Triplex formation by an oligonucleotide containing conformationally locked C-nucleoside, 5-(2-O,4-C-methylene-β-D-ribofuranosyl)oxazole

Article abstract of DOI:10.1016/S0040-4039(99)02052-3

The triplex-forming ability of oligonucleotide analogues containing conformationally locked C-nucleosides, 5(2-O,4-C-methylene-β-D- ribofuranosyl)oxazole or its 2-phenyl congener, towards a purine sequence of duplex DNA with a single C.G base pair interru

Full text of DOI:10.1016/S0040-4039(99)02052-3

TETRAHEDRON
LETTERS
Pergamon
Tetrahedron Letters 41 (2000) 221–224
Triplex formation by an oligonucleotide containing
conformationally locked C-nucleoside, 5-(2-O,4-C-methylene-β-
D-ribofuranosyl)oxazole
Satoshi Obika, Yoshiyuki Hari, Ken-ichiro Morio and Takeshi Imanishi ∗
Graduate School of Pharmaceutical Sciences, Osaka University, 1–6 Yamadaoka, Suita, Osaka 565-0871, Japan
Received 8 September 1999; revised 25 October 1999; accepted 29 October 1999
Abstract
The triplex-forming ability of oligonucleotide analogues containing conformationally locked C-nucleosides, 5-
(2-O,4-C-methylene-β-D-ribofuranosyl)oxazole or its 2-phenyl congener, towards a purine sequence of duplex
DNA with a single C·G base pair interruption is studied. © 1999 Elsevier Science Ltd. All rights reserved.
Keywords: nucleic acid analogues; molecular recognition; bicyclic heterocyclic compounds; oxazoles.
Pyrimidine oligonucleotides can bind to homopurine tracts of duplex DNA in a sequence-specific
manner to form triple-helical structures through the formation of Hoogsteen hydrogen bonds.1 These
triplex-forming oligonucleotides (TFOs) have received a considerable amount of attention as novel
agents to control specific gene expression (the so-called antigene strategy).2 However, the duplex DNA
recognized by TFOs is limited to homopurine sequences, and pyrimidine nucleotide interruptions in
the homopurine sequences reduce the triplex stability.3 Although it is known that guanine can interact
with a T·A base pair to form a G·T·A triad and that thymine can also form a T·C·G triad through a
single hydrogen bond,4 the stabilizing effect by these natural base triads is insufficient. To overcome
this problem, some oligonucleotide modifications in the nucleobase moiety have been reported to date.2,5
However, a practical method for the recognition of general duplex DNA sequences containing all four
base pairs is still lacking.
In order to design and synthesize a nucleobase analogue to accomplish efficient recognition of a
pyrimidine·purine base pair, it must be taken into consideration that the hydrogen bond donors and
acceptors should be favorably located to form proper hydrogen bonds and that the phosphate backbone
should coincide in geometry with that of a pyrimidine·purine·pyrimidine triad. From our modeling study,
it occurred to us that the five-membered heterocycles, such as oxazole and imidazole, would be the most
potent candidate for recognition of a C·G base pair through triplex formation.
∗
Corresponding author. Fax: +81 6-6879-8204; e-mail: imanishi@phs.osaka-u.ac.jp (T. Imanishi)
0040-4039/00/$ - see front matter © 1999 Elsevier Science Ltd. All rights reserved.
PII: S0040-4039(99)02052-3
tetl 15980

222
Conformationally locked oligonucleotides containing 20-O,40-C-methyleneribonucleosides are of
great interest because of their potent hybridizing ability towards complementary ssDNA or RNA, due
to their entropically favorable character.6 Here we describe the recognition of a C·G base pair in a
homopurine DNA sequence by an oligonucleotide containing conformationally locked C-nucleoside,
5-(2-O,4-C-methylene-β-D-ribofuranosyl)oxazole.
As shown in Scheme 1, conformationally locked C-nucleoside, 5-(3,5-O-dibenzyl-2-O,4-C-
methylene-β-D-ribofuranosyl)oxazole 4a, was synthesized according to the previously reported
procedure.7 The aldehyde 1 was treated with 2-methylthio-5-oxazolylmagnesium bromide to afford the
desired S-epimer of 2 as a main product (61%, S:R=85:15). The methylthio group in S-2 was removed
(S-2→3, 69%) and the subsequent ring-closure reaction gave the β-anomer of 4a exclusively (92%).
Hydrogenolysis of 4a and its 2-phenyl congener 4b7 afforded the diols 5a and 5b (82 and 46%),
respectively. The phosphoramidites 7a and 7b, the suitable building blocks for DNA synthesis, were
obtained via dimethoxytritylation (5→6, 94–99%) and phosphitylation (6→7, 90–92%). Modified TFOs
I (X=8 and 9) containing conformationally locked C-nucleosides were effectively prepared by standard
phosphoramidite protocol on a DNA synthesizer.†
Scheme 1. Reagents and conditions: (i) 2-methylthio-5-oxazolylmagnesium bromide (4 equiv.), THF, rt; (ii) Raney-Ni, EtOH,
reflux; (iii) 1,10-azobis(N,N-dimethylformamide), tributylphosphine, benzene, rt; (iv) H2, Pd(OH)2-C, EtOH, rt; (v) DMTrCl,
pyridine, rt; (vi) 2-cyanoethyl N,N,N0,N0-tetraisopropylphosphorodiamidite, diisopropylammonium tetrazolide, MeCN–THF, rt
Measurements of melting temperature (Tm) were carried out in 7 mM sodium phosphate buffer (pH
6.0) containing 140 mM potassium chloride and 0.5 mM magnesium chloride.‡ The melting profile for
I·II·III (8·C·G) triplex in which TFO I contains 5-(2-O,4-C-methylene-β-D-ribofuranosyl)oxazole is
†
The modified oligonucleotides were synthesized on the DNA synthesizer (Gene Assembler® Plus, Pharmacia, 0.2 µmol
scale, 50-dimethoxytrityl on). After treatment with conc. ammonia, removal of the 50-dimethoxytrytyl group and purification
were performed on NENSORB™ PREP reversed-phase columns. The purity of the modified oligonucleotides was verified using
reversed-phase HPLC and the compositions were determined by MALDI-MS.
‡
According to the literature,8 the buffer for Tm measurements which approximates the intracellular cationic environment and
the sequences of the target duplex are selected.

223
shown in Fig. 1, and all Tm data of TFO dissociation are summarized in Table 1. Triplex formation
between I (X=8) and II·III (Y·Z) is sequence-selective, and the binding strength of the 8·C·G triad
is preferable to that of T·C·G and other triads.§ On the other hand, TFO containing 2-phenyloxazole
congener 9 exhibits weaker binding affinity for all four base pairs.¶ Such differences in Tm values
between TFOs I (X=8) and I (X=9) suggest that the hydrogen bonding interaction between the 3-nitrogen
of the oxazole moiety in 8 and the 4-amino group hydrogen in cytidine is essential for stabilizing the
triplex, and that the interaction is obstructed by the steric hindrance of 2-phenyl group in 9 as illustrated
in Fig. 2.
Fig. 1. Melting profile of I·II·III (8·C·G) triplex
Table 1
Tm values (°C) of I·II·III (X·Y·Z) triplexes
§
In addition to the results in Table 1, we also elucidated the triplex-forming ability of another TFO 50-
d(TTTTTmCTXTmCTmCTmCT)-30 (IV), in which cytosine bases are replaced by 5-methylcytosine (mC), towards the target
duplex 50-d(GCTAAAAAGACAGAGAGTCG)-30 (II)/30-CGATTTTTCTGTCTCTCTAGC)-50 (III). The Tm measurements
were carried out under neutral conditions [7 mM sodium phosphate buffer (pH 7.0), 140 mM potassium chloride and 10 mM
magnesium chloride] and the Tm value of IV (X=8)·II·III was found to be 29°C, while that of IV (X=A, G, mC or T)·II·III
was 21, 20, 25 or 25°C, respectively.
¶
This result is in fair agreement with that of the oligonucleotide containing 1-(2-deoxy-β-D-ribofuranosyl)-4-
phenylimidazole, reported by Dervan et al.9

224
Fig. 2. Proposed hydrogen bonding scheme for 8·C·G and 9·C·G triads
These results indicate that the conformationally locked C-nucleoside, 5-(2-O,4-C-methylene-β-D-
ribofuranosyl)oxazole can recognize a C·G base pair in a homopurine DNA sequence through triplex
formation. Although the structure of 8 is simple and only one hydrogen bonding is proposed between 8
and a C·G base pair, the binding ability of 8 towards a C·G base pair seems to be comparable to that of
N4-(6-amino-2-pyridinyl)deoxycytidine, which is one of the most suitable compounds for C·G base pair
recognition, reported by Miller et al.10 This favorable feature of 8 may be due to its conformationally
locked structure. Thus, this type of C-nucleoside analogue would be a usable synthon for novel and
effective antigene oligonucleotides.
Acknowledgements
Part of this work was supported by a grant-in-aid for Scientific Research (B), no. 09557201, from
Japan Society for the Promotion of Science. We are also grateful to the Takeda Science Foundation for
financial support.
References
1. Moser, H. E.; Dervan, P. B. Science 1987, 238, 645–650; Le Doan, T.; Perrouault, L.; Praseuth, D.; Habhoub, N.; Decout,
J. L.; Thuong, N. T.; Lhomme, J.; Hélène, C. Nucleic Acids Res. 1987, 15, 7749–7760; Lyamichev, V. I.; Mirkin, S. M.;
Frank-Kamenetskii, M. D.; Cantor, C. R. Nucleic Acids Res. 1988, 16, 2165–2178.
2. Thuong, N. T.; Hélène, C. Angew. Chem., Int. Ed. Engl. 1993, 32, 666–690.
3. Horne, D. A.; Dervan, P. B. Nucleic Acids Res. 1991, 19, 4963–4965.
4. Griffin, L. C.; Dervan, P. B. Science 1989, 245, 967–971; Mergny, J.-L.; Sun, J.-S.; Rougée, M.; Montenay-Garestier, T.;
Barcelo, F.; Chomilier, J.; Hélène, C. Biochemistry 1991, 30, 9791–9798; Yoon, K.; Hobbs, C. A.; Koch, J.; Sardaro, M.;
Kutny, R.; Weis, A. L. Proc. Natl. Acad. Sci. USA 1992, 89, 3840–3844; Miller, P. S.; Cushman, C. D. Biochemistry 1993,
32, 2999–3004.
5. Luyten, I.; Herdewijn, P. Eur. J. Med. Chem. 1998, 33, 515–576.
6. Obika, S.; Nanbu, D.; Hari, Y.; Morio, K.; In, Y.; Ishida, T.; Imanishi, T. Tetrahedron Lett. 1997, 38, 8735–8738; Obika, S.;
Nanbu, D.; Hari, Y.; Andoh, J.; Morio, K.; Doi, T.; Imanishi, T. Tetrahedron Lett. 1998, 39, 5401–5404; Singh, S. K.; Nielsen,
P.; Koshkin, A. A.; Wengel, J. Chem. Commun. 1998, 455–456; Koshkin, A. A.; Singh, S. K.; Nielsen, P.; Rajwanshi, V.
K.; Kumar, R.; Meldgaard, M.; Olsen, C. E.; Wengel, J. Tetrahedron 1998, 54, 3607–3630; Koshkin, A. A.; Nielsen, P.;
Meldgaard, M.; Rajwanshi, V. K.; Singh, S. K.; Wengel, J. J. Am. Chem. Soc. 1998, 120, 13252–13253.
7. Obika, S.; Hari, Y.; Morio, K.; Imanishi, T. Tetrahedron Lett. 2000, 41, 215–219.
8. Steffens, R.; Leumann, C. J. J. Am. Chem. Soc. 1999, 121, 3249–3255.
9. Griffin, L. C.; Kiessling, L. L.; Beal, P. A.; Gillespie, P.; Dervan, P. B. J. Am. Chem. Soc. 1992, 114, 7976–7982.
10. Huang, C.-Y.; Bi, G.; Miller, P. S. Nucleic Acids Res. 1996, 24, 2606–2613.