A pH-responsive silica–metal–organic framework hybrid nanoparticle for the delivery of hydrophilic drugs, nucleic acids, and CRISPR-Cas9 genome-editing machineries

Article abstract of DOI:10.1016/j.jconrel.2020.04.052

Efficient delivery of hydrophilic drugs, nucleic acids, proteins, and any combination thereof is essential for various biomedical applications. Herein, we report a straightforward, yet versatile approach to efficiently encapsulate and deliver various hydrophilic payloads using a pH-responsive silica–metal–organic framework hybrid nanoparticle (SMOF NP) consisting of both silica and zeolitic imidazole framework (ZIF). This unique SMOF NP offers a high loading content and efficiency, excellent stability, and robust intracellular delivery of a variety of payloads, including hydrophilic small molecule drugs (e.g., doxorubicin hydrochloride), nucleic acids (e.g., DNA and mRNA), and genome-editing machineries (e.g., Cas9-sgRNA ribonucleoprotein (RNP), and RNP together with donor DNA (e.g., RNP + ssODN)). The superior drug delivery/gene transfection/genome-editing efficiencies of the SMOF NP are attributed to its pH-controlled release and endosomal escape capabilities due to the proton sponge effect enabled by the imidazole moieties in the SMOF NPs. Moreover, the surface of the SMOF NP can be easily customized (e.g., PEGylation and ligand conjugation) via various functional groups incorporated into the silica component. RNP-loaded SMOF NPs induced efficient genome editing in vivo in murine retinal pigment epithelium (RPE) tissue via subretinal injection, providing a highly promising nanoplatform for the delivery of a wide range of hydrophilic payloads.

Full text of DOI:10.1016/j.jconrel.2020.04.052

Journal Pre-proof
A
pH-responsive silica–metal–organic framework hybrid
nanoparticle for the delivery of hydrophilic drugs, nucleic acids,
and CRISPR-Cas9 genome-editing machineries
Yuyuan Wang, Pawan K. Shahi, Ruosen Xie, Huilong Zhang, Amr
A. Abdeen, Nisakorn Yodsanit, Zhenqiang Ma, Krishanu Saha,
Bikash Pattnaik, Shaoqin Gong
PII:
S0168-3659(20)30266-2
DOI:
https://doi.org/10.1016/j.jconrel.2020.04.052
COREL 10305
Reference:
To appear in:
Journal of Controlled Release
Received date:
Revised date:
Accepted date:
29 September 2019
14 April 2020
30 April 2020
Please cite this article as: Y. Wang, P.K. Shahi, R. Xie, et al., A pH-responsive
silica–metal–organic framework hybrid nanoparticle for the delivery of hydrophilic drugs,
nucleic acids, and CRISPR-Cas9 genome-editing machineries, Journal of Controlled
Release (2019), https://doi.org/10.1016/j.jconrel.2020.04.052
This is a PDF file of an article that has undergone enhancements after acceptance, such
as the addition of a cover page and metadata, and formatting for readability, but it is
not yet the definitive version of record. This version will undergo additional copyediting,
typesetting and review before it is published in its final form, but we are providing this
version to give early visibility of the article. Please note that, during the production
process, errors may be discovered which could affect the content, and all legal disclaimers
that apply to the journal pertain.
©
2019 Published by Elsevier.

Journal Pre-proof
A pH-Responsive Silica–Metal–Organic Framework Hybrid Nanoparticle for the
Delivery of Hydrophilic Drugs, Nucleic Acids, and CRISPR-Cas9 Genome-Editing
Machineries
Yuyuan Wang1, 2, Pawan K. Shahi , Ruosen Xie , Huilong Zhang , Amr A. Abdeen ,
3
1, 2
4
2
2
, 5
4
2, 5
3, 6
Nisakorn Yodsanit , Zhenqiang Ma , Krishanu Saha , Bikash Pattnaik and Shaoqin
1
, 2, 5, 6, 7 *
Gong
1
2
. Department of Materials Science and Engineering, University of Wisconsin–Madison,
Madison, WI 53715, USA
. Wisconsin Institute for Discovery, University of Wisconsin–Madison, Madison, WI 53715,
USA
3
4
. Department of Pediatrics, University of Wisconsin - Madison, Madison, WI 53706, USA.
. Department of Electrical and Computer Engineering, University of Wisconsin–Madison,
Madison, WI 53706, USA
5
6
7
*
. Department of Biomedical Engineering, University of Wisconsin–Madison, Madison, WI
5
3715, USA
. McPherson Eye Research Institute, University of Wisconsin-Madison, Madison, WI
3705, USA
5
. Department of Chemistry, University of Wisconsin–Madison, Madison, WI 53715, USA
: Correspondence should be addressed to SG (shaoqingong@wisc.edu)
Abstract
Efficient delivery of hydrophilic drugs, nucleic acids, proteins, and any combination
thereof is essential for various biomedical applications. Herein, we report a
straightforward, yet versatile approach to efficiently encapsulate and deliver various
hydrophilic payloads using a pH-responsive silica–metal–organic framework hybrid
nanoparticle (SMOF NP) consisting of both silica and zeolitic imidazole framework (ZIF).
This unique SMOF NP offers a high loading content and efficiency, excellent stability,
and robust intracellular delivery of a variety of payloads, including hydrophilic small
molecule drugs (e.g., doxorubicin hydrochloride), nucleic acids (e.g., DNA and mRNA),
and genome-editing machineries (e.g., Cas9-sgRNA ribonucleoprotein (RNP), and RNP
together with donor DNA (e.g., RNP+ssODN)). The superior drug delivery/gene
transfection/genome-editing efficiencies of the SMOF NP are attributed to its pH-
1

Journal Pre-proof
controlled release and endosomal escape capabilities due to the proton sponge effect
enabled by the imidazole moieties in the SMOF NPs. Moreover, the surface of the SMOF
NP can be easily customized (e.g., PEGylation and ligand conjugation) via various
functional groups incorporated into the silica component. RNP-loaded SMOF NPs
induced efficient genome editing in vivo in murine retinal pigment epithelium (RPE)
tissue via subretinal injection, providing a highly promising nanoplatform for the
delivery of a wide range of hydrophilic payloads.
1
. Introduction
Intracellular delivery of hydrophilic drugs, nucleic acids, and proteins plays an important
role in medicine, including targeted drug delivery, gene therapy, and genome editing[1-4].
Nevertheless, efficient encapsulation and delivery of hydrophilic payloads while retaining their
active conformations remains a significant challenge. A desirable delivery system would be
able to encapsulate bioactive molecules with a high loading efficiency without compromising
their biological activity.
The use of inorganic nanoparticles (NPs) (e.g., gold NPs, calcium phosphate NPs, silica-
based NPs) has emerged as a promising strategy for efficient drug/gene delivery[5-7]. Silica
NPs have shown remarkable potential in nanomedicine due to their unique properties, such as
high stability, multifunctionality, and biocompatibility[8-10]. However, stimuli-responsive
silica NPs are either difficult to design (i.e., pH-responsive), or require unstable/hard-to-
synthesize silica monomers (i.e., GSH-responsive)[11, 12], thus hindering their delivery
efficiency.
Metal–organic frameworks (MOFs), a class of materials formed by the covalent assembly
of polydentate bridging ligands and metal-connecting points, have been studied for drug, gene,
and genome-editing machinery delivery[13-15]. Zeolitic imidazolate framework (ZIF) is a
2

Journal Pre-proof
subclass of metal−organic frameworks formed by coordination between Zn2+ ions and 2-
methylimidazole (2-MIM) with good biocompatibility[16, 17]. Moreover, the excellent pH-
buffering capacity of the imidazole bridging ligand confers pH-responsive capabilities to the
ZIF, as well as an enhanced ability to escape the endocytic pathway[18]. ZIF-based
nanosystems have been used for drug, gene, and protein delivery[18-20].
Herein, we report the fabrication of a pH-responsive silica–metal–organic framework
hybrid NP (SMOF NP) consisting of both silica and ZIF via a facile water-in-oil emulsion
approach, allowing for the delivery of a variety of hydrophilic payloads including small
molecule drugs, nucleic acids, and genome-editing machineries. Hydrophilic payloads can be
encapsulated in the NPs with a high loading content (> 9 wt%) and a high loading efficiency
(> 90%). The proton sponge effect of imidazole in the ZIF moiety of the SMOFNPs contributes
to the pH-controlled release and endosomal escape capabilities, while the surface of the SMOF
NP is customizable via functional groups in the silica component.
We studied the genome editing efficiency in murine retinal pigmented epithelium (RPE),
as genetic disorders in the RPE can cause a variety of eye diseases (e.g., retinal degeneration
and blindness) [21]. SMOF NPs were decorated with a targeting ligand, all-trans retinoic acid
(ATRA) (i.e., SMOF-ATRA). ATRA binds to the inter-photoreceptor retinoid-binding protein,
a major protein in the inter-photoreceptor matrix that selectively transports all-trans-retinol to
the RPE and 11-cis-retinal to photoreceptor[22, 23]. SMOF-ATRA generated robust gene
editing in murine retinal pigment epithelium (RPE) after local administration. This stable,
biocompatible, and multifunctional SMOF NP is a promising nanoplatform capable of
efficiently delivering a variety of hydrophilic payloads.
2
. Experimental Section
Materials
3

Journal Pre-proof
1
H-imidazole-4-carboxylic acid, thionyl chloride (SOCl2), tetraethyl orthosilicate
(TEOS), tetrahydrofuran (THF), Triton X-100, acetone, ethanol, ammonia (30% in water) 1-
ethyl-3-(3-dimethylaminopropyl)carbodiimide (EDC), and N-hydroxysuccinimide (NHS)
were purchased from Fisher Scientific, USA. Hexanol, cyclohexane, 2-methyl-1H-imidazole
(2-MIM), (3-aminopropyl)triethoxysilane (APTES), and doxorubicin hydrochloride
(DOXHCl) were bought from Tokyo Chemical Industry Co., Ltd., USA.
Methoxypolyethylene glycol-N-succinimidyl ester (mPEG-NHS, Mn = 5000) and hydroxyl-
polyethylene glycol-N-succinimidyl ester (HO-PEG-NHS, Mn = 5000) were obtained from
Jenkem Technology, USA. Anhydrous zinc nitrate (ZnNO3) and all-trans retinoic acid (ATRA)
were purchased from Sigma–Aldrich, USA. Nuclear localization signal (NLS)-tagged
streptococcus pyogenes Cas9 nuclease (sNLS–SpCas9–sNLS) was provided by Aldevron,
USA.
Synthesis of N-(3-(Triethoxysilyl)propyl)-1H-Imidazole-4-Carboxamide (TESPIC)
A 1H-imidazole-4-carboxylic acid (500 mg, 3.85 mmol) solution in SOCl2 (8 ml) was
heated while stirring to reflux overnight. The reaction mixture was cooled to room temperature
and added into toluene. The precipitate was then collected by filtration and dried in vacuo at
room temperature to yield the acid chloride intermediate, 1H-imidazole-4- carbonyl chloride.
The freshly synthesized 1H-imidazole-4-carbonyl chloride was suspended in anhydrous THF
(5 ml), followed by addition of Triethylamine (855 mg, 8.47 mmol) and APTES (851 mg, 3.85
mmol). The mixture was stirred at room temperature overnight under a nitrogen atmosphere.
The mixture was subsequently filtered, and the solvent was then removed by rotary evaporation
to yield the final product TESPIC. Since the silica reactants have the tendency to undergo
hydrolysis/polymerization during column purification, TESPIC was synthesized and used
1
without purification for SMOF NP formation[11, 24]. H NMR (400 MHz, DMSO-D6): δ 0.60
(dd, 2.4 H, J = 14.6, 6.2 Hz), δ 1.12 (t, 0 H, J = 7.0 Hz), δ 1.57 (dt, 2 H, J = 15.9, 8.0 Hz), δ
4

Journal Pre-proof
1
3
2
.83–2.61 (m, 2 H), δ 3.70 (q, 6 H, J = 6.0 Hz), δ 7.03 (s, 1 H), δ 7.40 (s, 1 H). C NMR (100
MHz, DMSO-D6): δ 165.76, 135.50, 132.89, 128.21, 58.01, 42.55, 22.88, 18.64, and 7.55.
Preparation of Silica–Metal–Organic Framework Hybrid Nanoparticles (SMOF NPs)
SMOF NPs were synthesized by a water-in-oil emulsion method. Triton X-100 (1.75 ml)
and hexanol (1.75 ml) were dissolved in cyclohexane (7.5 ml) to form the organic phase. An
aqueous ZnNO3 (0.5 M) solution (20 μl) containing the desirable payload (e.g., DOXHCl,
DNA, mRNA, RNP, and RNP+ssODN; 5 mg/ml) was mixed with 400 µl of the organic phase.
This mixture was vortexed for 15 s and then sonicated in an ultrasonic water bath for 15 s to
form the water-in-oil emulsion, which was then magnetically stirred at 1500 rpm. To this
emulsion, TEOS, TESPIC, APTES, and 2-MIM with different feed weight ratios were
dissolved in 100 µl organic phase and added to the above emulsion. For example, to achieve a
feed weight ratio of silica reactants (i.e., TEOS, TESPIC, APTES) to MOF reactant (i.e., 2-
MIM) of 60:40, the total weight of TEOS+TESPIC+APTES added to the emulsion would be
1
.2 mg, while the weight of 2-MIM would be 0.8 mg. Upon the addition of 3 µL of 30%
ammonia aqueous solution, the mixture was stirred for 4 h at room temperature. Thereafter,
mPEG-NHS (100 μg in 100 μl hexanol) was added to the above emulsion and was stirred for
another 2 h. To prepare ATRA-modified SMOF NPs (i.e., SMOF-ATRA), HO-PEG-NHS was
used instead of mPEG-NHS. The final payload-encapsulated SMOF NPs were precipitated by
6
00 μl acetone, and then washed by ethanol and water three times each.
ATRA was conjugated to the SMOF NP surface via EDC/NHS catalyzed esterification.
Payload-encapsulated SMOF NPs (0.5 mg) were re-dispersed in 0.5 ml DI water. EDC (60 μg),
NHS (60 μg) and a DMSO solution of ATRA (6 μg in 3 μl DMSO) were added to the above
solution, and the pH was adjusted to 8. The solution was stirred at room temperature for 6 h,
and then the SMOF-ATRA was washed by water three times.
5

Journal Pre-proof
Characterization
The chemical structure of TESPIC was analyzed by nuclear magnetic resonance (NMR)
spectroscopy (Avance 400, Bruker Corporation, USA). The hydrodynamic diameter and zeta
potential of the SMOF NPs were characterized by a dynamic light scattering (DLS)
spectrometer (Malvern Zetasizer Nano ZS) at a 90° detection angle with a concentration of 0.1
mg/ml. The morphologies of SMOF NPs were characterized by transmission electron
microscopy (TEM, Tecnai 12, Thermo Fisher, USA) and scanning electron microscopy (SEM,
Zeiss/LEO 1530, Carl Zeiss Microscopy, USA). X-ray powder diffraction of SMOF NPs was
performed by Bruker D8 Discovery (Bruker Corporation, USA).
Loading Content/Loading Efficiency Study
To calculate the loading content and loading efficiency of the payloads in the SMOF NPs,
-
1
1
mg∙mL of SMOF NP stock solution with different payloads were prepared. Thereafter, 10
µL of SMOF NP was incubated with 40 µL of acetate buffer (0.1 M, pH 5.5) for 30 min to
allow for complete dissociation of SMOF NPs. The DOXHCl loading content/efficiency was
studied by UV-Vis spectroscopy. The RNP and RNP-ssODN loading contents/efficiencies
were measured via a bicinchoninic acid assay (BCA assay, Thermo Fisher, USA). DNA and
mRNA loading contents/efficiencies were evaluated using a NanoDrop One (Thermo Fisher,
USA).
Cell Culture
o
Cells were cultured in a cell culture incubator (Thermo Fisher, USA) at 37 C with 5%
carbon dioxide at 100% humidity. HEK 293 cells (a human embryonic kidney cell line), NHDF
(a normal human dermal fibroblast cell line), and RAW 264.7 cells (a mouse macrophage cell
line) were purchased from ATCC (USA) and cultured with DMEM medium (Gibco, USA)
with 10% (v/v) fetal bovine serum (FBS, Gibco, USA) and 1% (v/v) penicillin–streptomycin
6

Journal Pre-proof
(
Gibco, USA). HCT 116 cells (a human colon cancer cell line) were cultured with 89%
McCoy’s 5A medium, 10% FBS, and 1% penicillin–streptomycin. All the culture media used
for hydrophilic drug delivery/nucleic acid transfection/genome editing efficiency studies were
complete culture media containing 10% FBS.
Hydrophilic Drug Delivery Study
The cellular uptake behavior of DOXHCl-loaded SMOF NPs was analyzed using flow
cytometry. HEK 293 cells were seeded onto 96-well plates with 15,000 cells per well 24 h
before treatment. The cells were incubated with free DOXHCl and DOXHCl-loaded SMOF
NPs for 4 h with a DOXHCl concentration of 5 μg/ml. Thereafter, cells were harvested with
0
.25% trypsin-EDTA (Thermo Fisher, USA), spun down, and resuspended with 200 μl PBS
(Thermo Fisher, USA). DOXHCl uptake was detected with an Attune NxT flow cytometer
system (Thermo Fisher, USA) and analyzed with FlowJo 7.6.
DNA and mRNA Transfection Efficiency Study
HEK 293, HCT116, NHDF, and RAW 264.7 cells were seeded onto 96-well plates at a
density of 15,000 cells per well 24 h prior to treatment. Cells were transfected with either a
green fluorescence protein (GFP) plasmid DNA (Addgene #40259, USA)-loaded SMOF NPs,
or a GFP-mRNA (OZ Biosciences INC, San Diego, CA)-loaded SMOF NPs, The dosage of
DNA or mRNA dosages is 200 ng/well, the SMOF NP concentrations for DNA- and mRNA-
loaded SMOF NPs were 21 μg/ml and 22 μg/ml, respectively. DNA or mRNA was also
transfected using a commercially available transfection agent, Lipofectamine 2000 (i.e., Lipo
2
000, Thermo Fisher, USA), as a positive control group. The Lipofectamine-DNA complex
was prepared as suggested by the manufacturer. The amount of Lipo 2000 and DNA (or mRNA)
used per well was 0.5 μl and 200 ng, respectively. An untreated group was used as the negative
7

Journal Pre-proof
control group. After 48 h, HEK 293, HCT116, and NHDF cells were harvested with 0.25%
trypsin-EDTA. RAW264.7 cells were harvested by repeated pipetting. The cells were then spun
down and resuspended with 200 μl of PBS. GFP expression efficiencies were obtained with a
flow cytometer and analyzed with FlowJo 7.6. Gating strategies are shown in Figure S7.
RNP Genome-Editing Efficiency Study
GFP-expressing HEK 293 cells (GenTarget Inc.) were used as an RNP-transfection cell
model. Cells were seeded at a density of 5,000 cells per well onto 96-well plates, 24 h before
treatment. RNP was prepared as previously reported [25] by mixing sNLS–SpCas9–sNLS and
in vitro transcribed sgRNA (Integrated DNA Technologies, Inc., GFP protospacer: 5’-
GCACGGGCAGCTTGCCGG-3’) at a 1:1 molar ratio. Cells were treated with Lipo 2000 (0.5
μl/well) complexed with RNP or RNP-loaded SMOF NPs. The RNP dosage was kept at 150
ng/well (i.e., an equivalent Cas9 protein dosage of 125 ng/well). An untreated group was used
as the control group. A quantity of 100 μl of fresh culture medium was added into each well
4
8 h after treatment and thereafter; half of the culture medium was refreshed every 48 h. Six
days after treatment, cells were harvested with 0.25% trypsin-EDTA, spun down, and re-
suspended with 200 μl of PBS. The RNP genome-editing efficiencies were quantified via flow
cytometry. Data were analyzed with FlowJo 7.6.
RNP+ssODN Co-Delivery for Precise Gene Correction
The RNP+ssODN mixture was prepared by simply mixing the as-prepared RNP and single-
o
stranded oligonucleotide DNA (ssODN) donor template at 4 C for 5 min at a 1:1 molar ratio.
Blue fluorescence protein (BFP)-expressing HEK 293 cells generated through lentiviral
transduction of a BFP dest clone (Addgene, Cambridge, MA) was employed as a model cell
line[25]. When cells are transfected with RNP+ssODN-targeting BFP (Integrated DNA
Technologies, Inc., BFP protospacer: 5’-GCTGAAGCACTGCACGCCAT-3’), if precise
8

Journal Pre-proof
editing occurs, three nucleotides within the BFP gene are edited and converted to a green
fluorescent protein (GFP) gene as described previously (BFP to GFP ssODN sequence: 5’-
TCATGTGGTCGGGGTAGCGGCTGAAGCACTGCACGCCATGGGTCAGGGTGGTCA
CGAGGGTGGGCCAGGGCACCGGCAGCTTGCCGGTGGTGCAGATGAA-3’, changing
BFP to GFP via alternation of histidine to tyrosine) [25, 26]. BFP-expressing HEK 293 cells
were seeded at a density of 15,000 cells per well onto a 96-well plate 24 h before treatment.
Cells were treated with Lipo 2000 (0.5 μl/well) carrying RNP and ssODN or with
RNP+ssODN-loaded SMOF NPs. For each treatment, the RNP+ssODN dosage was kept at
1
75 ng/well (i.e., an equivalent Cas9 protein dosage of 125 ng/well). The precise gene-editing
efficiencies were quantified six days after treatment using flow cytometry by counting the
percentage of green fluorescence positive cells. Data were analyzed with FlowJo 7.6.
Intracellular Trafficking of RNP SMOF NPs
Intracellular trafficking of RNP SMOF NPs was investigated by confocal laser scanning
microscopy (CLSM, Nikon, Japan). In this case, ATTO550-labeled sgRNA (Integrated DNA
Technologies, Inc.) was used to form the Cas9/ATTO-sgRNA RNP loaded into the SMOFNPs.
HEK 293 cells were seeded onto a Nunc™ Lab-Tek™ II CC2™ chamber slide (Thermo Fisher,
USA) at 50,000 cells per well 24 h prior to treatment. At each time point (i.e., 0.5, 2, and 4 h)
after SMOF NP treatment, the cells were washed by PBS and then stained with
endosome/lysosome marker LysoTracker Green DND-26 (100 nM) and nucleus marker
o
Hoechst 33342 (10 μg/mL) for 30 min at 37 C.
Cell Viability Assay
The cytotoxicity of the DOXHCl-loaded SMOF NPs was studied using an MTT assay.
HEK 293 cells were seeded onto 96-well plates with 20,000 cells per well 24 h prior to
treatment. The cells were then treated with free DOXHCl, DOXHCl-loaded SMOF NPs, and
9

Journal Pre-proof
empty SMOF NPs (DOXHCl concentrations of 6 and 12 μg/ml). Cells without treatment were
used as a control group. After 48 h, the cell viability was measured using a standard MTT assay
(Thermo Fisher, USA). Briefly, cells were treated with media containing 500 μg/ml MTT and
incubated for 4 h. Then, the MTT-containing media was aspirated. Next, the purple precipitate
was dissolved in 150 μl of DMSO. The absorbance at 560 nm was obtained with a microplate
®
reader (GloMax Multi Detection System, Promega, USA).
The cytotoxicity of SMOF NPs was also studied by MTT assay. Cells were treated with
complete medium, Lipo 2000 (0.5 µl/well), and empty SMOF NPs, whose concentrations
ranged from 10 to 200 µg/ml. Cell viability was measured using a standard MTT assay 48 h
after treatment (Thermo Fisher, USA), as mentioned above.
Subretinal Injection
All animal research was approved by UW-Madison animal care and use committee. Ai14
reporter mice (obtained from The Jackson Laboratory) were used to assess the genome editing
efficiency induced by RNP-loaded SMOF NPs. C57BI/6 mice were used as the controls for
biocompatibility studies. RNPs were prepared using either a sgRNA targeting the stop cassette
composed of 3 SV40 polyA blocks (target sequence: 5’-AAGTAAAACCTCTACAAATG-3’)
in Ai14 mice or a mouse negative control sgRNA (Integrated DNA Technologies, guide
sequence: CGTTAATCGCGTATAATACG). Subretinal injection and subsequent RPE tissue
collection were performed as reported previously [27]. Mice were maintained under tightly
controlled temperature (23 ± 5 °C), humidity (40-50%), and light/dark (12/12 h) cycle
conditions under a 200 lux light environment. The mice were anesthetized by intraperitoneal
injection of ketamine (80 mg/kg), xylazine (16 mg/kg) and acepromazine (5 mg/kg) cocktail.
Before the subretinal injection, the cornea was anesthetized with a drop of 0.5% proparacaine
HCl, and the pupil was dilated with 1.0% tropicamide ophthalmic solution. Mice were placed
1
0

Journal Pre-proof
on a temperature-regulated heating pad during the injection and for recovery purposes. All
surgical manipulations were carried out under a surgical microscope (AmScope, Irvine, CA).
SMOF-ATRA encapsulating RNP with a sgRNA targeting the Ai14 stop cassette (i.e., Ai14
RNP SMOF), SMOF-ATRA encapsulating RNP with a negative control sgRNA (i.e., negative
control SMOF), and PBS were injected into the eyes subretinally. Two microliters of SMOF-
ATRA solutions containing 4 μg RNP or PBS was injected into the subretinal space using a
UMP3 ultramicro pump fitted with a NanoFil syringe, and the RPE-KIT (all from World
Precision Instruments, Sarasota, FL) equipped with a 34-gauge beveled needle. Successful
administration was confirmed by visualization of bleb formation. The tip of the needle
remained in the bleb for 10 s after bleb formation, when it was gently withdrawn.
To assess tdTomato expression generated by successful genome editing, the mice were
sacrificed, and eyes were collected 13 to 14 days after injection and rinsed twice with PBS. A
puncture was made at ora serrata with an 18-gauge needle, and the eye was opened along the
corneal incisions. The lens was then removed. The eyecup was incised radially to the center
and flattened to give a final floret shape. The RPE layer was then separated and flat-mounted
on a cover-glass slide. RPE tissues were imaged with a NIS-Elements using a Nikon C2
confocal microscope (Nikon Instruments Inc.). ImageJ (NIH) was used for image analysis.
Electroretinography of the Retina
To study the biocompatibility of SMOF NP after subretinal injection, we tested visual
function before sacrificing the mice via electroretinography (ERG). PBS and Ai14 RNP-loaded
SMOF-ATRA were injected to the eyes of C57BI/6 mice subretinally. Fourteen days post-
injection, animals were anesthetized as described above. All experiments were performed in a
dark room. An Espion Ganzfeld full-field system (Diagnosys LLC, Lowell, MA) was used for
ERG recordings. A drop of 2% hypromellose (GONIOVISC, HUB Pharmaceuticals, LLC,
1
1

Journal Pre-proof
Rancho Cucamonga, CA) solution was placed on the cornea to keep it moistened and to provide
an electrical contact with the ERG electrode. The mice were placed under the Ganzfeld dome
to assure uniform illumination of the eyes. The eyes were exposed to a sequential increment of
flash intensities (0.01 to 30 cd.s/m^2) for 400 ms with a 2 s interval between each flash for a
and b- wave and eyes were exposed 25 cd.s/m^2 for 4 secs to measure c-wave. The data were
analyzed using Diagnosys software version 6.0.54 (Diagnosys LLC, Lowell, MA).
Statistical Analysis
Results are presented as mean ± standard deviation (SD). One-way analysis of variance
(ANOVA) with Tukey’s multiple comparisons was used to determine the difference between
independent groups. Statistical analyses were conducted using GraphPad Prism software
version 6.
3
. Results and Discussion
Silica–metal–organic framework hybrid nanoparticles (SMOF NPs) were synthesized via
a facile water-in-oil emulsion method (Figure 1A and B). An aqueous solution containing zinc
ions at a constant concentration (0.5 M) and the desirable payload was emulsified in the
continuous oil phase, followed by additions of the silica reactants and the imidazole reactant
(i.e., 2-methylimidazole (2-MIM)), which coordinates with the zinc ions and forms the pH-
responsive zeolitic imidazole framework (ZIF)) (Figure 1C). The silica-reactive components
included tetraethyl orthosilicate (TEOS), a basic building block that constructs the silica
network; imidazole-containing N-(3-(triethoxysilyl)propyl)-1H-imidazole-2-carboxamide
(
TESPIC) that bridges the silica component with the ZIF component; and amine-containing (3-
aminopropyl)triethoxysilane (APTES) that enables surface modification. Polyethylene glycol
PEG) was subsequently incorporated onto the SMOF NP surface after the formation of the
SMOF NP, which allowed for further surface functionalization (e.g., conjugation of targeting
(
1
2

Journal Pre-proof
ligands and imaging agents). The as-prepared SMOF NPs were then collected by precipitation
in acetone, centrifuged, and washed by ethanol and deionized (DI) water three times each to
remove all impurities.
Figure 1. Design and synthesis of SMOF NPs. (A) Illustration of the SMOF NP for the
delivery of various hydrophilic payloads such as hydrophilic small molecular drugs, DNA,
mRNA, proteins, and a combination thereof (e.g., Cas9/sgRNA (RNP) and RNP+ssODN). (B)
Synthesis of SMOF NPs via a water-in-oil emulsion method. (C) Schematic illustration of the
intracellular trafficking pathways of SMOF NPs. SMOF NP: silica–metal–organic framework
hybrid nanoparticle; 2-MIM: 2-methylimidazole; PEG: polyethylene glycol; TEOS: tetraethyl
orthosilicate; TESPIC: N-(3-(triethoxysilyl)propyl)-1H-imidazole-2-carboxamide; APTES:
(3-aminopropyl)triethoxysilane.
1
3

Journal Pre-proof
The SMOF NP formulation was first optimized in a human embryonic kidney cell line
(
HEK 293) using plasmid DNA (Figure 2) and mRNA (Figure S2) as the payloads. The zinc
ion concentration in the aqueous phase was fixed at 0.5 M, while various factors were
optimized including the feed ratio of the payload to the SMOF NP reactants, the feed ratio of
the silica reactants (TEOS+APTES+TESPIC) to the MOF reactant (2-MIM), and the
emulsification process (e.g., bath sonication versus probe sonication).
The feed weight ratio between the payload and the SMOF NP reactants is important, as
insufficient SMOF NP forming materials may lead to a limited encapsulation volume and
subsequently, a low loading efficiency and premature release and degradation of the payloads.
The optimal formulation showing the highest DNA transfection efficiency was obtained at a
DNA:SMOF reactant feed ratio of 1:20, indicating successful encapsulation of the payload
within the SMOF NPs and an efficient intracellular release thereafter (Figure 2A).
The feed weight ratio between the silica reactants (i.e., TEOS+APTES+TESPIC) and the
MOF reactant (i.e., 2-MIM) is another critical factor for efficient payload delivery. Without the
silica component, surface functionalization of the resulting MOF/ZIF NPs is very challenging
because various functional groups can be conveniently introduced into the SMOF NPs through
judicious selection of the silica reactants. Without the MOF component, silica NPs alone can
neither escape endosomes and lysosomes efficiently nor release the payload rapidly in response
to pH, thereby greatly minimizing the delivery efficiency. As shown in Figure 2A, both pure
silica NPs and pure MOF NPs formed via water-in-oil emulsions exhibited limited DNA
transfection efficiencies. Moreover, pure MOF NPs showed larger particle sizes (>350 nm and
polydispersed) after purification, indicating inadequate PEGylation and thus NP aggregation.
The molar ratio of the three silica reactants—namely, TEOS, APTES, and TESPIC—was
1
4

Journal Pre-proof
further optimized (Figure 2B). The optimal formulation showing the highest DNA transfection
efficiency was obtained when the molar ratio of TEOS:APTES:TESPIC was 80:10:10.
To evaluate the necessity of using a TEOS:APTES:TESPIC ternary composition to form
the silica component in the SMOF NP instead of unary or binary counterparts, the SMOF NP
formulation without TESPIC (i.e., TEOS:APTES:TESPIC, molar ratio of 90:10:0) was first
tested. The resulting SMOF NPs exhibited significantly lower DNA transfection efficiencies,
indicating that TESPIC was essential for bridging the silica component to the MOF component
within the hybrid SMOF NPs. Moreover, the formulation without APTES (i.e.,
TEOS:APTES:TESPIC, molar ratio of 90:0:10) also showed large and polydispersed particle
sizes and limited the transfection efficacy due to the lack of surface PEGylation and NP
aggregation. However, higher APTES or TESPIC ratios did not provide any advantage in
achieving higher transfection efficiencies (Figure 2B).
The sonication method also plays an important role in SMOF NP synthesis as it facilitates
emulsification and controls the water droplet size in the emulsion. However, sonication that is
too strong may affect the integrity of the biomacromolecular payload and thus reduce delivery
efficiency. Using probe sonication for as short as 15 s can reduce the DNA transfection
efficiency by 50% in comparison with the DNA transfection efficiency achieved via a gentler
sonication method (i.e., vortex (15 s) + bath sonication (15 s)) (Figure 2A). This is consistent
with previous reports in that probe sonication can damage DNA [28, 29]
1
5

Journal Pre-proof
Figure 2. Optimization of the DNA-loaded SMOF NP formulation using HEK 293 cells.
(A) Optimization of the feed weight ratio of the payload over the SMOF reactants, feed weight
ratio of the silica reactants to the MOF reactant, and the emulsification method. (B)
Optimization of the molar ratio of the three silica reactants TEOS/APTES/TESPIC. The
optimal SMOF NP formulation is highlighted by a black bar. NS: not significant; *: p < 0.05;
*
*: p < 0.01; ***: p < 0.001; ****: p < 0.0001; n = 3.
The morphology of the DNA-loaded SMOF NP was characterized by scanning electron
microscopy (SEM) and transmission electron microscopy (TEM). Spherical NPs with uniform
sizes around 50–70 nm were observed, as shown in Figure 3A and B. The hydrodynamic
diameter of DNA-loaded SMOF NPs, as measured by dynamic light scattering (DLS), was 110
1
6

Journal Pre-proof
nm (Figure 3C), similar to empty SMOF NPs, (119 nm, Figure S3). Zeta-potential
measurements indicated that the DNA-loaded SMOF NPs had a slight positive surface charge
(5.6 ± 1 mV), similar to empty SMOF NPs (4.8 mV). Powder X-ray diffraction (XRD) spectra
showed that SMOFNPs had similar crystal structures to ZIF (Figure 3D). The ratio of the silica
components and ZIF component in the SMOF NPs is controlled by the feed weight ratio of the
silica reactants (i.e., TEOS, TESPIC, and APTES) and the ZIF reactant (i.e., 2-MIM). The ratio
of the silica component and the ZIF component in the SMOF NPs was studied by energy-
dispersive X-ray spectroscopy (EDS). As shown in Figure S1, with the optimal feed weight
ratio of the silica reactants to the ZIF reactant at 6:4, the elemental weight ratio between silicon
(Si) and zinc (Zn) was 63:37 in the final SMOF NP, which is approximately equivalent to a 1:1
weight ratio of silica to ZIF.
1
7

Journal Pre-proof
Figure 3. Characterization of SMOF NPs. (A) TEM and (B) SEM micrographs of SMOF
NPs. (C) Size distribution of SMOFNPs measured by DLS. (D) Powder XRD spectra of SMOF
NP, pure MOF NP, and pure silica NP synthesized via the water-in-oil emulsion method.
The SMOF NP contains a pH-responsive ZIF component that degrades in acidic
environments, leading to a rapid release of the payload [18]. Meanwhile, the ZIF component
can also facilitate the endosomal escape of the payload because the imidazole groups (pKa ∼
6
.0) can be protonated in the acidic endocytic compartments (i.e., endosomes), leading to
endosomal- membrane disruption by the proton sponge effect. To study the intracellular
1
8

Journal Pre-proof
trafficking of SMOF NPs, confocal laser scanning microscopy (CLSM) was used to image the
subcellular distribution of Cas9/ATTO550-labeled sgRNA ribonucleoprotein (RNP) delivered
by SMOF NPs (Figure 4). Cells without SMOF NP treatment were used as the control (Figure
S4). No significant alternation in cell morphology and integrity was observed in the SMOF NP
treated groups in comparison with the control group, indicating that SMOF NP treatment does
not affect cell morphology. RNP was observed to co-localize with endo/lysosomes 0.5 h post-
treatment, indicating that the uptake of RNP-loaded SMOF NPs occurred via endocytosis. The
extent of co-localization of RNP and endo/lysosomes decreased 2 h post-treatment, indicating
the efficient endo/lysosomal escape capabilities of SMOF NPs. Assisted by a nuclear
localization signal (NLS) fused on both terminuses of the Cas9 nuclease, the RNP signal
showed considerable overlap with the nucleus and minimal co-localization with
endo/lysosomes as early as 4 h post-treatment, thus indicating the efficient escape from
endo/lysosomes and the successful nuclear transportation of RNP.
Figure 4. Intracellular trafficking of RNP-loaded SMOF NPs by CLSM. Colocalization of
RNP and endo/lysosomes was studied at 0.5 h, 2 h, and 4 h post-treatment. Scale bar: 50 μm.
1
9

Journal Pre-proof
To investigate the versatility of SMOF NPs for the delivery of different hydrophilic
payloads, including small molecule drugs (i.e., doxorubicin hydrochloride (DOXHCl)),
nucleic acids (i.e., DNA and mRNA), and CRISPR-Cas9 genome-editing machineries (i.e.,
RNP and RNP+ssODN (i.e., a combination of an RNP with a single-stranded oligonucleotide
DNA (ssODN) donor template)), the loading content and loading efficiency of different
payloads are quantified and summarized in Table 1. For small molecule DOXHCl, the loading
content was 17 wt%, with a loading efficiency of 92%. For hydrophilic biomacromolecules,
the loading contents varied between 9.2–9.8 wt%, while the loading efficiencies ranged from
9
1–97%. The high loading contents and efficiencies can be attributed to the water-in-oil
emulsion method that confined the payloads within the water droplet, followed by the
formation of the SMOF NP network.
Table 1. Summary of loading content and loading efficiency of different payloads by SMOF
NPs.
Payload
Loading Content (wt%)
Loading Efficiency (%)
92
Doxorubicin
hydrochloride
1
7
DNA
mRNA
9.5
9.2
9.8
9.5
94
91
97
94
RNP
RNP+ssODN
Efficient delivery of DOXHCl via SMOF NPs was first studied by flow cytometry in
HEK293 cells by taking advantage of the fluorescence of DOXHCl. Cells without DOXHCl
treatment were used as a control. As shown in Figure 5A, DOXHCl -loaded SMOF NP-treated
cells exhibited a 3.2-fold higher level of DOXHCl uptake than free DOXHCl -treated cells 2
h post-treatment, indicating the efficient uptake of SMOF NPs by HEK293 cells. The cellular
2
0

Journal Pre-proof
uptake of DOXHCl -loaded SMOF NPs was also confirmed by fluorescence microscopy
(Figure S3) 4 h post-treatment. The therapeutic effect of DOXHCl -loaded SMOF NPs was
evaluated by an MTT assay (Figure 5B). At both 6 μg/ml and 12 μg/ml DOXHCl
concentrations, the DOXHCl -loaded SMOF NPs exhibited identical cytotoxicity to free
DOXHCl, while empty SMOF NPs showed no significant cytotoxicity. These results
demonstrated the efficient delivery and release of DOXHCl by SMOF NPs.
Figure 5. Delivery Efficiency of a hydrophilic drug by SMOF NPs. (A) Flow cytometry
analysis on HEK293 cells treated with free DOXHCl (5 μg/ml) and DOXHCl-loaded SMOF
NPs (DOXHCl concentration, 5 μg/ml) or medium alone (control) for 2 h. (B) Cytotoxicity of
empty SMOF NPs, free DOXHCl and DOXHCl-loaded SMOF NPs at different DOXHCl
concentrations (i.e., 6 and 12 μg/ml) after co-incubation with HEK293 cells for 48 h.
The transfection efficiency of DNA-loaded SMOF NPs was studied in four different cell
types, including a HEK293 cell line, a human colon tumor (HCT116) cell line, a human normal
dermal fibroblast (NHDF) cell line, and a rat macrophage (RAW264.7) cell line. In HCT116
cells, DNA-loaded SMOF NPs exhibited a similar transfection efficiency to the commercially
available transfection agent Lipofectamine 2000 (Lipo 2000), while in the other three cell lines,
SMOF NP showed statistically higher transfection efficiencies than Lipo 2000 (1.4-fold in
HEK293 cells, 1.2-fold in NHDF cells and RAW264.7 cells, as shown in Figure 6A), . For
mRNA-loaded SMOF NPs, they showed similar transfection efficiencies to Lipo 2000 in
2
1

Journal Pre-proof
HEK293 and NHDF cells, but statistically higher transfection efficiencies in HCT116 and
RAW264.7 cells (1.9- and 1.3-fold, respectively, as shown in Figure 6B), indicating efficient
delivery of nucleic acids by SMOF NPs.
Cas9 can cleave double-stranded DNA from a specific genomic locus under the guidance
of sgRNA. After the double-stranded DNA break is generated, gene deletion can be achieved
by the nonhomologous end-joining (NHEJ) DNA repair pathway[30, 31]. To investigate the
genome-editing efficiency of RNP-loaded SMOF NPs, a sgRNA targeting the GFP gene in a
transgenic GFP-expressing HEK 293 cell line was used. To enhance nuclear transportation, a
Cas9 protein fused with two NLS peptides (sNLS–Cas9–sNLS) was used to form the RNP
complexes. As shown in Figure 6C, SMOF NPs exhibited a statistically higher (1.3-fold) gene-
knockout efficiency than Lipo 2000.
Furthermore, to achieve precise genome editing by co-delivery of RNP and a donor DNA
template, gene correction or insertion can be achieved through the homology-directed repair
(HDR) pathway[25]. RNP and a donor single-stranded oligonucleotide DNA (ssODN) were
loaded into SMOF NPs, and the precise genome-editing efficiency was studied using BFP-
expressing HEK293 cells. Precise gene editing will lead to the replacement of three nucleotides
in the genome, thereby converting BFP to GFP. The precise genome-editing efficiency was
evaluated by the percentage of GFP-positive cells. As shown in Figure 6D, SMOF NPs showed
a statistically higher (1.4-fold) gene-correction efficiency than Lipo 2000. These studies
indicate that SMOF NPs are suitable for the delivery of CRISPR genome-editing machineries.
To study the biocompatibility of SMOF NPs, the cells were treated with SMOF NPs, and
the cell viability was investigated by an MTT assay (Figure 6E and Figure S6). SMOF NPs did
not induce significant cytotoxicity in HEK cells with concentrations up to 200 µg/ml, which
was at least 9.2-fold of the concentration used for our studies. Similar to previous reports, Lipo
2
2

Journal Pre-proof
2
000 exhibited significant cytotoxicity (with 30% cell death) at the dosage indicated in the
user’s manual (i.e., 0.5 μl/well in a 96-well plate, corresponding to 5 μg/ml Lipo 2000) [32].
Figure 6. Delivery efficiency of nucleic acids and CRISPR-Cas9 genome-editing
machineries by SMOF NPs. Transfection efficiency of the (A) DNA- and (B) mRNA-loaded
SMOF NPs in HEK293, HCT116, NHDF, and RAW264.7 cells. (C) Genome-editing
efficiency of RNP-loaded SMOF NPs in GFP-expressing HEK 293 cells. (D) Precise gene-
correction efficiency of RNP+ssODN co-loaded SMOF NPs in BFP-expressing HEK 293 cells.
2
3

Journal Pre-proof
The precise gene-correction efficiency of RNP+ssODN repair template converting the BFP to
the GFP was assayed by flow cytometry for gain of GFP fluorescence. NS: not significant; *:
p < 0.05; **: p < 0.01; ***: p < 0.005; n = 3. (E) Viability of HEK293 cells treated with Lipo
2
000 and SMOF NPs with different concentrations. NS: not significant; ***: p < 0.001; n = 5.
The genome editing efficiency of RNP-loaded SMOF NPs was further evaluated in vivo
via subretinal injection in transgenic Ai14 mice (Figure. 7). All the cells of Ai14 mouse contain
a CAGGS promoter and a loxP-flanked stop cassette (three repeats of the SV40 polyA sequence)
that prevents expression of the tdTomato fluorescent protein, at the Rosa26 locus. The gain-of-
function fluorescent signal in modified cells provides a robust and quantitative readout of
genome editing at the stop cassette [27, 33, 34]. RNP targeting the excision of the SV40 polyA
blocks can induce tdTomato expression (Figure. 7A). The genome editing efficiency of the
RNP-loaded SMOF NPs can be easily monitored through fluorescence imaging. We studied
the genome editing efficiency within the targeted retinal pigmented epithelium (RPE) of Ai14
mice, as RPE abnormality can cause a variety of eye diseases (e.g., retinal degeneration,
blindness) [21]. SMOF NPs were decorated with ATRA (i.e., SMOF-ATRA). Mice were
subretinally injected with SMOF-ATRA NPs loaded with RNPs targeting the Ai14 stop
cassette (i.e., Ai14 RNP SMOF) and SMOF-ATRA NPs loaded with negative control RNPs
(i.e., negative control SMOF) (Figure. 7B). Thirteen or fourteen days post-injection, the entire
RPE tissue was separated from the enucleated eye and flat-mounted to assess genome editing
via CLSM (Figure. 7C and Figure S8). As shown in Figure 7C and D, strong tdTomato
signals were visualized in the eyes injected with the RNP-loaded SMOF-ATRA targeting the
Ai14 stop cassette, while little tdTomato signal was found in eyes treated with negative control
SMOF-ATRA (i.e., SMOF-ATRA encapsulating RNP with negative control sgRNA),
indicating successful delivery of RNP and robust in vivo genome editing induced by SMOF-
ATRA.
2
4

Journal Pre-proof
The biocompatibility of SMOF after subretinal injection was evaluated by
electroretinography (ERG) of the retina. ERG evaluates the electronic response of the eye, and
any damage to the RPE or retina result in alternations in ERG recording [35-37]. PBS and Ai14
RNP-loaded SMOF-ATRA were injected to the eyes of C57BI/6 mice. As shown in Figure S9,
the a-wave and b-wave amplitude of SMOF injected eyes (131.04 ± 37.16 µV, P= 0.713) were
similar to the PBS injected eyes (128.1 ± 22.6 µV, P= 0.643) 14 days post-injection. The c-
wave amplitude were also not statistically significant when SMOF (329.4 ± 95.2 µV, P = 0.664)
was compared with the PBS control (274.2 ± 58.44 µV, P = 0.855). As there were no significant
difference in ERG responses between the SMOFinjected and PBS injected eyes, these findings
suggest that SMOF is either nontoxic or the toxicity is negligible to the retinal/RPE cells.
Figure 7. SMOF NPs induced efficient genome editing in vivo in Ai14 mice via local
administration. (A) The tdTomato locus in the Ai14 reporter mouse. A stop cassette
containing 3 Ai14 sgRNA target sites prevents downstream tdTomato expression. RNP guided
2
5

Journal Pre-proof
excision of the stop cassette results in tdTomato expression. (B) Illustration of SMOF NP
subretinal injection targeting the RPE tissue. (C) Representative images of tdTomato+ signal
(red) 13 or 14 days after subretinal SMOF-ATRA injection. The whole RPE layer was outlined
with a white dotted line. C1: RPE floret of Ai14 mouse subretinally injected with PBS. C2:
RPE floret of Ai14 mouse subretinally injected with negative control SMOF-ATRA (SMOF-
ATRA encapsulating RNP with negative control sgRNA). C3: RPE floret of Ai14 mouse eye
subretinally injected with SMOF-ATRA encapsulating RNP targeting the Ai14 stop cassette
(i.e., Ai14 RNP SMOF), and C4: zoom-in image (20X magnification) of genome-edited RPE
tissue induced by RNP-loaded SMOF-ATRA. (D) Genome editing efficiency as quantified by
percent of the area of whole RPE tissue with tdTomato+ signals. NS: not significant, *: p<0.05.
4
. Conclusion
In conclusion, we have demonstrated a novel and versatile silica–metal–organic
framework hybrid NP for the efficient delivery of hydrophilic payloads. The protonation of the
imidazole component in the SMOF NP network promoted the release and endosomal escape
of the payload. SMOF NPs can encapsulate hydrophilic payloads with both a high loading
content (17 wt% for small molecules and about 9.5 wt% for nucleic acids/RNP) and high
loading efficiency (higher than 90%). The biocompatible and stable SMOF NPs can efficiently
deliver a diverse range of hydrophilic payloads, including hydrophilic drug DOXHCl, nucleic
acids, and CRISPR-Cas9 genome-editing machineries. Furthermore, ATRA-conjugated SMOF
NP also induced efficient genome editing in mouse retinal pigmented epithelium via subretinal
injection, indicating that it is a highly promising nanoplatform for many biomedical
applications.
Acknowledgements
2
6

Journal Pre-proof
We acknowledge the generous financial support from the National Institute for Health
(1-UG3-NS-111688-01, R01HL129785, R01HL143469, and R01EY024995).
Keywords
Silica • metal-organic framework • hybrid nanoparticle • gene delivery • genome editing
machinery delivery
References
[
1] E. Blanco, H. Shen, M. Ferrari, Principles of nanoparticledesign for
overcoming biological barriers to drug delivery, Nat. Biotechnol., 33 (2015)
41.
2] A.A. Manzoor, L.H. Lindner, C.D. Landon, J.-Y. Park, A.J. Simnick, M.R.
9
[
Dreher, S. Das, G. Hanna, W. Park, A. Chilkoti, Overcoming limitations in
nanoparticle drug delivery: triggered, intravascular releaseto improvedrug
penetration into tumors, Cancer Res, 72 (2012) 5566-5575.
[
3] H. Yin, R.L. Kanasty, A.A. Eltoukhy, A.J. Vegas, J.R. Dorkin, D.G. Anderson,
Non-viral vectors for gene-based therapy, Nat. Rev. Genet., 15 (2014) 541-555.
4] C. Liu, L. Zhang, H. Liu, K. Cheng, Delivery strategies of the CRISPR-Cas9
gene-editing system for therapeutic applications, J. Controlled Release, 266
[
(
[
2017) 17-26.
5] F. Scaletti, J. Hardie, Y.-W. Lee, D.C. Luther, M. Ray, V.M. Rotello, Protein
delivery into cells using inorganic nanoparticle–protein supramolecular
assemblies, Chemical Society Reviews, 47 (2018) 3421-3432.
[
6] Y. Piao, H.P. Bei, A. Tam, Y. Yang, Q. Zhang, M. Yang, X. Zhao, Calcium
PhosphateNanoparticle-Based Systems for Therapeutic Delivery, in:
Theranostic Bionanomaterials, Elsevier, 2019, pp. 147-164.
[
7] I.I. Slowing, J.L. Vivero-Escoto, C.-W. Wu, V.S.Y. Lin, Mesoporous silica
nanoparticles as controlled release drug delivery and gene transfection
carriers, Adv. Drug Delivery Rev., 60 (2008) 1278-1288.
[
8] J.E. Lee, N. Lee, T. Kim, J. Kim, T. Hyeon, Multifunctional mesoporous silica
nanocompositenanoparticles for theranostic applications, Acc. Chem. Res., 44
(
[
2011) 893-902.
9] Y.-S. Lin, K.R. Hurley, C.L. Haynes, Critical considerations in the biomedical
use of mesoporous silica nanoparticles, The journal of physical chemistry
letters, 3 (2012) 364-374.
2
7

Journal Pre-proof
[
10] D. Wang, Z. Xu, Z. Chen, X. Liu, C. Hou, X. Zhang, H. Zhang, Fabrication of
single-hole glutathione-responsivedegradablehollow silica nanoparticles for
drug delivery, ACS Appl. Mater. Interfaces, 6 (2014) 12600-12608.
[
11] P. Yuan, H. Zhang, L. Qian, X. Mao, S. Du, C. Yu, B. Peng, S.Q. Yao,
Intracellular Delivery of Functional Native Antibodies under Hypoxic Conditions
by Using a Biodegradable Silica Nanoquencher, Angew. Chem., 129 (2017)
1
2655-12659.
[
12] E.A. Prasetyanto, A. Bertucci, D. Septiadi, R. Corradini, P. Castro‐
Hartmann, L. De Cola, Breakable hybrid organosilica nanocapsules for protein
delivery, Angew. Chem. Int. Ed., 55 (2016) 3323-3327.
[
13] P. Horcajada, T. Chalati, C. Serre, B. Gillet, C. Sebrie, T. Baati, J.F. Eubank,
D. Heurtaux, P. Clayette, C. Kreuz, Porous metal–organic-framework nanoscale
carriers as a potential platform for drug delivery and imaging, Nature
materials, 9 (2010) 172.
[
14] J. Della Rocca, D. Liu, W. Lin, Nanoscale metal–organic frameworks for
biomedical imaging and drug delivery, Acc. Chem. Res., 44 (2011) 957-968.
15] M.X. Wu, Y.W. Yang, Metal–organic framework (MOF)‐based drug/cargo
delivery and cancer therapy, Adv. Mater., 29 (2017) 1606134.
16] C. Doonan, R. Ricco, K. Liang, D. Bradshaw, P. Falcaro, Metal–organic
[
[
frameworks at the biointerface: synthetic strategies and applications, Acc.
Chem. Res., 50 (2017) 1423-1432.
[
17] P. Horcajada, R. Gref, T. Baati, P.K. Allan, G. Maurin, P. Couvreur, G. Ferey,
R.E. Morris, C. Serre, Metal–organic frameworks in biomedicine, Chem. Rev.,
12 (2011) 1232-1268.
18] S.K. Alsaiari, S. Patil, M. Alyami, K. Alamoudi, f. Aleisa, J. Merzaban, M. Li,
1
[
N.M. Khashab, Endosomal Escapeand Delivery of CRISPR/Cas9 GenomeEditing
Machinery Enabled by Nanoscale Zeolitic ImidazolateFramework, J. Am. Chem.
Soc., (2017).
[
19] T.-T. Chen, J.-T. Yi, Y.-Y. Zhao, X. Chu, Biomineralized metal–organic
framework nanoparticles enable intracellular delivery and endo-lysosomal
release of native active proteins, J. Am. Chem. Soc., 140 (2018) 9912-9920.
[
20] A. Poddar, J.J. Conesa, K. Liang, S. Dhakal, P. Reineck, G. Bryant, E. Pereiro,
R. Ricco, H. Amenitsch, C. Doonan, Encapsulation, Visualization and Expression
of Genes with Biomimetically Mineralized Zeolitic ImidazolateFramework‐8
(
ZIF‐8),Small, (2019) 1902268.
21] W. Berger, B. Kloeckener-Gruissem, J. Neidhardt, The molecular basis of
[
human retinal and vitreoretinal diseases, Prog Retin Eye Res, 29 (2010) 335-
3
[
75.
22] D. Sun, B. Sahu, S. Gao, R.M. Schur, A.M. Vaidya, A. Maeda, K. Palczewski,
Z.-R. Lu, Targeted multifunctional lipid ECO plasmid DNA nanoparticles as
2
8

Journal Pre-proof
efficient non-viral gene therapy for leber’s congenital amaurosis, Molecular
Therapy-Nucleic Acids, 7 (2017) 42-52.
[
23] A. Carlson, D. Bok, Promotion of the release of 11-cis-retinal from cultured
retinal pigment epithelium by interphotoreceptor retinoid-binding protein,
Biochemistry-us, 31 (1992) 9056-9062.
[
24] P. Yuan, X. Mao, K.C. Chong, J. Fu, S. Pan, S. Wu, C. Yu, S.Q. Yao,
Simultaneous Imaging of Endogenous Survivin mRNA and On‐Demand Drug
Release in Live Cells by Using a Mesoporous Silica Nanoquencher, small, 13
(
[
2017) 1700569.
25] J. Carlson-Stevermer, A.A. Abdeen, L. Kohlenberg, M. Goedland, K.
Molugu, M. Lou, K. Saha, Assembly of CRISPR ribonucleoproteins with
biotinylated oligonucleotides via an RNA aptamer for precise gene editing, Nat.
Commun., 8 (2017) 1711.
[
26] C.D. Richardson, G.J. Ray, M.A. DeWitt, G.L. Curie, J.E. Corn, Enhancing
homology-directed genome editing by catalytically active and inactive CRISPR-
Cas9 using asymmetric donor DNA, Nat. Biotechnol., 34 (2016) 339.
[
27] G. Chen, A.A. Abdeen, Y. Wang, P.K. Shahi, S. Robertson, R. Xie, M. Suzuki,
B.R. Pattnaik, K. Saha, S. Gong, A biodegradable nanocapsuledelivers a Cas9
ribonucleoprotein complex for in vivo genome editing, Nature nanotechnology,
1
4 (2019) 974-980.
[
28] M. Larguinho, H.M. Santos, G. Doria, H. Scholz, P.V. Baptista, J.L. Capelo,
Development of a fast and efficient ultrasonic-based strategy for DNA
fragmentation, Talanta, 81 (2010) 881-886.
[
29] N.A. Pchelintsev, P.D. Adams, D.M. Nelson, Critical parameters for efficient
sonication and improved chromatin immunoprecipitation of high molecular
weight proteins, PloS one, 11 (2016) e0148023.
[
30] J.A. Doudna, E. Charpentier, The new frontier of genome engineering with
CRISPR-Cas9,Science, 346 (2014)1258096.
31] L. Cong, F.A. Ran, D. Cox, S. Lin, R. Barretto, N. Habib, P.D. Hsu, X. Wu, W.
[
Jiang, L. Marraffini, Multiplex genome engineering using CRISPR/Cas systems,
Science, (2013) 1231143.
[
32] Y. Wang, B. Ma, A.A. Abdeen, G. Chen, R. Xie, K. Saha, S. Gong, Versatile
Redox-ResponsivePolyplexes for the Delivery of Plasmid DNA, Messenger RNA,
and CRISPR-Cas9 Genome-Editing Machinery, ACS Appl. Mater. Interfaces, 10
(
[
2018) 31915–31927.
33] B.T. Staahl, M. Benekareddy, C. Coulon-Bainier, A.A. Banfal, S.N. Floor, J.K.
Sabo, C. Urnes, G.A. Munares, A. Ghosh, J.A. Doudna, Efficient genome editing
in the mousebrain by local delivery of engineered Cas9 ribonucleoprotein
complexes, Nat. Biotechnol., 35 (2017) 431.
2
9