
37–750.
[
7
[
56] M. Aguilar-Moncayo, T.M. Gloster, J.P. Turkenburg, M.I. García-Moreno, C.O. Mellet, G.J. Davies, J.M.G. Fernández,
Glycosidase inhibition by ring-modified castanospermine analogues: tackling enzyme selectivity by inhibitor tailoring,
Org. Biomol. Chem. 7 (2009) 2738–2747.
[57] T.M. Gloster, P. Meloncelli, R.V. Stick, D. Zechel, A. Vasella, G.J. Davies, Glycosidase inhibition: an assessment of
the binding of 18 putative transition-state mimics, J. Am. Chem. Soc. 129 (2007) 2345–2354.
[58] J. Noguchi, Y. Hayashi, Y. Baba, N. Okino, M. Kimura, M. Ito, Y. Kakuta, Crystal structure of the covalent
intermediate of human cytosolic β-glucosidase, Biochem. Biophys. Res. Commun. 374 (2008) 549–552.
[59] A.J. Harvey, M. Hrmova, R. De Gori, J.N. Varghese, G.B. Fincher, Comparative modeling of the three‐dimensional
structures of family 3 glycoside hydrolases, Proteins: Struct. Funct. Bioinf. 41 (2000) 257–269.
[60] L.P. Meleiro, J.C.S. Salgado, R.F. Maldonado, S. Carli, L.A.B. Moraes, R.J. Ward, J.A. Jorge, R.P.M. Furriel,
Engineering the GH1 β-glucosidase from Humicola insolens: Insights on the stimulation of activity by glucose and
xylose, PLoS One 12 (2017) e0188254.
[
61] Y. Yang, X. Zhang, Q. Yin, W. Fang, Z. Fang, X. Wang, X. Zhang, Y. Xiao, A mechanism of glucose tolerance and
stimulation of GH1 β-glucosidases, Sci. Rep. 5 (2015).
[
62] L.-C. Cao, Z.-J. Wang, G.-H. Ren, W. Kong, L. Li, W. Xie, Y.-H. Liu, Engineering a novel glucose-tolerant
β-glucosidase as supplementation to enhance the hydrolysis of sugarcane bagasse at high glucose concentration,
Biotechnol. Biofuels 8 (2015) 202.

ACCEPTED MANUSCRIPT
List of Figures
TM
Fig 1. SDS-PAGE analysis of purified BglD5. Lane M: Benchmark Protein Ladder (Thermo Scientific, USA);
lane 1: cell lysate from recombinant E. coli BL21 (DE3); lane 2: flowthrough (uncaptured) fraction from
purification column; lane 3: purified BglD5. A 5 μL of each sample was loaded into each well and the gel was
TM
stained by Imperial Protein Stain (Thermo Scientific, USA).
Fig 2. Enzymatic characterization of recombinant BglD5. (a) The optimal temperature of BglD5. Reactions were
conducted in 100 mM sodium phosphate buffer (pH 7.4) at various temperatures for 15 min. (b) The optimal pH
of BglD5. Reactions were conducted at 65°C for 15 min in various buffers, pH ranging from 2 to 11. (c) Effects
of glucose (0 to 2500 mM) on BglD5 activity towards pNPG substrate. The reactions were conducted at 65°C
and pH 7 for 15 min. (d) Thermostability of BglD5. After preincubation of BglD5 at 65°C (supplemented either
with or without calcium chloride), the enzyme was withdrawn and subjected for enzyme assay, which was
conducted at 65°C and pH 7 for 15 min. (e) Nonlinear Michaelis-Menten plot of the purified BglD5. The
reactions were conducted at 65°C and pH 7 for 15 min, with pNPG concentration ranging from 0.05 to 3.00 mM.
Fig 3. The consensus motif and signature of BglD5 and other 70 GH1 beta-glucosidases. Weblogo representation
was generated using an online generator [20].
Fig 4. Multiple sequence alignment of BglD5 with GH1 beta-glucosidases from different microorganisms.
Abbreviations: Jeotgali- J. malaysiensis BglD5 (this study), Anoxybacil: Anoxybacillus sp. DT3-1 (Uniprot id:
M5QUM2), Thermoanae: Thermoanaerobacter brockii (Q60026) [12], Thermotoga: Thermotoga maritima
(
Q08638, PDB id 5N6S) [47], Paenibacil: Paenibacillus polymyxa (P22505, PDB id 2O9P) [48], Oryza: Oryza
sativa subsp. japonica (Q7XKV4, PDB id 3PTK, 3PTM, and 3PTQ) [26], Trichoderma: Trichoderma
harzianum (A0A127SA86, PDB id 5BWF) [31] and Humicola: Humicola insolens (A0A076JRL8, PDB id
4
MDO) [25]. The active site is shown in the box. The underlined sequences are the locations of motifs and GH1
N-terminal signature. Amino acids shown with a yellow (subsite -1), blue (subsite +1), and green (subsite +2)
background are the locations of subsites in the structure of 2O9P or 3PTQ. Red background residues functioned
as gatekeepers in 4MDO. The grey colour background for BGL Thermoanae represents highly conserved
residues that may be important for glucose tolerant characteristics [12].
Fig 5. Phylogenetic analysis of BglD5 with other BGLs. The Maximum-Parsimony (MP) tree was constructed
using MEGA 6 program to elucidate the relationship of BglD5 and other enzymes across bacteria, archaea, and
eukaryote.

ACCEPTED MANUSCRIPT
List of Tables
Table 1. Properties of GH1 beta-glucosidase from various microorganism
Table 2. Effects of metal ions and chemical reagents to the activity of BglD5
Table 3. Hydrolysis of various substrates by purified BglD5

ACCEPTED MANUSCRIPT
Table 1. Properties of GH1 beta-glucosidase from various microorganism
Source
MW
Opt.
Opt.
pH
Thermostability
Km (mM)a
Vmax (U/mg)b
Ref
(kDa temp.
)
°C
J. malaysiensis (this study)
52
65
7
t
1/2 65°C = 35 min
w/o CaCl
1/2 65°C = 70 min
with CaCl
0.50
39.48
this
stud
y
(
2
)
t
(
2
)
Anoxybacillus sp. DT3-1
53
57
70
55
8.5
6.0
t
t
t
1/2 60°C = 24 hours
1/2 45°C = 25 min
1/2 50°C = 3 min
0.22
0.36
923.7
4.09
[23]
[29]
Cellulosimicrobium
cellulans
Putranjiva roxburghii
61
65
4.6
Native:
Native:
Native:
[30]
Retained 67%
activity after
incubation at 70°C
for 1 hour
0.53 (pNPG)
0.181 μkat/mg
(pNPG)
0
.81
(
cellobiose)
0.122 μkat/mg
(
cellobiose)
Recombinant:
Recombinant:
Recombinant:
0
.58 (pNPG)
Retained 35%
activity after
incubation at 70°C
for 1 hour
0
.157 μkat/mg
0
.87
(
pNPG)
(
cellobiose)
0
.105 μkat/mg
(
cellobiose)
Trichoderma harzianum
Bacillus subtilis
54
40
6
CD thermal-induced
unfolding, Tm = 49°C
0.97 (pNPG)
29.3 (pNPG)
[31]
1
.22
10.4 (cellobiose)
(
cellobiose)
53
52
60
70
6
t
t
1/2 70°C = 45 min
1/2 68°C = 1 hour
0.82
55.55
[32]
[8]
Thermoanaerobacterium
thermosaccharolyticum
6.4
0.62 (pNPG)
64 (pNPG)
7
.9 (cellobiose) 120 (cellobiose)
DSM 571
Thermotoga thermarum
DSM 5069T
55
56
90
4.8
7.0
t
t
t
1/2 90°C = 2 hours
1/2 95°C = 50 min
1/2 45°C = 20 min
0.59
142
[33]
[34]
Reticulitermes flavipes
<40
1.66 (pNPG)
1.44
22.92 (pNPG)
(
w/o CaCl
1/2 45°C = 30 min
with CaCl
1/2 55°C = 50 min
2
)
278 (cellobiose)
(
cellobiose)
t
(
2
)
Humicola insolens RP86
56
60
5-7
t
0.20 mmol/L
pNPG)
36.4 (pNPG)
[35]
(
183.4 (cellobiose)
0
.38 mmol/L
(
cellobiose)
Humicola grisea var.
thermoidea
57
51
40
40
6
Retained 80%
activity after
incubation at 40°C
for 1 hour
0.16
6.72 μmol/min
[36]
[37]
Marine microbial
6.5
Retained 70%
activity after
0.39 (pNPG)
50.7 (pNPG)

ACCEPTED MANUSCRIPT
metagenome
incubation at pH 7.5
and 15°C for 1 hour
20.4
(cellobiose)
15.5 (cellobiose)
n.a
Fervidobacterium
islandicum
53
90
6-7
t
t
1/2 90°C = 25 min
1/2 100°C = 15 min
n.a
[38]
soil metagenome
52
46
50
60
6
6
n.a
2.09
183.9
[39]
[40]
Thermoanaerobacterium
aotearoense P8G3#4
t
1/2 55°C = 90min
0.66 (pNPG)
25.45 (pNPG)
740.5 (cellobiose)
2
5.45
(
cellobiose)
Neosartorya fischeri
NRRL181
60
40
6
t
t
t
t
t
t
1/2 37°C = 480 min
1/2 40°C = 60 min
1/2 50°C = 17 min
1/2 60°C = 8 min
1/2 40°C = 60 min
1/2 45°C = 30min
2.8
1693
[41]
Exiguobacterium sp. DAU5
Weissella cibaria 37
Thermobifida fusca
52
50
53
45
45
50
7
2.33
31.6
[42]
[43]
[44]
5.5
7
0.92 μmol/min
0.92 μmol/min
29 (cellobiose)
Stable at 60°C and
0.34
rapidly inactivated at
(cellobiose)
65°C
Bacillus halodurans
51
45
8
Retained 80%
activity after
incubation at 45°C
for 1 hour
4
n.a
[45]
[46]
Hot spring metagenome
57
90
6.5
t
1/2 70°C = 14 hours
0.8
0.022 μmol/min
(
archaea)
a, b
Unless specified, the data were obtained with standard assay using pNPG as substrate.

ACCEPTED MANUSCRIPT
Table 2. Effects of metal ions and chemical reagents to the activity of BglD5
Metal ions/Chemical
reagents
Relative activity (%)
(5 mM or 5% v/v)
Reference
100
121
100
104
109
6
Calcium Chloride
Sodium Chloride
Potassium Chloride
Magnesium Chloride
Iron (III) Chloride
Nickel (II) Chloride
Cobalt (II) Chloride
Ammonium Chloride
Zinc Sulfate
3
4
95
7
Manganese Sulfate
Copper (II) Sulfate
Rubidium Chloride
Strondium Chloride
Barium Chloride
Urea
7
0
77
95
61
85
2
SDS
EDTA
4
Tween-20 (5% v/v)
Tween-80 (5% v/v)
Triton X-100 (5% v/v)
DMSO (5% v/v)
75
47
70
84

ACCEPTED MANUSCRIPT
Table 3. Hydrolysis of various substrates by purified BglD5
Substrates
Cellobiose
Cellotriose
Cellotetraose
Cellopentose
Cellohexanose
Salicin
Relative hydrolysis ability (%)
100
124
125
125
85
118
54
34
0
Gentibiose
Lactose
Sucrose
Maltose
0
Avicel
0
Carboxymethyl
cellulose
0
Sigmacell cellulose
Alpha-cellulose
Xylan
0
0
0

ACCEPTED MANUSCRIPT
Highlights



BglD5 is the first discovered beta-glucosidase from halophilic genus
Jeotgalibacilus.
BglD5 belongs to the Glycoside Hydrolase family 1 together with a lately
discovery beta-glucosidase from Anoxybacillus.
BglD5 is a class III (broad substrate specificity enzymes) beta-glucosidase

Figure 1

Figure 2

Figure 3

Figure 4

Figure 5