Caged siRNAs with single folic acid modification of antisense RNA for photomodulation of exogenous and endogenous gene expression in cells

Article abstract of DOI:10.1039/c8ob01952e

Manually controlling siRNA activity is an essentially important way to spatiotemporally investigate gene expression and function. Owing to ease of operation and precise manipulation, light can be used for controlled regulation of siRNA-induced gene silencing. Here, we developed a series of caged siRNAs with folic acid modification at the 5′ terminus of the antisense strand of the siRNA through a photolabile linker. The attachment of the folic acid moiety temporarily masked the corresponding siRNA activity. Upon illumination, these caged siRNAs were activated, and their gene silencing activities were restored. Based on this strategy, we successfully photomodulated gene expression of both an exogenous gene (for green fluorescent protein, GFP) and an endogenous gene (for mototic kinesin-5, Eg5) in cells.

Full text of DOI:10.1039/c8ob01952e

View Article Online
View Journal
Organic &
Biomolecular
Chemistry
Accepted Manuscript
This article can be cited before page numbers have been issued, to do this please use: L. Yu, N. Jing, Z.
Yang, L. Zhang and X. Tang, Org. Biomol. Chem., 2018, DOI: 10.1039/C8OB01952E.
This is an Accepted Manuscript, which has been through the
Volume 14 Number
1 7 January 2016 Pages 1–372
Royal Society of Chemistry peer review process and has been
accepted for publication.
Organic &
Biomolecular
Chemistry
www.rsc.org/obc
Accepted Manuscripts are published online shortly after
acceptance, before technical editing, formatting and proof reading.
Using this free service, authors can make their results available
to the community, in citable form, before we publish the edited
article. We will replace this Accepted Manuscript with the edited
and formatted Advance Article as soon as it is available.
You can find more information about Accepted Manuscripts in the
author guidelines.
Please note that technical editing may introduce minor changes
to the text and/or graphics, which may alter content. The journal’s
standard Terms & Conditions and the ethical guidelines, outlined
in our author and reviewer resource centre, still apply. In no
event shall the Royal Society of Chemistry be held responsible
for any errors or omissions in this Accepted Manuscript or any
consequences arising from the use of any information it contains.
ISSN 1477-0520
COMMUNICATION
Takeharu Haino et al.
Solvent-induced emission of organogels based on tris(phenylisoxazolyl)
benzene
rsc.li/obc

Please do not adjust margins
Organic & Biomolecular Chemistry
Page 1 of 8
View Article Online
DOI: 10.1039/C8OB01952E
Journal Name
ARTICLE
Caged siRNAs with single folic acid modification of antisense RNA
for photomodulation exogenous and endogenous gene expression
in cells
Received 00th January 20xx,
Accepted 00th January 20xx
b†
b
Lijia Yua,b , Nannan Jing , Zhenjun Yang , Lihe Zhang b and Xinjing Tangb*
†
DOI: 10.1039/x0xx00000x
www.rsc.org/
Manually controlling siRNA activity is an essentially important way to spatiotemporally investigate gene evaluation and
functions. Due to the easy operation and precise manipulation, light could be used to regulate siRNAs induced gene
silencing in controllable mode. Here, we developed a series of caged siRNAs with folic acid modification at 5' terminus of
antisense strand of siRNA through a photolabile linker. The attachment of folic acid moiety temporally masked the
corresponding siRNA activity. Upon light illumination, these caged siRNAs were activated, and their gene silencing
activities was restored. Based on this strategy, we successfully photomodulated gene expression of both exogeneous gene
(green fluorescence protein, GFP) and endogenous gene (mototic kinesin-5, Eg5) in cells.
Controversial leakage of RNAi activity of caged siRNAs
remained unsolved. Jain et al proposed that incomplete block
of RNAi prior to irradiation might be due to the factor that the
Introduction
Light irradiation was one such method that has gained
popularity in the past decade because of its easy and precise
operation1, 2. Photocaging strategy can be used to temporary
caging group does not completely hinder the binding to Dicer.
The authors designed a new bulky photolabile caging group,
cyclo-dodecyl DMNPE (CD-DMNPE)8, and attached it to four
terminal phosphate groups of siRNAs to prevent binding with
Dicer and/or their following processing through steric
hindrance, with almost inert gene silencing activity before
activation. More recently, our group has reported that a series
of caged siRNAs with single ligand modification of antisense
strand of RNA to efficiently mask siRNA activity. Target ligands,
such as vitamin E-15, cholesterol-16, cRGD-17or aptamer-
modified18 at 5' end of caged antisense strand of siRNA, could
enhance steric hindrance to prevent the binding and
processing with Dicer and/or nucleases once they bind to their
receptor proteins with high specificity and affinity.
inactivation of
a biologically active molecule through a
photolabile protecting group. Upon light irradiation of
photolabile group, the active forms of caged biomolecules are
irreversibly released3-10. Small interfering RNA (siRNA) is one of
important biomolecules that are used to evaluate and regulate
gene expression in many cellular activities11, 12. Efficient
delivery and subsequent control of siRNA release remain a
major challenge in siRNA filed. There are various methods to
regulate the siRNA activity13. Shah et al reported the first
caged siRNA to photoregulate RNAi10. The siRNA was masked
with 1-(4,5-dimethoxy-2-nitrophenyl)ethyl (DMNPE) as the
photolabile caging group, which protected phosphate group of
RNA backbone and resulted in 3% caging efficiency. However,
it is important to note that targeting gene silencing was still
observed in cells treated with the caged siRNAs even without
irradiation (40% leakage activity), indicating that inactivation
of the caged siRNA was incomplete. Nguyen et al, attached a
1-(2-nitrophenyl)ethyl (NPE), as the caging group, to the 5'
terminal phosphate of guide strand of siRNA, which is thought
to be critical for incorporation of siRNA into RISC14.
Folic acid (FA) is the well-known ligand for folate receptor
(FR) that is known to be abundantly expressed in large fraction
of human tumors, but it is only minimally distributed in normal
tissues19. FA shows high affinity for FR and the binding affinity
of folate conjugates to FR is within nM range20. The conjugates
with folic acid moiety could be readily internalized into cells
with overexpressed folate receptor (FR) via receptor-mediated
endocytosis21. After one FR cycles, FR could recycle back to cell
surface, allowing the delivery of additional folate conjugates
into the cells22. Single FA modification at 5' end of antisense
strand of siRNA might block siRNA activity due to large steric
hindrance of the formation of FA/FR complex23. Thus, we
designed and developed caged siRNAs with a target ligand,
folic acid (FA), by inserting a photolabile linker (PL) between FA
and 5' terminus of antisense strand RNA. We successfully
achieved the effective photoregulation gene silencing of both
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 1
Please do not adjust margins

Please do not adjust margins
Organic & Biomolecular Chemistry
Page 2 of 8
View Article Online
DOI: 10.1039/C8OB01952E
ARTICLE
Journal Name
exogenous gene (green fluorescence protein, GFP) and information), which is similar to our previous observation.17
endogenous gene (Eg5) using these folic acid caged siRNAs.
And 4 min irradiation time was then used for further cellular
study.
Table 1. List of unmodified RNA and caged RNA strands with
FA modification used in this study.
Name
Sequence
（5'-3'
）
Calculated
Found
AG
GUUCACCUUGAUGCCGUUCTT
GAACGGCAUCAAGGUGAACTT
FA-PL-GUUCACCUUGAUGCCGUUCTT
CAACAAGGAUGAAGUCUAUTT
AUAGACUUCAUCCUUGUUGTT
FA-PL-AUAGACUUCAUCCUUGUUGTT
6559
6755
7226
6701
6569
7237
6561
6755
7227
6701
6569
7239
SG
FpAG
SE
AE
FpAE
Fig. 1 Synthesis of folic acid (FA) modified RNA strands on solid
support.
PL:
photolabile
group;
Fmoc: p or PL represents photolabile linker; F/FA represents folic acid; AG:
fluorenylmethyloxycarbonyl. Step a: RNA standard solid antisense strand of GFP; SG: sense strand of GFP; SE: sense strand of Eg5;
synthesis; Step b: 1) Piperidine/DMF (2/8, v/v, 0.5 mL) for 15 AE: antisense strand of Eg5.
min, 2) Folic acid in NHS, EDC in DMSO.
Results and discussion
Rational design, synthesis and characterization of caged
siRNAs with single folic acid modification.
Fig. 2 The PAGE assay. Caged siRNA with single strands with
As shown in Fig. 1, the antisense strand RNA of caged
FA modification (1 μM FpAE) with different irradiation time
(365 nm, 7 mW/cm2), AE: native single strand RNA.
siRNAs with a photolinker and single FA modification at 5' end
were prepared through solid phase synthesis. The photolinker
phosphoramidite with fluorenylmethyloxycarbonyl (Fmoc)
The cellular uptake assay
protected amine moiety was successfully synthesized and
coupled to 5' terminus of RNA based on normal
phosphoramidite chemistry. The Fmoc was then removed to
recover amine moiety for further coupling with folic acid pre-
activated with 1-(3-dimethylaminopropyl)-3-ethylcarbodiimide
hydrochloride (EDC HCl) and N-hydroxysuccinimide (NHS). The
folic acid molecule has two carboxyl groups, termed α and γ
carboxylic groups. Although the coupling of folic acid to the
amine moiety via its α-carboxyl group results in a reduced
binding affinity to its receptor, the coupling was mainly
performed via its γ-carboxy group24, 25. The folic acid modified
caged RNA oligonucleotides on solid support were then
To demonstrate the cellular uptake by caged siRNA with
single FA modification, flow cytometry and confocal laser
scanning microscopy were used. Cy3 was labeled at 3' terminal
phosphate of sense RNA strand (Cy3 SG). HeLa cells, a folate
receptor expressing cell line, were chosen and cultured in a
folic acid-depleted medium to up-regulate expression of folate
receptor26, 27. The Cy3 labeled sense strand RNA (Cy3-SG) was
hybridized to folic acid modified caged antisense RNA to form
caged siRNA duplex. Then this caged siRNA was used for
uptake by HeLa cells. As shown in Figure S2 (supporting
information), flow cytometry results revealed that the cellular
uptake behavior of 75 nM and 25 nM FpAG/Cy3 SG to HeLa
cleaved and deprotected. followed by HPLC purification and cells was similar and the attachment of folic acid to siRNA
enabled receptor-mediated uptake into HeLa cells without any
additional transfection agent. This specificity could be verified
by pre-incubation of free folic acid to pre-occupy the binding
site of folate receptor and prevent cellular uptake of the FA
modified caged siRNA (Figure S2 and S3, supporting
information). Thomas et al previously reported that high
concentration of folate-modified siRNAs was required for the
efficient siRNA delivery to targeted tissues by injecting retro-
orbitally.28 However, the real question is that folate-modified
siRNAs lack endosomal escape functionality and do not have
full access to RNA induced silencing complex in the cellular
MS characterization. Six caged RNA oligonucleotides with folic
acid modification at 5' end were successfully synthesized and
characterized
for
further
investigation
(supporting
information) as shown in Table 1.
To demonstrate the photoactivation of FA modified caged
siRNAs, it was irradiated and further analyzed using PAGE gel
assay. As shown in Fig. 2, FA modified caged single strand RNA
(FpAE) was irradiated for different time. A new band with
similar mobility to native unmodified RNA in gel appeared
after light activation, suggesting that caged group and folic
acid could be removed from the FpAE and active single-strand cytosol, which is necessary for the RNAi effect29. To combine
the selective targeted siRNA molecule with a transfection
agent enabling effective endosomal escape, the transfection
agent was still needed to efficient delivery of folate-targeted
siRNAs29. Here, we use commercially available LipofectamineTM
2000 (lipo2K) as transfection reagents. Cellular uptake of
FpAG/Cy3 SG with lipo2K was much more enhanced than that
RNA could be released. After 4 min UV irradiation, the native
single strand RNAs were completely released from FA modified
caged RNA strands. Mass data of these caged single-strand
RNAs (FpAG and FpAE) confirmed the recovery of native single-
stranded RNAs with a terminal phosphate group (supporting
2 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Please do not adjust margins
Organic & Biomolecular Chemistry
Page 3 of 8
View Article Online
DOI: 10.1039/C8OB01952E
Journal Name
ARTICLE
without transfection agent. As shown in Fig. 3 and Figure S4,
confocal laser scanning microscopy was also used to assess the
transfected with folic acid modified caged siRNA were
effectively downregulated to the level (33% at 5 nM siRNA)
that was similar to the PC group cells. And the down-
regulation of GFP signal level showed dose-dependent effect
on the concentration of folic acid modified caged siRNA
(FpAG/SG), which confirmed that folic acid and caging group
could be cleaved from FA modified caged siRNAs to release the
active siRNA and restore GFP gene expression. In addition, we
also observed some leakage of siRNA silencing activity. That
might be due to small percentage of RNA oligonucleotides
linked to α-carboxyl group of folic acid, which led to low
binding affinity to folate receptor with high affinity and could
not generate large steric blocking effect on siRNA activity
through formation of A/folate receptor complex.
Fig. 3 Assessment of the uptake and endosomal/lysosomal
escape of FA-siRNA complexes (25 nM) without Lipofectamine
2000 (Lipo-) and with lipofectamine 2000 (Lipo+) in HeLa cells.
Endosomes/lysosomes were stained with Lysotracker green.
FA modified siRNA (25 nM) was labeled with Cy3 (red). The
nuclei were stained with Hoechst 33342 (blue). Scale bar is 50
μm.
internalization of FpAG/Cy3 SG. The results disclosed that
FpAG/Cy3-SG at low concentration without a carrier was not
effectively uptaken by cells. Whereas, with assistance of
lipo2K, the FpAG/Cy3 SG was internalized into HeLa cells and
entrapped partly by endosome or lysosome.
Photoregulation of exogenous GFP gene silencing using caged
siRNA with single folic acid modification
To demonstrate FA modified caged siRNA for
photoregulation of its RNAi effect, we evaluated folic acid
modified caged siRNA using GFP/RFP reporter assay in HeLa
cells. The sequences of siRNAs were chosen to target GFP
expression while using RFP expression as an internal control.
HeLa cells were cotransfected with pRGFP-N1 vector and
pDsRed2-N1 vector, together with the corresponding siRNAs,
respectively. After 4 h incubation in the dark, the cells were
divided into two groups. One group was irradiated by light (4
min, 365 nm) and the other group was kept in the dark. After
incubation for 24 h, the cells were imaged with a fluorescence
microscope, and GFP/RFP expression was further quantified by
flow cytometry. As shown in Fig. 4 and Figure S5 (supporting
information), cells with only GFP/RFP plasmid transfection
(NC) showed clear gene expression with strong GFP
fluorescence and no effect of UV irradiation. The GFP
fluorescence was largely downregulated by positive control
siRNA (PC, AG/SG) without any terminal modification and the
GFP fluorescence intensity of cells was downregulated to 35%
(UV-) and 32% (UV+) compared with cells treated with NC
group at 5 nM siRNA. The level of GFP fluorescence was
obviously different in cells transfected with folic acid modified
caged siRNA before and after light activation. The GFP
fluorescence intensity of cells treated with folic acid modified
Fig. 4 Photomodulation of GFP expression co-transfected with
pEGFP-N1, pDsRED2-N1, and FA modified caged siRNA. Cells
were irradiated for 4 min (365 nm, 7 mW/cm2) or kept in the
dark. a) Cells were imaged using fluorescence microscopy with
GFP and RFP channels, the white scale bar is 100 μm; b)
Quantification of cell numbers with GFP expression divided by
cell numbers with RFP expression using flow cytometry.
Photoregulation of endogenous Eg5 gene silencing using
caged siRNAs with single folic acid modification.
To confirm the ability of light-activation strategy for en-
caged siRNA (FpAG/SG) was similar to that of NC group cells dogenous gene, folic acid modified caged siRNA targeting
without light irradiation, suggesting that folic acid modification endogenous Eg5 gene was developed to photoregulate Eg5
at 5' end of antisense strand RNA could block siRNA activity. gene silencing. Eg5 is a member of the kinesin-5 family and is
However, upon light irradiation, the GFP expression of cells an essential gene involved in the regulation of the cell cycle,
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 3
Please do not adjust margins

Please do not adjust margins
Organic & Biomolecular Chemistry
Page 4 of 8
View Article Online
DOI: 10.1039/C8OB01952E
ARTICLE
Journal Name
specifically for bipolar spindle formation30, 31. Blocking Eg5 FpAE/SE) in HeLa cells. The cells were fixed and stained with
expression could lead to the arrest of spindle formation, Hoechst 33342 (blue), scale bar is 50 μm; (b) DNA content of
mitosis and cell proliferation. Since the importance of Eg5 in G2/M in the cell cycle of HeLa cells; (c) Relative Eg5 mRNA in
cell cycle regulation and the potential in cancer therapy, caged HeLa cells treated with 5 nM AS/SE or FpAE/SE before or after
Eg5 siRNA with single folic acid modification (FpAE/SE) at 5' light activation (365 nm, 7 mW/cm2). GAPDH was used as
end of antisense strand RNA was designed and synthesized. To internal control. NC was the negative control.
confirm the photomodulation of targeting gene silencing via similar to that of negative control cells (NC) with normal shape
FpAE/SE, native siRNA (PC) and FpAE/SE were respectively of cell nuclei. However, once the cells transfected with
transfected to HeLa cells using lipo2K as transfection agent. FpAE/SE were irradiated, caged siRNA (FpAE/SE) was activated
After 4 h incubation in the dark, the cells were divided into and RNAi induced gene silencing machinery was triggered. We
two groups. One was irradiated with UV light, and the other clearly observed the phenotype of irregular bi- or multiple
group was still kept in dark. After 44 h incubation, the cells cellular nuclei as those of cells transfected with positive
were fixed and stained with Hoechst 33342 to label cell nuclei. control siRNA (AE/SE, PC), which is the typical phenotype with
As shown in Fig. 5a, the phenotypes of cells transfected with deficient Eg5 gene expression. We then quantified the arrest
FpAE/SE were the
of cells in prometaphase by analyzing cell cycle (Fig. 5b). Cell
treated with FpAE/SE without light irradiation exhibited similar
percentage (17%) of cells in G2/M phase as the negative
control (15%), and after light irradiation the G2/M percentage
of cells increased to 28% that was similar to the positive
control with AE/SE. These results also confirmed that boosted
arrest of G2/M phase for irradiated FpAE/SE resulted from the
recovery of siRNA activity after light irradiation.
To further confirm photomodulation of Eg5 gene on its
mRNA level, total RNAs were isolated from cells and then used
for real-time PCR assay. As shown in Fig. 5c, PC siRNA could
effectively silence target Eg5 mRNA transcription with mRNA
level down to 32% and 37% with or without light irradiation,
which indicated that there was little influence of UV light on
the targeting mRNA transcription. However, single folic acid
modification of caged siRNA (FpAE/SE) nearly blocked its siRNA
activity for cells treated with FpAE/SE. Upon light activation of
FpAE/SE, its siRNA activity was recovered, which led to
effective silencing of Eg5 with targeting mRNA level down to
60%. This result was weaker than PC control siRNA for
targeting Eg5 silencing, possibly due to the partial entrapping
of FA modified siRNA and their further degradation in
endosome or lysosome. The photo-induced down-regulation
of Eg5 mRNA using caged siRNA confirmed that
photoregulation of caged siRNAs with single folic acid
modification at 5' end of antisense strand RNA could also be
successfully achieved for regulating the endogenous gene
expression.
Experimental
Synthesis of phosphoramidites of photolinker PL and modified
RNA oligonucleotides
The phosphoramidites of photolabile group (PL) was
synthesized under an inert atmosphere using dry reagents and
solvents(Figure S6). The 394 automated DNA synthesizer was
used to synthesize the corresponding RNA strands32. PL was
inserted to the 5' end of RNA strands through solid phase
synthesizer,
fluorenylmethyloxycarbonyl
(Fmoc)
was
deprotected from solid phase by 2/8 Piperidine/DMF (v/v) in
0.5 mL for 15 min33, the resin was washed three times with 1
mL DCM and 1 mL diethyl ether, and was then dried in air. The
Fig. 5 (a) Light-activation Eg5 gene silence using native siRNA
(5 nM AE/SE, PC) or folic acid modified caged siRNA (5 nM
4 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Please do not adjust margins
Organic & Biomolecular Chemistry
Page 5 of 8
View Article Online
DOI: 10.1039/C8OB01952E
Journal Name
ARTICLE
RNA oligonucleotide was further conjugated with folic acid together with corresponding siRNAs with Lipofectamine 2000
pre-activated with 1-(3-dimethylaminopropyl)-3- in OptiMEM medium. After 4 h incubation, the cells were
ethylcarbodiimide hydrochloride (EDC HCl) and N- divided into two groups. One group was kept dark, the other
hydroxysuccinimide (NHS) in 1 mL DMSO34, 35. Caged RNAs with one was irradiated with UV light (4 min, 365 nm) to activate
single FA modification on solid support was washed with 3×1 photolabile siRNAs. The cells were further incubated with fresh
mL DMSO, 3×1 mL DCM and 3×1 mL diethyl ether, and was DMEM for additional 24 h. Cells were then imaged by
then dried in air. The deprotection of corresponding modified fluorescence microscopy (Olympus, IX83). The excitation and
RNA strands were finished by AMA solution ((1:1 mixture (v/v) emission wavelengths are 488 nm and 509 nm for GFP, 560 nm
of aqueous ammonium hydroxide (28%) and aqueous and 585 nm for RFP, respectively. GFP gene silencing was then
methylamine (40%)). The silicyl moiety on 2-hydroxyl group of quantified by flow cytometry. Analysis was performed on
RNA nucleoside was removed by mixing anhydrous 50 μL software CytExpert with RFP gene expression as internal
DMSO and 50 μL triethylamine trihydrofluoride for 2 h at 65
The solution was added with 250 μL butyl alcohol and 5 μL
NaOAc (3 M), and was then stored in -30 for 30 min for
℃
.
control.
Phenotypic Eg5 inhibition assay
℃
Cells were passaged to 6-well chamber slides (1×105 cells/well)
and grown to 70% confluence within 24 h. The 5 nM native
siRNA (AE/SE) or folic acid modified caged siRNAs (FpAE/SE)
with Lipofectamine RNAiMAX (6 μL/well) were cotransfected
precipitation. Unmodified RNAs were purified by Waters 2695
HPLC under the reversed-phase condition: A, 0.05 M,
triethylammonium bicarbonate buffer (TEAB, pH 8.5); B,
acetonitrile (ACN), 0-15% in 20 min. All these FA-modified
caged RNAs were purified using the same HPLC column (C18)
purification under the conditions: A, 0.05 M TEAB; B ACN, 0-
20% in 30 min. All mass spectrometric data of RNA
oligonucleotides were obtained using electrospray ionization
(ESI) in Figure S7.
to cells. After 4 h incubation at 37
℃, cells in 6 wells were
divided into two groups. One group was kept in the dark, and
the other was irradiated (4 min, 365 nm). The medium was
replaced, and the cells were incubated for another 44 h. Then
the cells were fixed with formaldehyde (4%) and stained with
Hoechst 33342 (Invitrogen). The cells were then imaged using
laser scanning confocal microscope.
Cellular uptake assay
FpAG/Cy3-SG was prepared by hybridization of antisense
strand RNA (FpAG) and Cy3-labled sense strand RNA (Cy3-SG).
FpAG/Cy3-SG was transfected to cells with or without
Lipofectamine 2000. After incubation for 4 h, Hoechst 33342
and Lyso-Tracker Green were added to respectively stain the
nucleus and lysosome/endosome for 30 min. Then the cells
were washed three times using 1×PBS buffer (pH 7.2). Hoechst
33342 was excited at 405 nm and its fluorescence was
detected at 450 nm, while Lyso-Tracker Green was excited at
504 nm and its fluorescence was detected at 511 nm. Cy3 was
excited at 561 nm and detected at 595 nm. The cells were
imaged by laser scanning confocal microscopy. Their image
analyses were dealt with NIS-Elements AR 4.2 software. For
flow cytometry (BDFACSAria II) experiments, the transfection
condition and cell treatment were the same condition as
above. Then the cells were washed using 1×PBS buffer (pH
7.2), trypsinized and further quantified by flow cytometry.
RT-qPCR
HeLa cells were passaged to 12-well plates (1 mL per well,
~1.0×105 cells/well) and grown to ~70% confluence in 24 h.
The cells were transfected with 5 nM corresponding control
siRNA and FA modified caged siRNAs with Lipofectamine 2000
(2 μL/well) for 4 h. The treated cells were divided into two
groups. One group was kept in the dark, and the other was
irradiated for 4 min. After additional 44 h incubation, the cells
were collected and total RNAs were isolated with TRIZOL
reagent (Invitrogen). Eg5 cDNAs were then synthesized with
HiScript II Q RT SuperMix for qPCR (Vazyme) and real time
polymerase chain reactions (RT-PCRs) were performed using
GoTaq® qPCR Master Mix (Promega) with GAPDH as internal
control. The following primer sequences were used: Eg5
forward primer 5' CAGCTGAAAAGGAAACAGCC, Eg5 reverse
primer 5' ATGAACAATCCACACCAGCA, GAPDH forward primer
5' TGCACCACCAACTGCTTAGC, and GAPDH reverse primer 5'
GGCATGGACTGTGGTCATGAG. The threshold cycles (Ct) of
PAGE gel shift assay
The mobility of RNA oligonucleotides was studied by 20% each sample were normalized to the GAPDH housekeeping
native PAGE gel. 4 μL of 1 μM single strand RNAs were loaded gene, and the inhibition of gene silencing is represented as the
to the gel for analysis before and after UV irradiation. All gels percent of Eg5 expression.
were performed at 200 V for 1 h, and used the ChemiDoc XRS
Cell cycle analysis.
to image after staining with SYBR Gold (Invitrogen).
HeLa cells were treated similar process as RT-qPCR
The GFP assay of gene silencing activity of FA modified caged
experiments with 5 nM native siRNA or FA caged siRNAs. After
siRNA.
48 h of incubation, cells were digested by trypin-EDTA and
HeLa cells were grown in folate-depleted 1640 medium, collected by centrifugation (2000×g, 5 min). Then cells were
supplemented with 10% Fetal Bovine serum (Hyclone), and washed with PBS once and fixed in 70% ice-cold ethanol at 4
℃
10% streptomycin/penicillin. Cells were passed into 24 well for 24 h, and collected by centrifugation (2000×g, 5 min). Cells
plate and grown to ~70% confluence in 24 h. HeLa cells were were pelleted by centrifugation and washed with PBS twice,
cotransfected with pRGFP-N1 vector and pDsRed2-N1 vector, followed by incubation with RNase A and staining with
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 5
Please do not adjust margins

Please do not adjust margins
Organic & Biomolecular Chemistry
Page 6 of 8
View Article Online
DOI: 10.1039/C8OB01952E
ARTICLE
Journal Name
6
7
8
9
X. Tang, J. Swaminathan, A. M. Gewirtz and I. J. Dmochowski,
Nucleic Acids Res., 2008, 36, 559-569.
L. Wu, F. Pei, J. Zhang, J. Wu, M. Feng, Y. Wang, H. Jin, L.
Zhang and X. Tang, Chem.-Eur. J., 2014, 20, 12114-12122.
P. K. Jain, S. Shah and S. H. Friedman, J. Am. Chem. Soc.,
2011, 133, 440-446.
propidium iodide (0.1 mg/mL) for 30 min at 37
℃ in the dark.
The cells were analyzed using a flow cytometry (BDFACSAria
Ⅱ
). The percentage of cells in the G2/M phase of the cell cycle
was evaluated using the software ModFitLT 5.0.
L. Shah, S. T. Laughlin and I. S. Carrico, J. Am. Chem. Soc.,
2016, 138, 5186-5189.
Conclusions
10 S. Shah, S. Rangarajan and S. H. Friedman, Angew. Chem. Int.
Ed., 2005, 44, 1328-1332.
In summary, we developed a series of caged siRNAs with single
folic acid modification and photolinker at 5′ end of antisense 11 J. Soutschek, A. Akinc, B. Bramlage, K. Charisse, R. Constien,
M. Donoghue, S. Elbashir, A. Geick, P. Hadwiger, J. Harborth,
M. John, V. Kesavan, G. Lavine, R. K. Pandey, T. Racie, K. G.
Rajeev, I. Rohl, I. Toudjarska, G. Wang, S. Wuschko, D.
Bumcrot, V. Koteliansky, S. Limmer, M. Manoharan and H.-P.
Vornlocher, Nature, 2004, 432, 173-178.
strand RNA. These FA modified caged siRNAs were synthesized
directly on solid phase resin by subsequent coupling of the
photolinker and activated folic acid NHS ester, and further
purified by RP HPLC and characterized by ESI mass spectra.
Folic acid modified caged RNA showed slower mobility than 12 T. C. Roberts, K. Ezzat, S. EL Andaloussi and M. S. Weinberg,
in siRNA Delivery Methods: Methods and Protocols, eds. K.
Shum and J. Rossi, Springer New York, New York, NY, 2016,
DOI: 10.1007/978-1-4939-3112-5_23, pp. 291-310.
13 F. Debart, C. Dupouy and J.-J. Vasseur, Beilstein J. Org.
Chem., 2018, 14, 436-469.
the corresponding unmodified RNA in PAGE gel. Light
irradiation cleaved the photolinker and removed folic acid
moiety, and further restored RNA mobility. Results from
confocal laser scanning microscopy and flow cytometry
showed that the cellular uptake ability of siRNA increased with 14 Q. N. Nguyen, R. V. Chavli, J. T. Marques, P. G. Conrad Ii, D.
Wang, W. He, B. E. Belisle, A. Zhang, L. M. Pastor, F. R.
Witney, M. Morris, F. Heitz, G. Divita, B. R. G. Williams and G.
K. McMaster, BBA - Biomembranes, 2006, 1758, 394-403.
15 Y. Ji, J. Yang, L. Wu, L. Yu and X. Tang, Angew. Chem. Int. Ed.,
2016, 55, 2152-2156.
the attachment of single folic acid moiety, but still need
transfection agents to assist their efficient delivery and
effective release for further gene silencing. With the
attachment of single folic acid at 5′ end of antisense strand
RNA, FA modified caged siRNA was nearly inert due to the 16 J. Yang, C. Chen and X. Tang, Bioconjugate Chem., 2018, 29
,
1010-1015.
17 L. Yu, D. Liang, C. Chen and X. Tang, Biomacromolecules,
2018, 19, 2526-2534.
18 Z. Liangliang, C. Changmai, F. Xinli and T. Xinjing,
ChemBioChem, 2018, 19, 1259-1263.
steric blocking effect on RISC formation or processing. Light
irradiation quickly recovered the active siRNA and triggered
RNAi induced gene silencing machinery. With this caging
strategy, both the exogenous gene (GFP) and endogenous
gene (Eg5) were successfully achieved using these caged 19 Y. Hattori and Y. Maitani, J. Controlled Release, 2004, 97
,
173-183.
siRNAs with single folic acid modification at 5' end of antisense
strand RNA. This modification strategy proves a clue for
practical applications to photomodulate RNAi induced gene
silencing in future.
20 E. Nogueira, A. C. Gomes, A. Preto and A. Cavaco-Paulo,
Nanomedicine: Nanomed-Nanotechnol, 2016, 12, 1113-1126.
21 P. S. Low, W. A. Henne and D. D. Doorneweerd, Accounts
Chem. Res., 2008, 41, 120-129.
22 S. Sabharanjak and S. Mayor, Adv. Drug Delivery Rev., 2004,
56, 1099-1109.
23 C. Hu, Z. Wu, H. Tang, L.-J. Tang, R.-Q. Yu and J.-H. Jiang, Int. J.
Mol. Sci., 2014, 15, 5221-5232.
24 R. Schneider, F. Schmitt, C. Frochot, Y. Fort, N. Lourette, F.
Guillemin, J.-F. Müller and M. Barberi-Heyob, Bioorgan. Med.
Chem., 2005, 13, 2799-2808.
Conflicts of interest
There are no conflicts to declare
25 S. Wang, R. J. Lee, C. J. Mathias, M. A. Green and P. S. Low,
Bioconjugate Chem., 1996, 7, 56-62.
This work was supported by National Major Scientific and 26 R. Xie, S. Hong, L. Feng, J. Rong and X. Chen, J. Am. Chem.
Acknowledgements
Soc., 2012, 134, 9914-9917.
27 D. Feng, Y. Song, W. Shi, X. Li and H. Ma, Anal. Chem., 2013,
85, 6530-6535.
28 M. Thomas, S. A. Kularatne, L. Qi, P. Kleindl, C. P. Leamon, M.
J. Hansen and P. S. Low, Ann. N. Y. Acad. Sci., 2009, 1175, 32-
39.
Technological Special Project for “Significant New Drugs
Development” (Grant No. 2017ZX09303013) and the National
Science Foundation of China (Grant NO: 21422201, 21372018,
and 21672015).
29 C. Dohmen, T. Fröhlich, U. Lächelt, I. Röhl, H.-P. Vornlocher,
P. Hadwiger and E. Wagner, Mol. Ther.-Nuc. Acids, 2012, 1,
e7.
30 J. M. Govan, D. D. Young, H. Lusic, Q. Liu, M. O. Lively and A.
Deiters, Nucleic Acids Res., 2013, 41, 10518-10528.
31 T. M. Kapoor and T. J. Mitchison, J. Cell Biol., 2001, 154,
1125-1133.
32 M. J. Damha and K. K. Ogilvie, in Protocols for
Oligonucleotides and Analogs: Synthesis and Properties, ed.
S. Agrawal, Humana Press, Totowa, NJ, 1993, DOI:
10.1385/0-89603-281-7:81, pp. 81-114.
Notes and references
1
N. Ankenbruck, T. Courtney, Y. Naro and A. Deiters, Angew.
Chem. Int. Ed., 2017, 57, 2768-2798.
2
C. Chen, Z. Yang and X. Tang, Med. Res. Rev., 2018, 38, 829-
869.
3
4
V. Mikat and A. Heckel, RNA, 2007, 13, 2341-2347.
C. M. Connelly, R. Uprety, J. Hemphill and A. Deiters, Mol.
Biosyst., 2012, 8, 2987-2993.
5
B. K. Ruble, S. B. Yeldell and I. J. Dmochowski, J. Inorg.
Biochem., 2015, 150, 182-188.
6 | J. Name., 2012, 00, 1-3
This journal is © The Royal Society of Chemistry 20xx
Please do not adjust margins

Please do not adjust margins
Organic & Biomolecular Chemistry
Page 7 of 8
View Article Online
DOI: 10.1039/C8OB01952E
Journal Name
ARTICLE
33 D. A. Stetsenko and M. J. Gait, Bioconjugate Chem., 2001, 12
,
576-586.
34 R. P. Fahlman and D. Sen, J. Am. Chem. Soc., 2002, 124
,
4610-4616.
35 Z. Wu, Z. Zhen, J.-H. Jiang, G.-L. Shen and R.-Q. Yu, J. Am.
Chem. Soc., 2009, 131, 12325-12332.
This journal is © The Royal Society of Chemistry 20xx
J. Name., 2013, 00, 1-3 | 7
Please do not adjust margins

Organic & Biomolecular Chemistry
Page 8 of 8
View Article Online
DOI: 10.1039/C8OB01952E
TOC
Photoregulating gene expression using folic acid modified caged siRNA through complex
formation of folic acid/folate receptor