SNP discrimination by tolane-modified peptide nucleic acids: Application for the detection of drug resistance in pathogens

Article abstract of DOI:10.3390/molecules25040769

During the treatment of viral or bacterial infections, it is important to evaluate any resistance to the therapeutic agents used. An amino acid substitution arising from a single base mutation in a particular gene often causes drug resistance in pathogens. Therefore, molecular tools that discriminate a single base mismatch in the target sequence are required for achieving therapeutic success. Here, we synthesized peptide nucleic acids (PNAs) derivatized with tolane via an amide linkage at the N-terminus and succeeded in improving the sequence specificity, even with a mismatched base pair located near the terminal region of the duplex. We assessed the sequence specificities of the tolane-PNAs for single-strand DNA and RNA by UV-melting temperature analysis, thermodynamic analysis, an in silico conformational search, and a gel mobility shift assay. As a result, all of the PNA-tolane derivatives stabilized duplex formation to the matched target sequence without inducing mismatch target binding. Among the different PNA-tolane derivatives, PNA that was modified with a naphthyl-type tolane could efficiently discriminate a mismatched base pair and be utilized for the detection of resistance to neuraminidase inhibitors of the influenza A/H1N1 virus. Therefore, our molecular tool can be used to discriminate single nucleotide polymorphisms that are related to drug resistance in pathogens.

Full text of DOI:10.3390/molecules25040769

ASrNticleP Discrimination by Tolane-Modified Peptide
Nucleic Acids: Application for the Detection of Drug
Resistance in Pathogens
1
1
1
1
1
Kenji Takagi , Tenko Hayashi , Shinjiro Sawada , Miku Okazaki , Sakiko Hori ,
1
1
2,
1,2,
Katsuya Ogata , Nobuo Kato , Yasuhito Ebara * and Kunihiro Kaihatsu
*
1
Department of Organic Fine Chemicals, The Institute of Scientific and Industrial Research, Osaka
University, 8-1 Mihogaoka, Ibaraki, Osaka 567-0047, Japan; takagi33@sanken.osaka-u.ac.jp (K.T.);
haya33@sanken.osaka-u.ac.jp (T.H.); sinistergale@yahoo.co.jp (S.S.);
okazaki33@sanken.osaka-u.ac.jp (M.O.); hori_s@visgene.com (S.H.); ogata-k@visgene.com (K.O.);
kato-n@sanken.oska-u.ac.jp (N.K.)
Graduate School of Human Development and Environment, Kobe University, 3-11 Tsurukabuto, Kobe,
Hyogo 657-8501, Japan
2
* Correspondence: kunihiro@sanken.osaka-u.ac.jp (K.K.), ebara@kobe-u.ac.jp (Y.E.); Tel.: +81-78-803-7759
Received: 7 January 2020; Accepted: 7 February 2020; Published: 11 February 2020
Abstract: During the treatment of viral or bacterial infections, it is important to evaluate any
resistance to the therapeutic agents used. An amino acid substitution arising from a single base
mutation in a particular gene often causes drug resistance in pathogens. Therefore, molecular tools
that discriminate a single base mismatch in the target sequence are required for achieving
therapeutic success. Here, we synthesized peptide nucleic acids (PNAs) derivatized with tolane
via an amide linkage at the N-terminus and succeeded in improving the sequence specificity, even
with a mismatched base pair located near the terminal region of the duplex. We assessed the
sequence specificities of the tolane-PNAs for single-strand DNA and RNA by UV-melting
temperature analysis, thermodynamic analysis, an in silico conformational search, and a gel
mobility shift assay. As a result, all of the PNA-tolane derivatives stabilized duplex formation to
the matched target sequence without inducing mismatch target binding. Among the different
PNA-tolane derivatives, PNA that was modified with a naphthyl-type tolane could efficiently
discriminate a mismatched base pair and be utilized for the detection of resistance to
neuraminidase inhibitors of the influenza A/H1N1 virus. Therefore, our molecular tool can be
used to discriminate single nucleotide polymorphisms that are related to drug resistance in
pathogens.
Keywords: peptide nucleic acid; tolane; single nucleotide polymorphism; influenza virus; drug
resistance
1. Introduction
A single nucleotide polymorphism (SNP), as a variation at a single position in a gene sequence
among individuals [1], within viral genes often confers drug resistance to the pathogen, such as
HIV-1 drug resistance [2] or oseltamivir-resistant influenza virus [3]. Therefore, the
sequence-specific detection of SNPs in target genes while using oligonucleotides is a key technology
for detecting pathogens and disease-related genes. The accuracy and sensitivity of diagnosis relies
on the chemical properties of the oligonucleotides that were used for detection. Thus, various types
of chemically modified nucleic acids have been developed to improve the binding affinity and
sequence specificity. Peptide nucleic acids (PNAs) are DNA mimics in which the phosphate
backbone has been replaced by a neutral amide backbone composed of N-(2-aminoethyl)glycine
Molecules 2020, 25, 769; doi:10.3390/molecules25040769
www.mdpi.com/journal/molecules

Molecules 2020, 25, 769
2 of 20
linkages [4]. The advantages of PNAs are their high binding affinity [5–7], good mismatch
discrimination [8], nuclease and protease resistance [9], and low affinity for proteins [10].
Up to now, PNAs have been used to detect single nucleotide polymorphisms (SNPs) through a
combination with various types of other technologies. Ross et al. have utilized PNAs to detect SNPs
in target genes while using matrix-assisted laser desorption/ionization time-of-flight mass
spectrometry (MALDI-TOFMS) of PCR products. This ability to detect SNPs can be achieved,
because PNAs can form stable complexes with their target genes under low salt conditions [11]. In
order to perform the simultaneous detection of multiple SNP sites in dsDNA by MALDI-TOFMS,
Ren et al. mixed multiple PNAs and dsDNA and treated them first with exonuclease III and then
with nuclease S1 to produce PNA/ssDNA fragments, including the SNP sites in situ. They
succeeded in discriminating between various apolipoprotein E genotypes in patients while using
dsDNAs that were obtained by PCR [12]. Boontha et al. developed a new ion-exchange capture
technique for SNP detection using a pyrrolidinyl PNA probe. The complementary PNA/DNA
hybrid is selectively captured by the anion exchanger in the presence of noncomplementary or
unhybridized PNA, allowing for the direct detection of the hybridization event on the anion
exchanger by MALDI-TOFMS. The accuracy of MALDI-TOFMS, in conjunction with the high
specificity of PNA hybridization, offers promise for development into a multiplexed,
high-throughput screening technique [13].
Gaylord et al., developed a method for the fluorescence-based detection of SNPs while using
PNA
probes
conjugated
with
an
optically
amplifying
conjugated
polymer
and S1
poly[(9,9-bis(6′-N,N,N-trimethylammoniumhexylbromide)
fluorene)-co-phenylene],
nuclease. Recognition is accomplished by the sequence-specific hybridization between the
uncharged, fluorescein-labeled, PNA probe, and the DNA sequence of interest. After subsequent
treatment with S1 nuclease, the cationic polymer electrostatically only associates with the remaining
anionic PNA/DNA duplex, leading to the sensitized fluorescence emission of the labeled PNA
probe via FRET from the cationic polymer [14]. They succeeded in detecting a known point
mutation that had been implicated in a dominant neurodegenerative dementia known as
frontotemporal dementia with Parkinsonism linked to chromosome 17 (FTDP–17), which has
clinical and molecular similarities to Alzheimer’s disease.
The fluorescence-based detection of SNPs is a simple, rapid, and robust technology.
Rockenbauer et al. reported a new method that combined allele-specific hybridization, PNA
technology, and detection while using flow cytometry. These authors described a fully functional
two-bead genotyping system based on PNA capture and flow cytometric detection that they used
for the accurate and fast re-genotyping of a Danish basal cell carcinoma cohort [15]. Bethge et al.
synthesized forced intercalation probes (FIT-probes) that contained an intercalating cyanine dye,
such as oxazole yellow (YO), which serves as a replacement for a canonical nucleobase. The YO in
the FIT probes responds to adjacent base mismatches through the attenuation of fluorescence
intensity under conditions where both matched and mismatched target DNAs are bound. The
YO-PNA is capable of signaling the presence of fully complementary DNA by providing an up to
20-fold enhancement in fluorescence. Single base mismatches cause a significant attenuation of YO
fluorescence [16]. Socher et al. also employed a thiazole orange (TO) modified FIT-PNA molecule to
monitor SNPs in a target gene. They found that the use of D-ornithine rather than
aminoethylglycine as the PNA backbone increased the intensity of the fluorescence emitted by
matched probe-target duplexes, while the specificity of fluorescence under non-stringent conditions
was also increased. The utility of these ornithine-containing FIT probes was demonstrated in a
real-time PCR analysis providing a linear measurement range over at least seven orders of
magnitude [17]. Ditmangklo et al. synthesized novel alkyne-modified styryl dyes for conjugation
with pyrrolidinyl peptide nucleic acid (acpcPNA) while using click chemistry to detect the presence
of structural defects, including mismatched, abasic, and base-inserted DNA targets. The largest
increase in the fluorescence quantum yield (up to 14.5–fold) of styryl-dye-labelled acpcPNA was
achieved with DNA carrying base insertions [18].

Molecules 2020, 25, 769
3 of 20
Kam et al. succeeded in discriminating SNPs in the KRAS oncogene in cultured cells while
using two types of molecular beacons (MBs) based on either phosphothioated DNA (PS-DNA-MB)
or peptide nucleic acid (TO-PNA-MB, where TO = thiazole orange). Cell transfection of
TO-PNA-MB with the aid of PEI resulted in fluorescence in cells expressing the fully
complementary RNA transcript (Panc-1), but undetectable fluorescence in cells expressing the K-ras
mRNA that had a single mismatch to the TO-PNA-MB (HT29). In contrast, PS-DNA-MB showed no
fluorescence in all the cell lines that were tested post PEI transfection [19]. Further, Kolevzon et al.
synthesized a PNA bis-quinoline that was capable of detecting mutant K-ras mRNAs in cultured
cells by monitoring far-red emission [20].
As mentioned above, PNA is a powerful tool that can be used to discriminate SNPs when used
in combination with a mass spectrometer, PCR, or a fluorescence detector. The usefulness of PNA
will be further amplified if it could be used for the rapid diagnosis of viral and bacterial
drug-resistance in clinical specimens. This could be achieved by improving the hybridization
properties of the PNA, eliminating the need for any expensive equipment. We recently reported
that the hybridization property of a PNA could be enhanced by azobenzene modification at the
N-terminus [21]. We also attached intercalators containing larger pi-conjugated systems, such as
acridine and pyrene to the N-terminus of PNA via amide linkages. However, these modifications
increased binding not only to the matched DNA, but also to the mismatched DNA (data not
shown). Dogan et al. [22] reported that modification by stilbene, an orthogonal molecule, at the
5′-terminus of the DNA, also enhanced the binding affinity for matched DNA/DNA duplex
formation, without increasing the formation of mismatched duplexes. These reports inspired us to
explore modification of the N-terminus end of PNA with a more rigid and orthogonal molecule
when compared to stilbene, which could increase the binding affinity and sequence specificity of
PNA to DNA and RNA.
In this study, we designed and synthesized various types of intercalators utilizing a
diphenylachetylene(tolane) backbone and attached them to the N-terminus of the PNA via amide
linkage. The binding affinities and sequence specificities of these PNA derivatives for DNA or RNA
were assessed by a UV-melting temperature analysis and a gel mobility shift assay. We also
developed a novel type of rapid diagnostic test kit for discriminates SNP relating neuraminidase
inhibitor-resistant virus of the seasonal influenza virus.
2. Results and Discussion
2.1. Design and Synthesis of PNA and Tolane-PNA
The typical duplex structure of PNA/DNA has been reported in the Protein Data Bank
(PDB:1PDT). We introduced a diphenylacetylene (tolane) derivative to the N-terminal of PNA via
an amide linkage and performed an in silico conformational search while using MacroModel to
design a chemically modified PNA that can form a stable stacking conformation with the terminal
base pairs (Figure 1). As can be seen in Figure 1, the tolane molecule (Figure 2, tolane1) appeared to
form a stacking interaction with a neighboring base pair in the terminal region of the PNA/DNA
duplex. We reasoned that the optimization of the linker length in tolane might further enhance the
stacking conformation in the PNA/DNA duplex. Accordingly, we synthesized a series of tolane
molecules that had different linker lengths or pi-conjugation systems (Figure 2). These were
introduced to the N-terminal region of a 12-mer poly-pyrimidine PNA (PNA0) that is known to be
sensitive to mismatches and it is unable to form a triplex with the target DNA (Table 1). The lysine
at the C-terminus was introduced to increase the water solubility of the PNA.

Molecules 2020, 25, 769
4 of 20
Figure 1. Conformational search of the tolane1 modified Peptide nucleic acid (PNA)/DNA duplex.
The original PNA/DNA duplex structure was obtained from the Protein Data Bank (PDB:1PDT).
The conformational search was performed while using the force field OPLS2005 model in
MacroModel.
Figure 2. Chemical structure of the tolane derivatives. 1–5) tolanes containing different alkyl linker
lengths, 6–8) tolanes containing either ether or amide linkages, 9–12) tolanes containing different

Molecules 2020, 25, 769
5 of 20
pi-conjugation systems. Tolane1-PNA) Schematic diagram of tolane1 modified PNA. A lysine
residue was introduced to the C-terminus of the PNA molecule to increase water solubility. Tolane1
was attached to the N-terminal amino group through an amide linkage.
Table 1. PNA and DNA sequences used for studying the effect of tolane molecules on UV-melting
temperature analysis.
Mass
Name
PNA (N-C)/DNA or RNA (5-3)
Calculated
3258.38
3490.67
3476.65
3504.70
3518.73
3532.76
3520.70
3520.70
3533.72
3570.76
3644.85
3550.73
3545.71
-
Found
3261.74
3495.84
3482.33
3508.71
3519.78
3536.00
3520.79
3521.16
3534.27
3570.68
3642.05
3552.13
3546.78
-
PNA0
PNA1
PNA2
PNA3
PNA4
PNA5
PNA6
PNA7
PNA8
PNA9
PNA10
PNA11
PNA12
DNA1
DNA2
TTCCCTCCTCTA-Lys
Tolane1-TTCCCTCCTCTA-Lys
Tolane2-TTCCCTCCTCTA-Lys
Tolane3-TTCCCTCCTCTA-Lys
Tolane4-TTCCCTCCTCTA-Lys
Tolane5-TTCCCTCCTCTA-Lys
Tolane6-TTCCCTCCTCTA-Lys
Tolane7-TTCCCTCCTCTA-Lys
Tolane8-TTCCCTCCTCTA-Lys
Tolane9-TTCCCTCCTCTA-Lys
Tolane10-TTCCCTCCTCTA-Lys
Tolane11-TTCCCTCCTCTA-Lys
Tolane12-TTCCCTCCTCTA-Lys
ATGTCCTAGAGGAGGGAATAA
ATGTCCTAGAGGAGGGCATAA
-
-
Lys: lysine, Underlined: mismatch base. Calculated: expected molecular weight, Found: molecular
weight identified by MALDI-TOFMS.
2.2. The Effect of Linker Structures in the Tolane-PNAs on Duplex Stability with Single Strand DNA
The thermal stabilities of the tolane-PNA/DNA duplexes were used to assess the effects of the
different tolane derivatives on duplex stability. We measured the melting temperature (Tm) of
PNA0–12 with a single stranded DNA (DNA1). The Tm of the matched PNA0/DNA1 was 56.5 °C,
while that of the mismatched PNA0/DNA2 was 48.6 °C, thus representing a difference of 7.9 °C.
PNAs 1–5 represent molecules with different lengths of the alkyl chain spacer that lies between
the PNA and the tolane moiety. The Tms of their duplexes with DNA1 increased in an alkyl
length-dependent manner until the tolane linker was pentanoic acid (Table 2. PNA4, 61.7 °C). The
PNA5/DNA1 duplex, which contained a hexanoic acid linker, had a lower Tm than the
PNA4/DNA1 duplex (Table 2. 59.6 °C). Pentanoic acid seemed to be an optimal linker length for
tolane-PNA conjugates based on these data. Interestingly, the Tms of the PNA0-5/DNA2
mismatched duplexes did not increase with alkyl chain length (Table 2. Tm = 48.1–48.8 °C). Among
PNA0–5, PNA4 gave the largest ΔTm (+13.0 °C), which was 5.1 °C larger than that of PNA0 (ΔTm =
+7.9 °C). Tolane4 in PNA4 could efficiently associate with adjacent base pairs in the matched
PNA/DNA duplex and it also stabilized the duplex formation.
We further investigated the effect of the chemical structure of the tolane linkers on PNA/DNA
duplex formation. We elected to use a tolane linker length, which was the same as hexanoic acid;
however, we substituted the aliphatic linkers with two more flexible and hydrophilic ether linkers
(Figure 2, tolane6-7) or a more rigid amide linkage (Figure 2. tolane8). The two different types of
ether linkers and the amide linker were introduced to the N-terminus of PNA, as shown in Table 1
(PNA6–8). PNA6 and PNA7 both contain flexible ether linkers that increased duplex stability with
DNA1 relative to PNA4 (Table 2, PNA6/DNA1 Tm = 63.0 °C, PNA7/DNA1 Tm = 62.2 °C). In
contrast, PNA8 contains a more rigid amide linker that had a slightly lower Tm (Table 2,
PNA8/DNA1 Tm = 60.9 °C) when compared to PNA4. We performed a conformational search of
tolane6 and tolane8 in the PNA/DNA duplex (PDB:1PDT) by an in silico conformational search

Molecules 2020, 25, 769
6 of 20
®
while using MacroModel to understand the mode of binding of tolane molecules within the
PNA/DNA duplex. As a result, the flexible ether linker of tolane6 efficiently formed stacking
conformation with the terminal base pairs, while the rigid amide linked tolane8 did not (Figure 3).
Table 2. Thermal stability of PNA/DNA and tolane-PNA/DNA duplexes.
Tm (°C)
PNA
1
2
3
Match
Mismatch
48.6 ± 0.9
48.8 ± 0.7
48.5 ± 0.9
48.1 ± 0.7
48.7 ± 0.8
48.4 ± 0.3
48.5 ± 0.9
48.8 ± 0.6
48.7 ± 0.4
48.3 ± 0.9
∆Tm
7.9
0
1
2
3
4
5
6
7
8
56.5 ± 0.9
60.8 ± 0.6
59.3 ± 0.9
60.1 ± 0.1
61.7 ± 0.9
59.6 ± 0.2
63.0 ± 0.6
62.2 ± 0.3
60.9 ± 0.3
64.8 ± 0.6
12.0
10.8
12.0
13.0
11.2
14.5
13.4
12.2
16.5
9
4
4
4
10
11
12
60.7 ± 1.2
60.9 ± 0.5
63.3 ± 0.7
48.6 ± 0.3
48.9 ± 0.7
49.2 ± 0.2
12.1
12.0
14.1
1 Mean Tm ± SD (n = 3), Tm between each PNA and DNA1, 2Mean Tm ± SD (n = 3), Tm between each
PNA and DNA2. ΔTm = Tm(matched) − Tm(mismatched). 20% methanol was added to dissolve
3
4
the pyrene-PNA in 20 mM phosphate buffer (pH 7.4).
Figure 3. Molecular docking simulation of the tolane-PNA/DNA duplex conformation. Left: tolane6
in PNA forms a favorable stacking conformation with the terminal base pair of the PNA/DNA
duplex via its flexible ether linker. Right: tolane8 in PNA forms a stacking interaction with the DNA
bases, but not with the terminal base of the PNA due to the rigidity of the amide backbone. The
PNA/DNA duplex structures were obtained as 1PDT from the PDB data bank and the
conformational search was performed using the force field OPLS2005 model and MacroModel.
Green; DNA, Blue; PNA conjugated with tolane6, Orange; PNA conjugated with tolane8.
We performed a conformational search using the same procedures to understand the different
effects of tolane6 and tolane7. As a result, tolane6 formed a stable stacking interaction with the
adjacent PNA/DNA base pair, while tolane7 could only form a stacking interaction with the DNA
bases (Figure 4). Regardless of the flexibility of the linker, PNA 6 and 7 did not show an increase in
the Tm for the duplex with mismatched DNA2 (Table 2). From these results, we chose the
ethoxyacetate linker for the further optimization of the tolane molecules.

Molecules 2020, 25, 769
7 of 20
Figure 4. Molecular docking simulation of the tolane-PNA/DNA duplex conformation. Left: tolane6
formed a favorable stacking conformation with the terminal base pair of the PNA/DNA duplex via
its flexible ether linker. Right: tolane7 was unable to form a stacking interaction with the N-terminal
base pair due to the rigidity of the amide linker. The PNA/DNA duplex structures were obtained as
1PDT from the PDB data bank and the conformational search was performed with the OPLS2005
force field and gradient termination at 0.001 kJ/mol-Å (MacroModel, 2010).
2.3. Modification of the Tolane Structure to Enhance the Stacking Interaction with the PNA/DNA Duplex.
In the previous section, the optimization process showed that the ethoxyacetic acid linker
(tolane6) was the best candidate among tolane1–8. We next modified the structure of the tolane
backbone to enhance the stacking interaction with the terminal base pairs of the PNA/DNA.
According to our in silico conformational search that is shown in Figure 5, an extended pi-conjugate
system might increase the stacking interaction with the terminal base pair of PNA/DNA (Figure 5.
Top view of the tolane-PNA/DNA duplex. Red: tolane6, White: terminal base pair).
Figure 5. Conformational search of tolane6-PNA/DNA using MacroModel. Force Field; OPLS2005,
Solvent: water, Red; tolane. White; terminal base pairs.
Based on these data, we synthesized tolane9 and 10, which had extended pi-conjugated
systems in their terminal phenyl group and tolane11 and 12 that had an electron donor and an
acceptor group, respectively. Each compound was attached to the amino group at the N-terminus
of the PNA and the resulting DNA binding affinities were assessed by a UV-melting temperature
analysis (Table 2). As a result, tolane9, which contains a naphthyl group, increased the duplex
stability with DNA1 (Table 2, Tm = 64.8 °C) and the thermal stability was found to be higher than
that of tolane6 (Tm = 63.0 °C). On the other hand, tolane9 had almost no effect on the thermal
stability of the mismatched PNA9/DNA2 duplex (Table 2, Tm = 48.3 °C). As PNA 10 possesses a
pyrene group, it has poor solubility in aqueous solution. Therefore, we used 20% methanol in a
phosphate buffered solution to measure the Tm of DNA1. As a result, the pyrene containing tolane
10, which has an enhanced pi-conjugated system and had a lower Tm when compared to tolane 9
(Table 2, Tm = 60.7 °C). Although the pi-conjugated system in tolane 10 is larger than that tolane 9,
the poor water solubility of tolane10 made it unsuitable for forming a stacking interaction with the
neighboring base pairs in the PNA 10/DNA1 duplex when in an aqueous solution.

Molecules 2020, 25, 769
8 of 20
We next examined the effect of functional groups at the para-position in tolane on the thermal
stability of the PNA/DNA duplex. PNA11, which has an electron donating methoxy group in
tolane11, had a lower Tm (Table 2, Tm = 60.9 °C) when compared to PNA7. The structural bulkiness
of the methoxy group in tolane11 might cause steric hindrance with the neighboring base pairs in
PNA12/DNA1 and prevent the stacking interaction. PNA13, which has an electron withdrawing
cyano group in tolane12, had nearly the same Tm (Table 2, Tm = 63.3 °C) as PNA6. These data
indicate that the electron density of the tolane molecule does not affect the stacking interaction with
the terminal base pair of the tolane-PNA/DNA. Overall, the tolane derivatives did not stabilize the
mismatch duplex formation of the tolane-PNA/DNA, regardless of the modified functional groups.
Based on the ΔTm (16.5 °C) in Table 2, PNA9, which is a naphthyl type tolane (tolane 9), had the
best sequence specificity.
2.4. Analysis of the Duplex Conformation of the Tolane-PNA/DNA Duplexes by Fluorescence Spectroscopy.
We analyzed the fluorescence spectra of PNA9 in the absence or presence of matched DNA1 or
mismatched DNA2 to understand the mode of action of tolane9 in the PNA/DNA duplex. PNA9
was dissolved in 20 mM phosphate buffer (pH 7.4) at a concentration of 4 M at 25 °C. The
excitation wavelength of tolane9 in PNA9 was found to be 323 nm, while the emission wavelength
was found to be 384 nm (Figure 6, fluorescence intensity: 402.24). The fluorescence intensity was
drastically quenched to 151.94 when PNA9 was mixed with matched DNA1 at a 1:1 molar ratio
(Figure 6). This is likely to be as the result of the stacking interaction of tolane9 with the
neighboring base pairs in PNA9/DNA1. On the other hand, when PNA9 was mixed with
mismatched DNA2 at a 1:1 molar ratio, the fluorescence intensity was decreased by about half
relative to DNA1 (Figure 6, fluorescence intensity: 271.33). These results indicated that tolane9
could form an efficient stable stacking conformation with matched DNA1. When a penultimate base
pair of the PNA/DNA was mismatched, tolane9 did not form a stable stacking conformation with
an adjacent base pair due to the fraying of the base pairs in the terminal region.
Figure 6. The fluorescence spectra of PNA9 (solid), PNA9/DNA1 (dashed-dotted line), and
PNA9/DNA2 (dashed line) were measured in 20 mM sodium phosphate buffer (pH 7.4). Conditions:
PNA, DNA = 4 M, Excitation = 323 nm, Emission = 384 nm, Temperature = 25 °C.
2.5. Thermodynamic Study of the PNA/DNA and Tolane-PNA/DNA Duplexes.
We analyzed the thermodynamic parameters of PNA0 and PNA9 with matched DNA1 and
mismatched DNA2 to study the binding behavior of tolane9. The Tm values of the duplex varied
depending on their total concentration. Thus, we measured the Tm of each duplex and plotted
1/Tm on the vertical axis and ln(Ct/4) on the horizontal axis, as shown in Figure 7. The enthalpy
(∆H) was calculated from the slope of the approximate line obtained, and the entropy (∆S) was

Molecules 2020, 25, 769
9 of 20
calculated from the intercept, as indicated in equation (1) below. Figure 7 shows the actual plots
and approximate straight lines. ∆G was calculated based on equation (2).
1/Tm = (R/ΔH)ln(Ct/4) + ΔS/ΔH
(1)
(2)
ΔG = ΔH − TΔS
Figure 7. Tm plot of the PNA/DNA and tolane-PNA/DNA duplexes at different concentrations in 20
mM phosphate buffer (pH 7.4). The R/∆H values were calculated from the slope of each
approximate straight line. The ∆S/∆H values were calculated from the estimated intercept on the
1/Tm line as ln(Ct/4) approached zero.
We obtained the R/ΔH for PNA0/DNA1, PNA0/DNA2, PNA9/DNA1, and PNA9/DNA2,
−5
−5
−5
−5
−1
which was 3.25 × 10 , 4.47 × 10 , 2.52 × 10 , and 4.18 × 10 (K ), respectively, according to the
approximate straight line in Figure 7. In addition, the ΔS/ΔH ratio for PNA0/DNA1, PNA0/DNA2,
−6
−6
−6
−6
PNA9/DNA1, and PNA9/DNA2 was calculated as 2.60 × 10 , 2.55 × 10 , 2.64 × 10 , and 2.55 × 10
−1
(K ), respectively. The heat capacity should be negligible. The gas constant (R) was 0.00199
(kcal/(mol·K)). These data were used for calculating the ΔH, ∆S, and ΔG values, according to
equations (1) and (2), and they are summarized in Table 3.
The ΔG values in Table 3 showed good correlations with the Tm values. When comparing the
ΔH of the matched PNA/DNA duplex, PNA9 (−79.1 kcal/mol) had a smaller value than PNA0
(−61.8 kcal/mol), which indicates that tolane9 forms a stacking interaction with the neighboring base
pairs by intermolecular bindings, such as pi–pi stacking interactions and hydrogen bonds. When
comparing the ∆S of the matched PNA/DNA, PNA9 (−208.8 cal/mol·K) had a smaller value than
PNA0 (−159.5 cal/mol·K), which indicates that the stacking interaction of tolane9 impairs the
structural flexibility at the terminal region of the PNA/DNA duplex. However, the enthalpy
contribution was relatively bigger than the loss of entropy, so, as a result, the free energy of PNA9
(−16.9 kcal/mol) was lower than PNA0 (−13.7 kcal/mol) and formed a stable duplex. Looking at the
thermodynamic parameters of the mismatched duplexes in Table 3 revealed that PNA0 and PNA9
had almost the same values. This suggested that tolane9 has negligible interaction with PNA/DNA
duplex when the mismatched base is located at the second base position from the terminus. This
sequence specificity was caused by the structural rigidity of the tolane, since the diphenylacetylene
backbone can adopt a stacking conformation only when the terminal base pair forms a matched
duplex.
Table 3. Thermodynamic parameters of the PNA/DNA duplex.

Molecules 2020, 25, 769
10 of 20
∆G°(298K)
(kcal/mol) (kcal/mol) (cal/mol·K)
∆H°
∆S°(298K)
Tm
C
°
PNA0/DNA1
PNA9/DNA1
PNA0/DNA2
PNA9/DNA2
−13.7
−16.9
−10.7
−11.3
−61.8
−79.1
−44.6
−47.6
−159.5
−208.8
−113.7
−121.5
56.6 ± 0.9
64.9 ± 0.6
49.4 ± 0.9
50.2 ± 0.9
2.6. Recognition of Single Base Mismatched DNA by Tolane 9
We prepared DNA3-5, which had three single base mismatches at the first, second, and third
bases from the 3′-terminus, respectively, to confirm that tolane9 can discriminate a single base
mismatch in its target DNA (Table 4). As summarized in Table 5, tolane9 in PNA9 slightly
increased the Tm for the mismatched DNAs (DNA3: +0.3–+2.5 °C, DNA4: +0.8–2.6 °C, DNA5: +0.3–
1.5 °C) compared to PNA0/DNA3–4. On the other hand, PNA9 increased the Tm for the matched
DNA by approximately 8.3 °C. Therefore, its sequence specificity is improved, as shown in Figure 8,
as ∆Tm [∆Tm = Tm (matched) − Tm (mismatched), maximum ∆Tm; +14.7 °C (T/C mismatch with
DNA4), minimum ∆Tm; +4.8 °C (T/G mismatch with DNA3)]. Although there are many other
possible mismatch variations in the PNA/DNA duplex, we think that tolane9 can improve the
sequence specificity, regardless of the exact location of the mismatch.
Table 4. PNA and DNA sequences used to study single base mismatch discrimination. The
underlined sequences in DNA3, 4, and 5 were the mismatched bases to both PNA0 and PNA9.
PNA (N-C)/DNA (5-3)
PNA0
PNA9
DNA 1
TTCCCTCCTCTA-Lys
Tolane9-TTCCCTCCTCTA-Lys
ATGTCCTAGAGGAGGGAATAA
DNA3-T ATGTCCTAGAGGAGGGATTAA
DNA3-G ATGTCCTAGAGGAGGGAGTAA
DNA3-C ATGTCCTAGAGGAGGGACTAA
DNA4-T ATGTCCTAGAGGAGGGTATAA
DNA4-G ATGTCCTAGAGGAGGGGATAA
DNA4-C ATGTCCTAGAGGAGGGCATAA
DNA5-T ATGTCCTAGAGGAGGTAATAA
DNA5-A ATGTCCTAGAGGAGGAAATAA
DNA5-C ATGTCCTAGAGGAGGCAATAA
Table 5. UV-melting temperature analysis of PNA0 and PNA9 with DNA containing a single base
mismatch at the first (DNA3), second (DNA4), and third (DNA5) base from the N-terminus of the
PNA.
Tm (°C)
1
1
1
1
Matched
DNA1
T/A
Mismatched
DNA3
Mismatched
DNA4
Mismatched
DNA5
PNA
T/T
57.0
T/G
57.7
T/C
53.0
T/T
56.7
T/G
56.6
T/C
49.6
C/T
54.0
C/A
53.7
C/C
52.5
56.6
(±0.9)
64.9
(±0.6)
PNA0
PNA9
(±0.4) (±0.3) (±0.9) (±1.9) (±1.2) (±0.9) (±0.8) (±0.7) (±1.1)
59.5 60.1 53.3 58.5 59.2 50.2 55.4 55.2 52.8
(±0.1) (±0.3) (±0.2) (±0.8) (±0.9) (±0.9) (±0.4) (±0.5) (±0.5)
1 Mean Tm ± SD (n = 3), PNA, DNA; 4 M each in 20 mM phosphate buffer (pH 7.4).

Molecules 2020, 25, 769
11 of 20
Figure 8. Measurement of Tm for PNA0/DNAs and PNA9/DNAs in 20 mM phosphate buffer (pH
7.4). ∆Tm = Tm (matched) − Tm (mismatched). DNA1 contains a complementary sequence to the
PNAs. DNA3, DNA4, and DNA5 contain a mismatched base at the first, second, and third base
from the N-terminus of the PNA.
2.7. Detection of Single Nucleotide Polymorphism (SNP) in a Neuraminidase Inhibitor-Resistant Influenza
Virus by PNA13 and PNA14 Using a Gel Mobility Shift Assay.
Neuraminidase inhibitors, such as Zanamivir and Oseltamivir, are antiviral medicines that are
used to treat and prevent influenza virus infections. A SNP in the influenza A virus neuraminidase
gene often causes drug-resistance to those neuraminidase inhibitors. Kawakami et al. identified the
difference between
a
neuraminidase inhibitor-resistant influenza
A
viral gene
(Yokohama/77/2008/H1N1, GenBank Accession number: AB465325) and a neuraminidase
inhibitor-sensitive influenza A viral gene (Yokohama/1/2008/H1N1, GenBank Accession ID:
AB519808) by direct sequencing of the PCR product of the neuraminidase gene during the previous
swine influenza pandemic in 2008–2009 [23]. They found that nucleotide 823 (labeled from the
5′-terminus of the complementary viral RNA gene ((+) stand RNA), which causes a change from an
adenine to a thymine, leads to the substitution of histidine to a tyrosine at amino acid 275 (H275Y).
We synthesized PNA13 and PNA14 that are complementary to the viral gene in Influenza
A/Yokohama/77/H1N1 to discriminate this SNP within the viral RNA((−) strand RNA). We attached
a Lys-O-O-Lys-biotin linker (O; aminoethylethoxyacetate) to increase the water solubility and
develop a nucleic acid chromatography method for the detection of a SNP associated with the
neuraminidase inhibitor-resistance of influenza A/Yokohama/77/H1N1.
We first prepared DNAs that contained the sequences of influenza A/Yokohama/1/2008/H1N1
(Table 6, DNA6) and influenza A/Yokohama/77/2008/H1N1 (Table 6, DNA7) genes and performed
a UV-melting temperature analysis. As a result, PNA14 had a Tm that was 5.8 °C higher with the
matched DNA7 (Tm = 59.3 °C) compared to PNA13/DNA7 (Tm = 53.5 °C). PNA14 had nearly the
same Tm with mismatched DNA6 (47.6°C) relative to PNA13/DNA6 (Tm 48.0 °C). As a result, the
modification of tolane9 to PNA enhanced the ∆Tm by 6.2 °C (i.e., from 5.5 °C (PNA13) to 11.7 °C
(PNA14)). These results indicated that tolane9 only increases the binding affinity to the target
sequence when the sequence is matched.

Molecules 2020, 25, 769
12 of 20
We also assessed the binding of PNA13 and PNA14 to RNA sequences that were derived from
influenza A/Yokohama/1/H1N1(Table 6, RNA1) and influenza A/Yokohama/77/H1N1 (Table 6,
RNA2) neuraminidase genes. Each RNA consisted of 17 bases and the 5-terminus was fluorescently
labelled with Cy5 to allow for the visualization of the binding on a gel (Table 6, RNA1 and RNA2).
PNA14 showed a higher Tm with the matched RNA2 (Table 7, Tm = 55.3 °C) when compared to
PNA13/RNA2 (Table 7, Tm = 51.7 °C). On the other hand, PNA14 showed a significantly lower Tm
with the mismatched RNA1 (Table 7, Tm = 31.5 °C) as compared to PNA13/RNA1 (Table 7, Tm =
40.2 °C). As a result, tolane9 improved the ∆Tm of PNA by 23.8 °C (Table 7), which is 12.3 °C higher
than PNA13 (Table 7, ∆Tm = 11.5). We hypothesized that the lowered binding affinity of PNA14 to
the mismatched RNA could be due to the hydrophobic property of tolane9, which prefers to form
intramolecular interactions with neighboring PNA bases and avoids forming a mismatched duplex
with the hydrophilic RNA that possesses 2′-hydroxyl groups. While using a conformational search
that was conducted using MacroModel, as shown in Figure S1 (supplemental data), we compared
the stability of the capped state of tolane-PNA/DNA, in which tolane forms a stacking interaction
with neighboring base pair in the PNA/DNA duplex, and the backbone binding state of the
tolane-PNA/DNA duplex, in which tolane is bound to the PNA backbone. The capped state is 2 kcal
more stable than the backbone binding state based on the ∆G energy. The difference in ∆G energy
indicates that the relative abundance ratio of the capped state and backbone binding state within
tolane-PNA/DNA is estimated to be 30:1.
Table 6. PNA13 and PNA14 used to detect a neuraminidase inhibitor-resistant gene in influenza
virus A/Yokohama/77/H1N1 derived from a single nucleotide polymorphism (SNP) within the
sequence. RNA1 contains the neuraminidase inhibitor-sensitive gene in influenza virus
A/Yokohama/1/2008/H1N1, while RNA2 contains the neuraminidase inhibitor-resistant gene in
influenza virus A/Yokohama/77/2008/H1N1. DNA6 and DNA7 contain the same sequence as RNA1
and RNA2, except that uracil bases were substituted with thymine bases.
Mass
Calculated. Found
Name
PNA (N-C)/RNA (5-3) or DNA
PNA13
TTTTATTATGAG-Lys-O-O-Lys-biotin
4062.35
4374.45
4063.27
4374.45
PNA14 Tolane9-TTTTATTATGAG-Lys-O-O-Lys-biotin
DNA6
DNA7
RNA1
RNA2
GCATTCCTCATAATAGAAATT
GCATTCCTCATAATAAAAATT
Cy5-GCAUUCCUCAUAAUAGAAAUU
Cy5-GCAUUCCUCAUAAUAAAAAUU
O: aminoethylethoxyacetate.
-
-
-
-
-
-
-
--
Table 7. UV-melting temperature analysis of PNA/DNA and PNA/RNA containing the
neuraminidase inhibitor-resistant and neuraminidase-sensitive gene sequences.
1
2
2
1
Tm (°C)
Tm (°C)
ΔTm (Tm – Tm )
With Sensitive Sequence
With Resistant Sequence
(°C)
PNA13
PNA14
PNA13
PNA14
48.0 (DNA6)
47.6(DNA6)
40.2(RNA1)
31.5 (RNA1)
53.5 (DNA7)
59.3 (DNA7)
51.7(RNA2)
55.3 (RNA2)
5.5
11.7
11.5
23.8
PNA/RNA; 4 M each in 10 mM phosphate buffer and 1 mM EDTA (pH 6.0).
We performed a gel mobility shift assay to study the effect of tolane9 on the duplex formation
between PNA and RNA. Cy5-labelled synthetic RNA oligonucleotides (RNA1 and RNA2 at a final
concentration 100 nM) were incubated with three equivalents of the PNAs (PNA13 and PNA14 at a
final concentration 300 nM) for 10 min. in 10 mM sodium phosphate buffer and 1 mM EDTA (pH
6.0) at 25 °C, 40 °C, and 55 °C. PNA13 bound to both the mismatched RNA1 and the matched RNA2
and gave band shifts on the gel, regardless of the incubation temperature, as shown in Figure 9.

Molecules 2020, 25, 769
13 of 20
PNA showed low sequence specificity, as a mismatch base is located near the terminal of the target
sequence. However, PNA13 showed less binding to the mismatched RNA1, as the incubation
temperature was increased to 55 °C. In contrast, PNA14 showed reduced binding to the
mismatched RNA1 at 40 °C and the band shift was drastically reduced at 55 °C. Tolane-modified
PNA showed improved sequence specificity, as a mismatch base is located near the terminal of the
target sequence, which was probably due to selective stacking interactions with only the matched
neighboring base pair. These results correspond to the results of their melting temperature analyses
that are summarized in Table 7. Regarding the N-terminus-modified PNA, a lysine-rich cationic
peptide-modified PNA was previously reported to increase the binding constant to a matched DNA
by up to 250–fold; however, it also increased the binding constant to mismatched DNA sequences
by up to 35–fold relative to that of non-modified PNA [24]. Therefore, tolane-PNA is a better option
for discriminating SNPs in a target gene.
Figure 9. Gel mobility shift assay to assess single nucleotide polymorphism recognition in an RNA
oligonucleotide (RNA1, RNA2) by PNA13 and PNA14. RNA1 contains the partial sequence from
neuraminidase inhibitor-sensitive influenza A/Yokohama/1/H1N1, while RNA2 contains the partial
sequence from the neuraminidase inhibitor-sensitive influenza A/Yokohama/77/H1N1. PNA; 300
nM, RNA; 100 nM, incubation; 10 mM phosphate buffer (pH 6.0); and, 1 mM EDTA at room
temperature for 10 min., gel shift assay; 15% acrylamide gel, 20 mA, 60 min.
Here, we proposed a new PNA chromatography system to detect a SNP related to the
neuraminidase-inhibitor susceptibility of the influenza viral gene. We recently reported a
PNA-based ELISA system [25] and a rapid diagnostic test kit while using nucleic acid
chromatography for discriminating influenza A viruses [26]. In both methods, PNAs target a
conserved sequence of a viral gene of influenza A viruses. These PNA recognizes the viral gene in a
sequence-specific manner. As the viral RNA forms ribonucleoprotein complexes with nucleoprotein
(NP) [27], their PNAs can form a complex with viral RNA/nucleoprotein, or ribonucleoprotein
(RNP) within the virus lysate (Figure 10, top A; PNA/RNP formation). This PNA/RNP complex can
be visualized by a gold nanoparticle-conjugated rabbit anti-nucleoprotein IgG antibody (gold-rabbit
anti-NP IgG) in the control line, and a red color develops as a result of surface plasmon resonance
(Figure 10, top B; PNA/RNP detection). In addition, we prepared a control line that can capture
gold-rabbit anti-NP IgG by anti-rabbit IgG antibody to confirm the flow of the sample through the
device (Figure 10, top C; Confirmation). We employed this system to discriminate a SNP that is
involved in neuraminidase inhibitor resistance and neuraminidase inhibitor-sensitive viral strains.

Molecules 2020, 25, 769
14 of 20
We decided to perform this nucleic acid chromatography detection at 55 °C to eliminate
mismatched binding but to retain matched binding since PNA14 can slightly bind to RNA1 that
contains a mismatched base at 40 °C (Figure 9). First, we added a neuraminidase inhibitor-resistant
virus (NIR virus) and neuraminidase inhibitor-sensitive virus (NIS virus) into an elution buffer (see
Materials and Methods section). Subsequently, PNA13 or PNA14 was added to the elution mixture
and then incubated at 55 °C for 5 min. The PNA-containing elution mixtures were dropped onto a
conjugation pad of the PNA chromatography at 55 °C and let react for 15 min. As a result, PNA13
could not discriminate the SNPs between these two viruses and detected both the NIR and the NIS
viruses on the chromatograph (Figure 10, bottom left). By contrast, PNA14 discriminated the SNPs
among these viruses and selectively detected the NIR virus, which possesses a complementary viral
RNA sequence, on the chromatograph (Figure 10, bottom right). These results correspond to the
results of the gel mobility shift assay that is shown in Figure 9. Further, our chromatography system
is advantageous when compared to microarray technology, since it does not require the additional
steps of target genome amplification, hybridization, washing, and fluorescence detection during the
diagnosis process. Our chromatography method is also advantageous when compared to the
immunochromatography approach that has been widely used in bedside applications. In particular,
the immunochromatography kit requires two antibodies for the detection of a target antigen in a
sandwich fashion and, thus, the sensitivity and specificity rely on the quality of these two
antibodies. By contrast, PNA chromatography requires a tolane-PNA that recognizes a conserved
gene sequence of the target pathogen and an antibody recognizes the nucleoproteins that are
associated with the target gene. The design and synthesis of a certain tolane-PNA for detecting a
viral or bacterial gene can be accomplished within one week. The development of an antibody
targeting an antigen (i.e., nucleoprotein) is easier than developing two antibodies. One of the
6
drawbacks of tolane-PNA chromatography is its low sensitivity (detection limit: 1.0 × 10 pfu/mL).
In addition, some binding was lost to the matched binding since a relatively high incubation
temperature is required to eliminate the mismatched binding. However, taking these advantages of
tolane-PNA together, we could succeed in developing a novel type of nucleic acid chromatography
that can effectively discriminate a SNP in influenza A virus.

Molecules 2020, 25, 769
15 of 20
Figure 10. Rapid diagnosis of influenza virus by PNA chromatography. Top) Schematic diagram of
the PNA chromatography kit. Top A) PNA/RNP formation, Top B) PNA/RNP detection, Top C)
Confirmation. Bottom left) PNA13 did not discriminate a SNP in the target viral RNA among the
two viruses and detected both NIR and NIS viruses on the PNA chromatograph. Bottom right)
PNA14 discriminated a SNP in the target viral RNA among these two viruses and selectively
detected NIR virus on the PNA chromatograph. PNA, 5 L (0.5 g); influenza viruses, 10 L (1.0 ×
106 pfu/mL); elution buffer, 105 L (containing 1% Tween, 0.5% BSA). PNA and virus lysate
incubation: 55 °C, 5 min. Chromatography incubation: 55°C, 15 min.
3. Materials and Methods
3.1. Chemicals for Synthesis of Tolane Derivatives and General Analysis
All of the reagents and dry solvents were used without any further purification. Silica gel 60N
(spherical, neutral, particle size 40–50um, Kanto Chemical Co. Inc., Tokyo, Japan) were used for
column chromatography, unless otherwise noted. Thin-layer chromatography was performed while
using Merck TLC silica gel 60 F254 (Merck KGaA, Darmstadt, Germany). Nuclear magnetic
resonance (NMR) spectrum was recorded on a JEOL JML-LA-400 H1 400MHz (JEOL Ltd., Tokyo,
Japan). The spectra were internally referenced to the tetramethylsilane signal at 0 ppm, CDCl3 (7.24
ppm), and DMF (2.5 ppm). Mass measurements were recorded on JEOL JMS-T100LC
(ESI-TOF-HRMS) (JEOL Ltd., Tokyo, Japan).
3.2. Synthesis of Tolane Derivatives
The details were written in the supplemental data. Briefly, we prepare the linker molecule with
a carboxylic acid one side and 4-bromo-phenyl group the other side. The carboxylic acid was
esterified with methanol and 4-bromo-phenyl group was reacted with ethynylbenzene while using
the Sonogashira coupling reaction. After the methoxy ester was hydrolysed to carboxylic acid in
lithium hydroxide solution. The free carboxylic acid group was used for amide coupling with the
N-terminal amino of PNA.
3.3. Chemicals for PNA Synthesis
Fmoc/Bhoc-protected PNA monomers were purchased from Panagene (Daejeon, Korea).
Fmoc-Lys(Boc)-OH, poly-ethylene linker, and TGR-resin were purchased from Merck Millipore
(Tokyo, Japan). The coupling activators and HATU were purchased from Watanabe Chemicals
(Hiroshima, Japan). DNA (salt free) was purchased from Sigma–Genosys (Ishikari, Japan). Other
chemicals were purchased from Wako Pure Chemical (Osaka, Japan), Sigma–Aldrich (Tokyo,
Japan), and Tokyo Chemical Industry (Tokyo, Japan). The reagents and solvents were used without
further purification, unless otherwise noted.
3.4. Preparation of Fmoc-Lys-(Boc)-OH Loaded Resin
The Novasyn TGR resin (200 mg, 0.24 mmol/g) was swollen in 5 mL DMF for 30 min. prior to
the synthesis. 200 μL of base solution (0.3 M 2,6-lutidine, 0.2 M diisopropyl ethylamine, and 0.33 M

Molecules 2020, 25, 769
16 of 20
thiourea solution) and 0.5 M HATU were added to a mixture of Fmoc/Boc-protected lysine
(Fmoc-Lys(Boc)-OH, 22.5 mg, 48 μmol), and Boc/Cbz-protected lysine (Boc-Lys(Cbz)-OH, 72.3 mg,
190 μmol) in 200 μl of DMF to activate the carboxyl groups of coupling monomers. For the coupling
reaction, the mixture was added to the resin and then incubated at ambient temperature for 60 min.
The resin was then removed from the reaction solution and washed with DMF (5 × 5 mL). For the
capping of non-reacted amine groups, the resin was treated with 1.5 mL of capping solution
(2,6-lutidine: Ac2O:pyridine = 6:5:89, v/v) for 5 min. and washed with DMF (10 × 5 mL). For the
deprotection of Fmoc-groups, the resin was treated with 1 mL of deblock solution (40% (v/v)
piperidine in DMF) for 5 min. and washed with DMF (10 × 5 mL).
3.5. PNA Synthesis
Automated linear solid phase synthesis of PNA was performed while using an Intavis ResPep
parallel synthesizer that was equipped with micro scale columns (Köln, Germany). The
lysine-loaded resin (200 mg, 16 μmol) was swollen in 5 mL DMF for 30 min., and 20 mg of the resin
was transferred to each column in the synthesizer. After the removal of DMF, the Fmoc-protecting
groups of the lysine-loaded resin were removed from the resin by a 10-min. incubation in 100 μl of
deblock solution; the resin was subsequently washed with 100 μl of DMF 10 times. The
concentration of each monomer (Fmoc-PNA monomers, Fmoc-AEEA-OH, Fmoc-AZO-OH, and
Fmoc-Lys(Boc)-OH) was adjusted to 0.3 M in DMF solution. The activator solution contained 0.5 M
HATU in DMF. The base solution contained 0.3 M 2,6-lutidine, 0.2 M diisopropyl ethylamine, and
0.33 M thiourea in 5% NMM in pyridine solution (v/v). The deblock solution contained 40%
pyperidine in DMF solution.
For the coupling reaction, 17.5 μL of monomer solution, 17.0 μL of activation solution, and 8.50
μL of base solution were combined in a vessel and incubated for 2 min. at ambient temperature. The
coupling solution was then transferred to 20 mg of the resin and then incubated for 100 min. at
ambient temperature. After eluting the coupling solution from the resin by filtration, the resin was
washed with 100 μL of DMF 10 times. This coupling procedure was repeated twice for each
monomer elongation reaction. The resin was then incubated with 100 μL of capping solution for 10
min. to protect the non-elongated amino groups with acetyl groups and subsequently washed with
100 μL of DMF 10 times. The N-terminus Fmoc-group was then removed by incubating the resin
with 100 μL of deblock solution for 10 min. and subsequently washing with 100 μL of DMF 10 times.
The coupling step of the next monomer and capping steps were repeated, as described above, until
the desired PNA molecule was synthesized. Before the cleavage of PNA molecules from the resin,
the resin was washed with 100 μL of DMF five times, followed by washing with 100 μL of
dichloromethane five times. After drying the resin, 1 mL of TFA/m-cresol (9:1, v/v) was added and
incubated for 12 h. The resin was then filtered and the flow-through containing the cleaved PNA
was transferred to a new tube. The PNA solution was added to 15 mL of ice-cold diethyl ether, and
the precipitate was collected by centrifugation at 4400 rpm for 4 min. The supernatant was
transferred to another tube and then discarded. The residue was dried under ambient atmosphere
and then dissolved in 100 μL of distilled water.
3.6. PNA Purification and Analysis
All of the PNAs were purified by reverse-phase HPLC using a JASCO PU-2086 pump system
(Tokyo, Japan) with a JASCO UV-2075 detector and a GL Science Inertsil (150 mm × 4.6 mm, 5 μm)
C-18 column for analytical runs or a GL Science Inertsil (20 mm × 250 mm, 3 μm) C-18 column for
semi-preparative runs. Eluting solvents (analytical: A (0.1% TFA in water) and B (0.1% TFA in
acetonitrile); semi preparative: A (0.1% TFA in water) and B (0.1% TFA in acetonitrile)) were used in
a linear gradient at a flow rate of 1 mL/min. for analytical and 5 mL/min. for semi-preparative HPLC.
The gradient for analytical runs was 0→50% B in 30 min., and the gradient for semi-preparative runs
was 0% B for 10 min., 0→5% B in 10 min., 5% B for 10 min., 5→10% B in 10 min., 10% B for 10 min., 10
→ 20% B in 120 min., and 20 →50% B in 10 min. Detection was performed while using a

Molecules 2020, 25, 769
17 of 20
UV-VIS-detector at 260 nm. PNA molecular weights were analysed using an Ultraflextreme MALDI
TOF Mass Spectrometer (Bruker Daltonics, Yokohama, Japan). The optical densities of PNA and
DNA were measured at 260 nm with a UV1700 spectrometer (Shimadzu, Kyoto, Japan) using quartz
cuvettes (4 × 10 mm). The extinction coefficient of PNA was calculated from the molar extinction
coefficient obtained from http://www.panagene.com/. The molar extinction coefficient of tolane
−1
−1
derivatives 1–8, 9, 10, 11, and 12 were 15,600, 15,000, 16,500, 9,600, and 11,000 (M cm ), respectively.
Measurements of absorption at 260 nm were carried out in a buffer solution (10 mM NaH2PO4, pH
7.0) at an ambient temperature.
3.7. UV-Melting Analysis of PNA/DNA and Tolane-PNA/DNA
PNAs were preheated at 95 °C for 5 min. to prevent aggregation, and then gradually cooled to
25°C before being added to the DNA solution. The melting profiles of PNA complexed with DNA
or RNA were analysed on a UV1700 spectrophotometer (Shimadzu) while using a microcell (eight
cells, 1 mm) at 260 nm. PNAs and DNA were suspended in 20 mM sodium phosphate buffer (pH
7.4) at 4 µM each. The PNAs and RNA were suspended in 10 mM sodium phosphate buffer and
1mM EDTA (pH 6.0) at 4 µM each. The temperature was ramped down from 95 °C to 10 °C at a rate
of −1 °C/min.
3.8. In silico Conformational Search of Tolane Derivatives in the PNA/DNA Duplex
A PNA/DNA duplex structure that was solved by NMR methodology has been registered in
the Protein Data Bank (PDB ID:1PDT). Tolane derivatives were introduced to the N-terminal amino
group of PNA via an amide linkage, and an in silico conformational search of tolane within the
PNA/DNA duplex was performed by Macromodel version 10.5 (Schrödinger, LLC, New York, NY,
2014). The torsion angle search approach, followed by minimization using an OPLS-2005 force field
in water was utilized to analyze the stacking conformers.
3.9. Analysis of Duplex Conformation of Tolane-PNA/DNA Duplexes by Fluorescence Spectroscopy.
Cy5-labelled DNA concentrations were quantified by absorbance at 260 nm while using a
molar extinction coefficient provided by manufacturer. Fluorescence Spectrophotometer F-7000
identified excitation wavelength and emission wavelengths at 323 nm and 384 nm. PNA9 were
preheated at 95 °C for 5 min. to prevent aggregation, then gradually cooled to 25 °C before being
added to DNA solutions. PNA9, DNA1, and DNA2 concentrations were quantified by absorbance
at 260 nm while using a molar extinction coefficient that was provided by the manufacturer.
Fluorescence spectrum of PNA9 alone, PNA9/DNA1, and PNA9/DNA2 were measured in 20 mM
sodium phosphate (pH 7.4) at 25 °C.
3.10. Gel Mobility Shift Analysis of PNA/RNA Complexes
PNAs were preheated at 95 °C for 5 min. to prevent aggregation, and then gradually cooled to
25 °C before being added to the RNA solution. The RNA concentrations were quantified by
absorbance at 260 nm while using a molar extinction coefficient provided by the manufacturer.
PNA/RNA hybridization assays were conducted while using 100 nM Cy5-labeled single strand
RNA with 300 nM PNA, or tolane-PNA in 10 mM sodium phosphate and 1 mM EDTA at pH 6.0 for
10 min. at 25 °C. The reaction mixture for each condition was mixed with 0.2 volumes of a solution
containing 30% glycerol, 0.025% bromophenol blue, and 0.025% xylencyanol (Sigma-Aldrich Japan,
Tokyo, Japan), and then subjected to electrophoresis at 20 mA for 60 min. on a 15% non-denaturing
polyacrylamide gel using 1x TBE as a running buffer (89 mM Tris base, 89 mM borate, 2 mM EDTA,
pH 8.1) at 4 °C in the dark. The gel images were created by the use of a CCD digital image stock
system, FAS-III (Toyobo, Osaka, Japan).
3.11. Preparation of Influenza A/Yokohama/1/2008/H1N1 and A/Yokohama/77/2008/H1N1

Molecules 2020, 25, 769
18 of 20
Influenza A/Yokohama/1/2008/H1N virus and A/Yokohama/77/2008/H1N virus were
propagated in chicken embryonated eggs and then purified by sucrose gradient ultracentrifugation.
For the PNA binding assay, the viral titers were assessed while using a plaque formation assay and
6
adjusted to 1.0 × 10 pfu/mL with a phosphate buffered saline (pH 7.4).
3.12. Discrimination of a SNP in the Neuraminidase Gene of Influenza A Virus by PNA and Tolane-PNA
Using Nucleic Acid Chromatography
6
The samples containing influenza virus (10 L of 1.0 × 10 pfu/mL) were added to 105 L of
phosphate buffer (pH 7.4) containing detergents at 55 °C and dropped to a conjugate pad of the kit.
We first formed the complex between tolane-PNA-biotin and influenza viral RNA/nucleoprotein in
the sample lysate, which was dropped onto the conjugation pad, and then flowed by
chromatography on the membrane towards the test and control lines. PNA-Lys-O-O-Lys(biotin) and
tolane-PNA-Lys-O-O-Lys(biotin) was preheated at 95 °C for 5 min. to prevent aggregation, and
then gradually cooled to 55 °C before being added to the influenza virus detergent. After incubation
of 0.5 g of PNA-Lys-O-O-Lys(biotin) and tolane-PNA-Lys-O-O-Lys(biotin) solution with 115 L of
the viral lysate at 55 °C for 5 min., the mixture was dropped onto a conjugate pad on a lateral flow
strip that contains a gold-rabbit anti-nucleoprotein at 55 °C in a CO2 gas incubator SCA series
(ASTEC, Fukuoka, Japan). PNAs can form a complex with the influenza viral RNA and the
nucleoprotein (RNP) within the virus lysate. This PNA/RNP complex can be visualized by
gold-nanoparticle that was conjugated rabbit anti-nucleoprotein IgG antibody (gold-rabbit anti-NP)
in the control line, and a red color develops as a result of surface plasmon resonance. In addition,
we prepared a control line that can capture the excess gold-rabbit anti-NP by anti-rabbit IgG to
confirm the flow of sample through the device. We employed this system to discriminate a SNP in
neuraminidase inhibitor-resistant and neuraminidase inhibitor-sensitive viral strains.
4. Conclusions
We designed and synthesized various types of tolane derivatives that possess different types
of linkers, such as alkyl linkers, ether linkers, and amide linkers. These were incorporated at the
N-terminus of the PNA to increase its sequence specificity against ssDNA. As a result, we found
that the best linker length among the different alkyl acids tested was pentanoic acid. The
substitution of pentanoic acid with ethoxypropanoic acid further increased the binding affinity of
the tolane-PNA due to its flexible structure. Extension of the pi-conjugated system by changing
from a phenyl to naphthyl group also increased the binding affinity to neighboring base pairs and
increased duplex stability in a sequence specific manner. We were able to discriminate a single base
mismatch in the terminal region of target DNA and RNA molecules without increasing the binding
to mismatched genes to activate the carboxyl groups of coupling monomers. A novel type of nucleic
acid chromatography that employed our tolane-modified PNA allowed for us to detect a SNP
related to drug-resistance found in an influenza virus without using PCR-based genome
amplification reaction. Therefore, tolane-modified PNA chromatography has the potential to
directly enable the simple diagnosis of drug-resistant viruses from viral samples at the bedside
without requiring PCR, gel electrophoresis, mass spectroscopy, or fluorescence detection.
Supplementary Materials: The following are available online, Figure S1: Conformational search of
tolane4-PNA/DNA duplex.
Author Contributions: Conceptualization, K.T., T.H., S.S., and M.O.; methodology, K.T., T.H., S.S., and M.O.;
software, K.T.; validation, K.T., S.H., and K.O.; formal analysis, K.T., T.H., and M.O.; investigation, K.T., T.H.,
S.S., and M.O.; resources, N.K., Y.E., and K.K.; data curation, K.T., T.H., S.S., M.O., S.H., and K.O.;
writing—original draft preparation, K.K.; writing—review and editing, Y.E.; visualization, K.T., and K.K.;
supervision, N.K.; project administration, N.K. and K.K.; funding acquisition, N.K. Y.E., and K.K. All authors
have read and agreed to the published version of the manuscript.

Molecules 2020, 25, 769
19 of 20
Funding: This work was supported by a Grant-in-Aid for Young Scientists (B) (22750155 to KK) from JSPS and
a Grant-in-Aid for Scientific Research (B) (25290073 to KK) from JSPS.
Acknowledgments: We thank Ms. Aya Takenaka and Ms. Hiroyo Matsumura for their kind assistance to this
work.
Conflicts of Interest: The authors declare no conflict of interest. The funders had no role in the design of the
study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision
to publish the results.
References
1.
Scitable. Definition, SNP Available online: https://www.nature.com/scitable/definition/snp-295/. (accessed
on 10 February 2020)
2.
Li, J.Z.; Paredes, R.; Ribaudo, H.J.; Svarovskaia, E.S.; Metzner, K.J.; Kozal, M.J.; Hullsiek, K.H.; Balduin, M.;
Jakobsen, M.R.; Geretti, A.M. et al. Low-frequency HIV-1 drug resistance mutations and risk of
NNRTI-based antiretroviral treatment failure: a systematic review and pooled analysis. JAMA 2011, 305,
1327–1335.
3.
Suzuki, Y.; Saito, R.; Sato, I.; Zaraket, H.; Nishikawa, M.; Tamura, T.; Dapat, C.; Caperig-Dapat, I.;
Baranovich, T.; Suzuki, T. et al. Identification of Oseltamivir Resistance among Pandemic and Seasonal
Influenza A (H1N1) Viruses by an His275Tyr Genotyping Assay Using the Cycling Probe Method. J Clin
Microbiol 2011, 49, 125–130.
4.
5.
6.
7.
8.
Nielsen, P.; Egholm, M.; Berg, R.; Buchardt, O. Sequence-selective recognition of DNA by strand
displacement with a thymine-substituted polyamide. Science 1991, 254, 1497–1500.
Hanvey, J.; Peffer, N.; Bisi, J.; Thomson, S.; Cadilla, R.; Josey, J.; Ricca, D.; Hassman, C.; Bonham, M.; Au,
K.; et al. Antisense and antigene properties of peptide nucleic acids. Science 1992, 258, 1481–1485.
Larsen, H.; Bentin, T.; E Nielsen, P. Antisense properties of peptide nucleic acid. Biochim. et Biophys. Acta
(BBA) - Gene Struct. Expr. 1999, 1489, 159–166.
Ray, A.; Nordén, B. Peptide nucleic acid (PNA): its medical and biotechnical applications and promise for
the future. FASEB J. 2000, 14, 1041–1060.
Egholm, M.; Buchardt, O.; Christensen, L.; Behrens, C.; Freier, S.M.; Driver, D.A.; Berg, R.H.; Kim, S.K.;
Nordén, B.; Nielsen, P.E. PNA hybridizes to complementary oligonucleotides obeying the Watson–Crick
hydrogen-bonding rules. Nature 1993, 365, 566–568.
9.
Demidov, V.V.; Potaman, V.N.; Frank-Kamenetskil, M.; Egholm, M.; Buchard, O.; Sönnichsen, S.H.;
Nlelsen, P.E. Stability of peptide nucleic acids in human serum and cellular extracts. Biochem. Pharmacol.
1994, 48, 1310–1313.
10. Hamilton, S.E.; Iyer, M.; Norton, J.C.; Corey, D.R. Specific and nonspecific inhibition of transcription by
DNA, PNA, and phosphorothioate promoter analog duplexes. Bioorganic Med. Chem. Lett. 1996, 6, 2897–
2900.
11. Ross, P.L.; Lee, K.; Belgrader, P. Discrimination of single-nucleotide polymorphisms in human DNA using
peptide nucleic acid probes detected by MALDI-TOF mass spectrometry. Anal. Chem. 1997, 69, 4197–4202.
12. Ren, B.; Zhou, J.-M.; Komiyama, M. Straightforward detection of SNPs in double-stranded DNA by using
exonuclease III/nuclease S1/PNA system. Nucleic Acids Res. 2004, 32, e42.
13. Boontha, B.; Nakkuntod, J.; Hirankarn, N.; Chaumpluk, P.; Vilaivan, T. Multiplex Mass Spectrometric
Genotyping of Single Nucleotide Polymorphisms Employing Pyrrolidinyl Peptide Nucleic Acid in
Combination with Ion-Exchange Capture. Anal. Chem. 2008, 80, 8178–8186.
14. Gaylord, B.S.; Massie, M.R.; Feinstein, S.C.; Bazan, G.C. SNP detection using peptide nucleic acid probes
and conjugated polymers: applications in neurodegenerative disease identification. Proc Natl Acad Sci U S
A. 2005, 102, 34–39.
15. Rockenbauer, E.; Petersen, K.; Vogel, U.; Bolund, L.; Kølvraa, S.; Nielsen, K.V.; Nexø, B.A. SNP genotyping
using microsphere-linked PNA and flow cytometric detection. Cytom. Part. A 2005, 64, 80–86.
16. Bethge, L.; Jarikote, D.V.; Seitz, O. New cyanine dyes as base surrogates in PNA: Forced intercalation
probes (FIT-probes) for homogeneous SNP detection. Bioorganic Med. Chem. 2008, 16, 114–125.
17. Socher, E.; Jarikote, D.V.; Knoll, A.; Röglin, L.; Burmeister, J.; Seitz, O. FIT probes: Peptide nucleic acid
probes with a fluorescent base surrogate enable real-time DNA quantification and single nucleotide
polymorphism discovery. Anal. Biochem. 2008, 375, 318–330.

Molecules 2020, 25, 769
20 of 20
18. Ditmangklo, B.; Taechalertpaisarn, J.; Siriwong, K.; Vilaivan, T. Clickable styryl dyes for fluorescence
labeling of pyrrolidinyl PNA probes for the detection of base mutations in DNA. Org. Biomol. Chem. 2019,
17, 9712–9725.
19. Kam, Y.; Rubinstein, A.; Nissan, A.; Halle, D.; Yavin, E. Detection of Endogenous K-ras mRNA in Living
Cells at a Single Base Resolution by a PNA Molecular Beacon. Mol. Pharm. 2012, 9, 685–693.
20. Kolevzon, N.; Hashoul, D.; Naik, S.; Rubinstein, A.; Yavin, E. Single point mutation detection in living
cancer cells by far-red emitting PNA–FIT probes. Chem. Commun. 2016, 52, 2405–2407.
21. Sawada, S.; Takao, T.; Kato, N.; Kaihatsu, K. Design of Tail-Clamp Peptide Nucleic Acid Tethered with
Azobenzene Linker for Sequence-Specific Detection of Homopurine DNA. Molecules 2017, 22, 1840.
22. Dogan, Z.; Paulini, R.; Stütz, J.A.R.; Narayanan, S.; Richert, C. 5‘-Tethered Stilbene Derivatives as Fidelity-
and Affinity-Enhancing Modulators of DNA Duplex Stability. J. Am. Chem. Soc. 2004, 126, 4762–4763.
23. Kawakami, C.; Obuchi, M.; Saikusa, M.; Noguchi, Y.; Ujike, M.; Odagiri, T.; Iwata, M.; Toyozawa, T.;
Tashiro, M. Isolation of oseltamivir-resistant influenza A/H1N1 virus of different origins in Yokohama
City, Japan, during the 2007-2008 influenza season. Jpn. J. Infect. Dis. 2009, 62, 83–86.
24. Kaihatsu, K.; Shah, R.H.; Zhao, X.; Corey, D.R. Extending Recognition by Peptide Nucleic Acids (PNAs):
Binding to Duplex DNA and Inhibition of Transcription by Tail-Clamp PNA−Peptide Conjugates†.
Biochemistry 2003, 42, 13996–14003.
25. Kaihatsu, K.; Sawada, S.; Nakamura, S.; Nakaya, T.; Yasunaga, T.; Kato, N. Sequence-Specific and Visual
Identification of the Influenza Virus NS Gene by Azobenzene-Tethered Bis-Peptide Nucleic Acid. PLoS
ONE 2013, 8, e64017.
26. Kaihatsu, K.; Sawada, S.; Kato, N. Rapid Identification of Swine-Origin Influenza A Virus by Peptide
Nucleic Acid Chromatography. J. Antivirals Antiretrovir. 2013, 5, 77–79.
27. Kemler, I.; Whittaker, G.; Helenius, A. Nuclear Import of Microinjected Influenza Virus
Ribonucleoproteins. Virology 1994, 202, 1028–1033.
Sample Availability: Samples of the compounds are not available from the authors.
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access
article distributed under the terms and conditions of the Creative Commons Attribution
(CC BY) license (http://creativecommons.org/licenses/by/4.0/).