Efficient synthesis of 2-alkylidene-3-iminoindoles, indolo[1,2-b]isoquinolin-5-ones, δ-carbolines, and indirubines by domino and sequential reactions of functionalized nitriles

Article abstract of DOI:10.1002/chem.200204566

The sodium hydride mediated cyclization of arylacetonitriles with oxalic acid bis(imidoyl) dichlorides, azaanalogues of oxalyl chloride, afforded functionalized 2-alkylidene-3-iminoindoles with very good regio- and E/Z selectivity. Excellent chemoselectiv

Full text of DOI:10.1002/chem.200204566

FULL PAPER
Efficient Synthesis of 2-Alkylidene-3-iminoindoles, Indolo[1,2-b]isoquinolin-
5-ones, d-Carbolines, and Indirubines by Domino and Sequential Reactions of
Functionalized Nitriles
Peter Langer,* Joachim T. Anders, Klaus Weisz, and Judith J‰hnchen[a]
Abstract: The sodium hydride mediat-
ed cyclization of arylacetonitriles with
oxalic acid bis(imidoyl) dichlorides, aza-
analogues of oxalyl chloride, afforded
functionalized 2-alkylidene-3-iminoin-
doles with very good regio- and E/Z
selectivity.Excellent chemoselectivities
were observed for functionalized sub-
strates.Based on these results a domino
™cyclization lactamization∫ reaction of
bis(imidoyl) chlorides with methyl 2-(cy-
anomethyl)benzoate was developed.
This process allowed a convenient one-
pot synthesis of indolo[1,2-b]isoquino-
lin-5-ones related to tryptanthrin.A new
and convenient synthesis of d-carbolines
by intramolecular electrocyclization
elimination reactions of 2-alkylidene-3-
iminoindoles was developed.It was
shown that d-carbolines selectively bind
to triplex or duplex DNA (intercala-
tion).Indirubine analogues were pre-
pared by deprotection and lactonization
of functionalized 2-alkylidene-3-imi-
noindoles.
Keywords: cyclization
¥
DNA
¥
domino reactions ¥ imidoyl chlorides
¥ nitriles
oped:[8] The domino ™cyclization lactamization∫ reaction of
methyl 2-(cyanomethyl)benzoate with bis(imidoyl) dichlor-
ides allowed a convenient one-pot synthesis of cyano-sub-
stituted indolo[1,2-b]isoquinolin-5-ones.Although the parent
heterocyclic core structure was first reported in 1940,
functionalized derivatives are rare.[9a] Recent syntheses of
unfunctionalized indolo[1,2-b]isoquinolin-5-ones include in-
tramolecular Heck reactions of 2-alkylidene-3-oxindoles.[9e]
Indolo[1,2-b]isoquinolin-5-ones are of considerable pharma-
cological relevance because they represent C-analogues of
tryptanthrin.[10] Related structures occur, for example, in
Goniometine-type alkaloids.[11]
Introduction
2-Alkylidene-3-oxindoles represent important building blocks
for the synthesis of alkaloids[1, 2] and non-natural target
molecules.[3] We have recently reported[4] a versatile synthesis
of 2-alkylidene-3-iminoindoles–masked 2-alkylidene-3-oxin-
doles–by cyclization of dilithiated nitriles and sulfones with
oxalic acid bis(imidoyl) dichlorides.[5] Bis(imidoyl) dichlorides
can be prepared in two steps from inexpensive anilines and
can be regarded as aza-analogues of oxalyl chloride.[6]
However, a problem associated with our methodology lies
in the fact that generation of the dilithio compounds requires
the use of a strong base (lithium diisopropylamide (LDA) or
nBuLi).[7] Therefore, the synthesis of ester-, nitrile-, or halide-
substituted indoles was not possible, due to nucleophilic
attack of the dianion onto the nitrile and ester groups and
metal halide exchange, respectively.
Herein, we report a new protocol that allows the synthesis
of functionalized indoles with excellent chemoselectivity.
Based on these results, a new domino process was devel-
[a] Prof.Dr.P.Langer, Dipl-.Chem.J.T.Anders, Prof.Dr.K.Weisz,
Dr.J.J‰hnchen
Ernst-Moritz-Arndt-Universit‰t Greifswald
Institut f¸r Chemie und Biochemie Soldmannstrasse 16, 17487 Greifs-
wald (Germany)
Fax : (‡49)3834-864373
E-mail: peter.langer@uni-greifswald.de
Chem. Eur. J. 2003, 9, 3951 3964
DOI: 10.1002/chem.200204566
¹ 2003 Wiley-VCH Verlag GmbH & Co.KGaA, Weinheim
3951

P.Langer et al.
FULL PAPER
In addition, we report a new approach to d-carbolines by
sequential ™cyclization electrocyclization∫ reactions of ni-
triles with bis(imidoyl) dichlorides.These results show that
2-alkylidene-3-iminoindoles are useful synthetic building
blocks.Carbolines have been prepared so far mainly by
cycloaddition reactions and occur in a number of natural
products.[12 14] Benzoannulated d-carbolines, which are readily
available by our methodology, are related to the antitumor
agent ellipticin[15] and occur in a variety of antibiotically active
natural products, such as cryptolepine, cryptoquindoline,
biscryptolepine, and neocryptolepine.[16] Benzoannulated d-
carbolines are pharmacologically relevant systems, due to
their potential cancerostatic activity.Herein, we report first
results related to experiments that indicate that our d-
carbolines selectively bind to triplex or duplex DNA (inter-
calation).In these experiments a 35mer oligonucleotide,
capable of forming both triple- and double-helical structures
by folding, was used.
functionalized substrates.Variation of the reaction conditions
was studied for the cyclization of phenylacetonitrile (1a) with
oxalic acid bis(2-tolylimidoyl) dichloride (2a) (Scheme 1,
The synthetic utility of 2-alkylidene-3-iminoindoles was
further demonstrated by the development of a new approach
to indirubine analogues by sequential ™cyclization lactoni-
zation∫ reactions.The synthesis of indirubine analogues is of
great current interest, due to the recently recognized anti-
tumor activity of indirubine and indigo derivatives.[17]
Scheme 1.Synthesis of indole 3a.
Table 1).Employment of LDA resulted in the formation of
indole 3a in 53% yield with complete E diastereoselectivity.[4]
The formation of 3a can be explained by initial attack of the
Table 1.Variation of the reaction conditions
Results and Discussion
Entry
Conditions
Yield [%][a]
base (equiv) solvent temperature
time [h]
Synthesis of functionalized 2-alkylidene-3-iminoindoles
1
2
3
4
5
6
7
8
LDA (2.3)
K2CO3(3.0)
KOtBu (3.0) THF
K2CO3 (3.0)
NaH (3.0)
NaH (3.0)
NaH (3.0)
NaH (3.0)
THF
THF
À 100 ! 208C
reflux
reflux
reflux
reflux
reflux
208C
reflux
12
120
120
24
24
72
53
54
20
14
40
83
8
Optimization: Our standard protocol[4a] for the synthesis of
2-alkylidene-3-iminoindoles relies on the use of dilithiated
nitriles which are generated from two equivalents of strong
base.These dianions reside in many cases as monoanions
which are associated to one molecule of base (e.g. LDA).[7]
Therefore, it was hoped that modification of the reaction
conditions (employment of a weak base, stepwise deprotona-
tion) would improve the applicability of our methodology to
DMF
THF
THF
THF
THF
72
120
72
[a] Yield of 3a isolated.
nitrile onto 2a to give an ambident anionic intermediate.
Stereoelectronically favored 5-exo-trig cyclization subse-
quently occurred from the ortho-carbon atom of the arylimino
group and rearomatization led to the final product
(Scheme 1).After much experimentation, we found that
optimal yields of 3a (up to 83%) were obtained when a
solution of the starting materials in THF was refluxed in the
presence of sodium hydride (NaH) for 72 h.The use of other
solvents or bases proved less satisfactory (Table 1).No loss of
diastereoselectivity was observed.This was not unexpected,
since the E-configured isomer represents the thermodynami-
cally favored product.
Abstract in German: Die Natriumhydrid-vermittelte Cyclisie-
rung von Arylacetonitrilen mit Oxals‰ure-bis(imidoyl)dichlo-
riden, Azaanaloga des Oxalylchlorids, liefert funktionalisierte
2-Alkyliden-3-iminoindole mit sehr guter Regio- und E/Z-
Selektivit‰t. Exzellente Chemoselektivit‰ten wurden f¸r funk-
tionalisierte Substrate beobachtet. Basierend auf diesen Resul-
taten wurde eine Domino ™Cyclisierungs-Lactamisierungs∫-
Reaktion von Bis(imidoyl)dichloriden mit Methyl 2-(Cyano-
methyl)benzoat entwickelt. Diese Reaktion ermˆglicht eine
bequeme Ein-Topf-Synthese von Indolo[1,2-b]isoquinolin-5-
onen, die strukturell dem Tryptanthrin verwandt sind. Weiter-
hin wird ein neuartiger und effizienter Zugang zu d-Carboli-
nen durch intramolekulare ™Elektrocyclisierungs-Eliminie-
rungs∫-Reaktionen von 2-Alkyliden-3-iminoindolen vorge-
stellt. Die d-Carboline binden selektiv and Triplex oder
Duplex DNA durch Intercalation. Schlie˚lich wurde ein neuer
Zugang zu Indirubin-Analoga durch Entsch¸tzung und Lac-
tonisierung geeigneter funktionalisierter 2-Alkyliden-3-imi-
noindole entwickelt.
Preparative scope: The application of our new protocol to
functionalized substrates was studied next (Scheme 2, Ta-
ble 2).The LDA-mediated reaction of (4-bromophenyl)ace-
tonitrile (1b) with 2a afforded the bromo-substituted indole
3b, however, in only 19% yield (due to extensive metal
halide exchange).In contrast, the use of NaH/THF resulted
in a dramatic increase in yield (91%).The NaH-mediated
3952
¹ 2003 Wiley-VCH Verlag GmbH & Co.KGaA, Weinheim
www.chemeurj.org
Chem. Eur. J. 2003, 9, 3951 3964

Functionalized 2-Alkylidene-3-iminoindoles
3951 3964
prepared by use of strong base (except for 3n and 3r).The
synthesis of all indoles 3a r proceeded with excellent E
diastereoselectivity (E/Z > 98:2).
Synthesis of indolo[1,2-b]isoquinolin-5-ones by domino
™cyclization lactamization∫ reactions
Optimization: Based on the results outlined above, a novel
domino process was developed.The NaH-mediated reaction
of methyl 2-(cyanomethyl)benzoate (4) with bis(imidoyl)
chloride 2a afforded 5,11-dihydro-indolo[1,2-b]isoquinolin-5-
one (5a) in only one step by a domino ™cyclization lactam-
ization∫ reaction via intermediate C (Scheme 3).The cleavage
Scheme 2.Synthesis of 2-alkylidene-3-iminoindoles 3.
Table 2.Synthesis of 2-alkylidene-3-iminoindoles 3a r.
R1 R2 R3 R4 R5
R6
R7
[%][a] lmax
[b]
1
2
3
Base
b
b
b
b
c
c
d
d
d
e
e
a
a
f
f
f
f
g
h
i
j
k
a
a
b
c
b
b
c
d
e
e
f
LDA Me
H
H
H
Me
H
H
H
H
H
H
H
Br
Br
H
H
Me
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
Br
Br
Br
Br
H
H
H
H
H
CO2Me
CO2Me
H
H
H
H
H
H
H
H
H
H
H
Br
Br
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
CN
CN
CN
H
19
NaH
NaH
NaH
Me
H
H
91
95
61
49
84
0
61
40
0
461
461
459
461
a
a
b
b
a
a
a
d
d
b
a
c
e
f
a
b
f
K2CO3 Me
NaH
LDA
NaH
Me
H
H
f
480
461
467
g
h
h
i
i
j
K2CO3 Me
LDA Me
NaH
nBuLi
NaH
LDA
Me
H
H
H
H
H
48
8
44
461
H
OMe 55
OMe 51
OMe 71
OMe 62
H
H
Me
H
H
465
462
462
475
481
470
459
481
481
k
l
LDA Me
LDA
LDA Me
NaH
nBuLi Me
H
m
n
o
p
q
r
Me
Me
H
H
Me
H
H
OMe
H
H
Me
H
60
30
74
62
96
OMe
H
H
LDA
nBuLi
NaH
H
H
H
H
H
Me
g
Me Me
Scheme 3.Domino ™cyclization lactamization∫ reactions of 2b with 4.
Conditions: 1) DMSO, reflux, 16 h, 84%; or 2) THF/HCl (10%) ˆ 1:1,
208C, 72 h, 95%.
[a] Yield of isolated product.[b] UV/Vis [nm] (CHCl ).
3
syntheses of the bromo-substituted indoles 3c and 3d were
equally successful.The reaction of (3-bromophenyl)acetoni-
trile (1c) with 2a in the presence of K2CO3 afforded indole 3e
in 49% yield.The use of NaH again resulted in a dramatic
increase in yield (84%).
of the imino group was studied next.After some experimen-
tation we found that treatment of 5a with a 1:1 mixture of
THF and an aqueous solution of HCl (10%) afforded the
desired parent ketone 6a in 95% yield.Interestingly, simple
reflux of a solution of 5a in DMSO also resulted in the
formation of 6a in high yield.This reaction was monitored by
1H NMR spectroscopy ([D6]DMSO).The NMR spectrum of
the crude mixture exclusively showed the signals of 6a.No
formation of aniline or azobenzene was detected.However, a
very broad signal in the aromatic region was observed which
suggested that polyaniline was formed.Since no water was
added to the reaction mixture at any time, the oxygen atom of
6a could have derived from DMSO.In fact, the formation of
dimethyl sulfide was detected by its characteristic smell.
However, the DMSO-mediated cleavage of imines has, to the
best of our knowledge, not been previously reported.[19]
Alternatively, the formation of 6a can be explained by
hydrolysis of 5a by small amounts of water present in DMSO.
Deprotonation of (2-cyanophenyl)acetonitrile (1d) with
LDA has been reported to result in dimerization by inter-
molecular attack of the carbanion onto the nitrile.[18] It was
therefore not unexpected that treatment of 1d with LDA and
subsequent addition of 2b resulted in the formation of a
complex mixture.In contrast, the cyano-substituted indoles 3 f
and 3g were formed in good yields when NaH and K2CO3
were employed, respectively.The LDA-mediated reaction of
methyl 4-(cyanomethyl)benzoate (1e) with oxalic acid bis-
(imidoyl) dichloride 2a was unsuccessful.In contrast, the
desired indole 3h could be prepared in good yield by using
NaH.The NaH-mediated cyclization of 1a with oxalic acid
bis(m-bromophenylimidoyl) dichloride (2d) afforded 3i con-
taining a bromo-substituted indole moiety (44%).In contrast,
the product was formed in only 8% yield when n-butyllithium
was employed.Although reactions of meta-substituted bis-
(imidoyl) chlorides can, in principle, result in formation of
regioisomers, indole 3i was formed with very good regiose-
lectivity.The novel 2-alkylidene-3-iminoindoles 3j r were
Preparative scope: The domino cyclizations of 4 with other
bis(imidoyl) chlorides were equally successful and afforded
indolo[1,2-b]isoquinolin-5-ones 5b g in 55 96% yields (Ta-
ble 3).The cyclization of 4 with 2c resulted in formation of a
Chem. Eur. J. 2003, 9, 3951 3964
www.chemeurj.org
¹ 2003 Wiley-VCH Verlag GmbH & Co.KGaA, Weinheim
3953

P.Langer et al.
FULL PAPER
dichlorides 2b and 2a) were 57% and 23%, respectively.The
overall yields of those products prepared via 5a and 5b were
70% and 24%, respectively.Therefore, the latter approach
was more efficient in terms of yield.
All indoles prepared have been compared with regard to
their UV/Vis absorption properties.Simple unsubstituted
indoles such as 3a showed lmax values around 460 nm.The
presence of one (3b e) or more (3i) halide atoms did not
have any significant effect on the lmax absorptions.In contrast,
the presence of an ester group (3h) led to a slightly increased
lmax value (467 nm).Hypsochromic shifts were observed for
indolo[1,2-b]isoquinolin-5-ones 5a
g
(lmax ˆ 420 457 nm)
with respect to the corresponding 2-alkylidene-3-iminoin-
doles 3.This observation can be explained by replacement of
the free NH group by an electron-withdrawing lactam moiety
which results in a less pronounced push pull character of the
indigo-type chromophore.The absence of the arylimino group
in heterocycles 6 resulted only in a slight hypsochromic effect.
For reasons of comparison, measurements have been carried
out in DMF and CHCl3: a bathochromic shift of the lmax
absorptions was generally observed for measurements in
DMF with respect to CHCl3 (‡6 to ‡20 nm).
Table 3.Synthesis of the indolo[1,2- b]isoquinolin-5-ones 5 and 6.
[c]
[c]
2
5, 6 R1 R2 R3
R4 Yield 5 [%][a] lmax
Yield 6 [%][a] lmax
a
b
c
c
f
a
b
c
d
e
f
H
Me
H
H
H
H
H
Me
H
H
H
H
H
H
Me
H
MeO
H
H
H
83
423
426
420
420
431
457
84 (95)
48 (82)
419
423
50
55[b]
Me 55[b]
H
85
Me 96
87
94 (100)
48 (84)
67 (90)
426
449
g
h
H
H
Me
H
g
H
[a] Yield of isolated product.For compounds 6: yields obtained by reflux of
a solution of 5 in DMSO; in parentheses: yields obtained by treatment of 5
with HCl (10%).[b] Mixture of regioisomers ( 5c/5d ˆ 2.4:1, 5c ‡ 5d ˆ
Synthesis of d-carbolines by sequential ™cyclization electro-
cyclization∫ reactions
55%).[c] UV/Vis [nm] (CHCl ).
3
Optimization: 2-Alkylidene-3-iminoindoles 3 represent not
only masked 2-alkylidene-3-oxindoles, but also potential
starting materials for the synthesis of d-carbolines.We found
that d-carbolines can be prepared from 3 by 6p electro-
cyclization (involving the exocyclic double bond and the
arylimino group of the indole) and subsequent elimination of
HCN.This type of reaction has to our knowledge not yet been
reported.[20] However, our initial experiments to realize this
transformation were unsuccessful: Treatment of indole 3s[4a]
with TFA or TfOH (neat) or with concentrated aqueous
solutions of HCl or NaOH resulted in decomposition.Only
starting material was recovered by use of more dilute
solutions (CH2Cl2 or H2O).Flash vacuum pyrolysis (FVP)
of 3s afforded the desired d-carboline 7a, however, in only
12% yield.Only starting material was recovered when a
solution of 3s in THF was refluxed for 48 h.We eventually
found that optimal yields of 7a were obtained when a solution
of 3s in DMSO was refluxed for 48 h (Scheme 5, Table 4).The
use of other solvents was less effective.Prolongation of the
reaction time did not result in an increase of the yield.
mixture of regioisomers.The cleavage of the imino group of
5b and 5e g afforded the parent indolo[1,2-b]isoquinolin-5-
ones 6b and 6e g in good yields.Better yields were generally
obtained by using HCl/THF/208C rather than by refluxing a
solution of the starting materials in DMSO.
We also developed an alternative approach to parent
indolo[1,2-b]isoquinolin-5-ones 6. Reflux of a solution of
2-alkylidene-3-iminoindoles 3 f and 3g in DMSO directly
afforded 6a and 6b, respectively (Scheme 4).The formation
Preparative scope: To study the preparative scope of the
novel electrocyclization elimination reaction, the substitu-
ents of 2-alkylidene-3-iminoindoles 3 were systematically
varied (Scheme 6, Table 5).A number of d-carbolines (7b i),
containing methyl and methoxy groups at various positions,
were prepared from the corresponding indoles in up to 80%
yield. d-Carbolines 7j l, containing bromo and ester groups,
were prepared from the corresponding functionalized indoles
with very good chemoselectivity.In case of 7j, 2-alkylidene-3-
oxindole 8 was isolated as a second product in 49% yield.This
Scheme 4.Synthesis of indolo[1,2- b]isoquinolin-5-ones 6a, b from 3 f, g.
of these products can be explained by intramolecular attack of
the indole nitrogen atom onto the nitrile to give an amidine,
cleavage of the imino group (vide supra), and hydrolysis of the
imine during chromatography or by water present in DMSO.
The yields of 6a and 6b (over two steps from bis(imidoyl)
3954
¹ 2003 Wiley-VCH Verlag GmbH & Co.KGaA, Weinheim
www.chemeurj.org
Chem. Eur. J. 2003, 9, 3951 3964

Functionalized 2-Alkylidene-3-iminoindoles
3951 3964
observation corresponds to the formation of indolo[1,2-b]-
isoquinolin-5-ones 6 from imino derivatives 5.All d-carbo-
lines 7a l were isolated in moderate to good yields and are
available in only two steps from readily available and
inexpensive starting materials.Due to the use of symmetric
oxalic acid bis(imidoyl) dichlorides, our methodology is
limited so far to the synthesis of d-carbolines containing
substitution patterns as depicted in Scheme 6.Future plans
are directed towards employment of unsymmetrical bis(imi-
doyl) dichlorides to install substituents at all positions of the
d-carboline moiety independently from each other.
Scheme 5.Synthesis of d-carboline 7a.
Carbolines 7 are of special interest because they are
fluorescence dyes.Emission in the range of 429 448 nm is
observed for alkyl- and bromo-substituted derivatives.No
shift of the emission wavelength was observed for the
presence of a methoxy group at the phenyl group.In contrast,
a dramatic bathochromic shift was observed for 7i, which
contains a methoxy group located at the indole moiety
(553 nm).
Table 4.Variation of the reaction conditions.
Entry
Conditions[a]
Yield [%][b]
1
2
3
4
5
6
7
8
FVP, 4508C
12
0
61
30
50
0
THF, reflux, 48 h
DMSO, reflux, 48 h
DMSO, reflux, 24 h
DMSO, reflux, 130 h
DMSO, 708C, 48 h
DMF, reflux, 48 h
toluene, reflux, 48 h
Mechanistic considerations: Indolo[1,2-b]isoquinolin-5-ones 5
can be regarded as lactam-bridged 2-alkylidene-3-iminoin-
doles.Different thermolytic reaction pathways were observed
for bridged and unbridged 2-alkylidene-3-iminoindoles 5 and
3.Thermolysis of 5b resulted in the formation of 6b (vide
supra) rather than pentacyclic d-carboline 9.This can be
0
0
[a] FVP ˆ flash vacuum pyrolysis .[b] Yield of 7a isolated.
Scheme 6.Synthesis of d-carbolines 7a l.
Table 5.Synthesis of d-carbolines 7a l.
explained in two ways: a) Formation of an sp3-hybridized
carbon atom is required for electrocyclization (intermediate
G; see Scheme 5).The corresponding intermediate leading to
9 would suffer from severe allylic strain; b) twisting of the
triene system is necessary for optimal orbital overlap during
electrocyclization.This twisting is more difficult for bridged
heterocycles 5 than for 3.
The thermolysis of amide 10[4b] was studied next
(Scheme 7).In this substrate the excellent leaving group
cyanide was replaced by a poor leaving group.Reflux of a
solution of 10 in DMSO resulted in the formation of d-
carboline 7g (53%).The formation of 2-alkylidene-3-oxin-
dole 11 could not be detected.Although 7g could be prepared
from nitrile 3o in better yield than from 10 (71%, Table 5),
the product distribution seems not to be influenced by the
leaving group ability.
[c]
3
7
R1
R2
R3
R4
R5
R6
R7 Yield [%][a] F lmax
s
a
t
a
b
c
d
e
f
g
h
i
H
Me
H
H
Me
H
Me
H
OMe
H
Me
Me
H
H
H
H
H
Me
H
H
H
H
H
H
H
H
Me
Me
Me
H
H
Me
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
Me
H
H
H
OMe
H
H
H
H
H
H
H
H
H
H
H
H
H
H
61
37
55
63
76
80
71
32
77
48[b]
71
38
429
429
439
q
u
r
o
n
v
c
b
h
448
444
427
Me Me
H
H
H
H
H
H
OMe
H
H
Br
Br
CO2Me
553
429
434
j
k
l
H
H
H
Mainly decomposition was observed during the thermolysis
of sulfone-substituted indole 12.Small amounts ( <10%) each
[a] Yield of isolated product.[b] A second product ( 8) was also isolated in 49%
yield.[c] Fluorescence [nm] (CH CN).
3
Chem. Eur. J. 2003, 9, 3951 3964
www.chemeurj.org
¹ 2003 Wiley-VCH Verlag GmbH & Co.KGaA, Weinheim
3955

P.Langer et al.
FULL PAPER
Figure 1.Folding of a 35-base oligodeoxynucleotide into an intramolecular
triplex structure with ten Watson Crick base pairs (¥) and seven
Hoogsteen bound third strand bases ( )
*
Scheme 7.Thermolysis of amide 10.
of d-carbolines 13a and 13b (the latter formed by extrusion of
the sulfone group of 13a), and of 2-alkylidene-3-oxindole 13c
were detected (Scheme 8).This result shows that the product
distribution is influenced by the substitution pattern and
electronic situation of the substrate.
Figure 2.Plot of first derivative d A/dT versus temperature of the UV
&
&
melting curves for the foldback triplex without ( ) and with ( ) d-carboline
7l.
dissociation of the ™third∫ strand, whereas the high-temper-
ature transition is associated with melting of the duplex stem.
Upon adding a small amount of d-carboline 7l to the
oligonucleotide, the triplex transition broadens but at the
same time the melting temperature determined from the
maximum of the first derivative plot dA/dT is shifted by about
48C to higher temperatures (Tm ꢀ 298C).It should be noted,
that the low solubility of 7l in aqueous solution prohibits
larger effects on melting.A corresponding, yet smaller shift of
about 2.68C is also observed for the duplex melting temper-
ature in the presence of the heterocyclic compound.This
indicates a stabilization of both the triplex and, albeit to a
minor extent, of the duplex structure by the polycyclic ligand
7l.Based on our encouraging initial results, future work is
directed to the preparation of d-carbolines that exhibit a
better solubility in water (e.g. carboxylic acid derivatives) and
to the synthesis of oligonucleotides containing a d-carboline
side chain for NMR experiments.
Scheme 8.Thermolysis of 2-alkylidene-3-oxindole 12.
DNA intercalation experiments: Several polycyclic com-
pounds have been shown in the past to selectively bind to
triplex or duplex DNA resulting in significant stabilization of
such structures.Thus, favored by its large aromatic ring
system, benzo[e]pyridoindole significantly stabilizes triplex
DNA by intercalation.[21] Likewise, based on their crescent-
shaped geometry, indolo[1,2-b]isoquinolin-5-ones 6 and d-
carbolines 7 should experience extensive overlap with adja-
cent base triplets upon intercalation within DNA.Herein, we
report first results related to these experiments: Using a
35mer oligonucleotide of the sequence GAAA-
GAAGCGTTTTCGCTTCTTTCTTTTCTTTCTT, which is
capable of forming both triple and double-helical structures
by folding back on itself under suitable conditions (Figure 1),
potential interactions with d-carbolines 7a l were studied by
UV melting experiments.[22]
Synthesis of indirubine analogues by sequential ™cyclization
lactonization∫ reactions
Our first attempts to prepare indirubine analogues by our
methodology failed.The direct cyclization of 2-cumaranone
with oxalic acid bis(phenylimidoyl)dichloride (2b) afforded
the open-chain 2:1 condensation product 14 rather than
indirubine derivative 15a (Scheme 9).Therefore, we envis-
aged a sequential synthesis with employment of our method-
ology in the first step.
The best results so far were obtained by using the ester-
substituted d-carboline 7l (Figure 2).Other derivatives
proved less successful, due to their low water solubility.As
seen in Figure 2, two thermal transitions are generally
observed in the UV melting curves at pH 7.The low-temper-
ature transition corresponds to the melting of the triplex with
Methoxy-substituted 2-alkylidene-3-iminoindoles 3k,l were
prepared in good yields by cyclization of (2-methoxyphen-
3956
¹ 2003 Wiley-VCH Verlag GmbH & Co.KGaA, Weinheim
www.chemeurj.org
Chem. Eur. J. 2003, 9, 3951 3964

Functionalized 2-Alkylidene-3-iminoindoles
3951 3964
bis(imidoyl) dichlorides 2 were prepared according to reference [9].For the
1H and 13C NMR spectra (1H NMR: 200, 300 and 500 MHz, 13C NMR: 50,
75 and 125 MHz) the deuterated solvents indicated were used.Mass
spectral data (MS) were obtained by using the electron ionization (70 eV),
the chemical ionization (CI, H2O), or the electrospray ionization technique
(ESI).For preparative scale chromatography silica gel (60 200 mesh) was
used.Melting points are uncorrected.Elemental analyses were performed
at the microanalytical laboratory of the University of Gˆttingen.
Procedures for the synthesis of (E)-2-(1-cyano-1-phenylmethylidene)-7-
methyl-3-(2-tolyl)imino-2,3-dihydro-1H-indole (3a)
Procedure 1 (use of LDA): n-Butyllithium (6.5 mL, 1.54m solution in n-
hexane, 10 mmol) was added to a solution of diisopropylamine (1.012 g,
10 mmol) in THF (30 mL) at 08C and the solution was stirred for 20 min.
Phenylacetonitrile 1a (0.469 g, 4.00 mmol) was added at 08C and the
solution was stirred for 60 min.The solution was slowly transferred by
cannula to a solution of oxalic acid bis(2-tolylimidoyl) dichloride (2a;
1.220 g, 4.00 mmol) in THF (50 mL) at À788C.The solution was warmed to
208C, stirred for 3 h, and poured into an aqueous solution of NH4Cl
(250 mL, 1m).The organic and the aqueous layer were separated and the
latter was extracted with diethyl ether (3 Â 100 mL).The combined organic
layers were dried (MgSO4), filtered, and the filtrate was concentrated in
vacuo.Chromatographic purification of the residue (silica gel; diethyl
Scheme 9.Reaction of 2-cumaranone with 2b.
yl)acetonitrile (1 f) with bis(imidoyl)dichlorides 2c,e (Ta-
ble 2).Treatment of indoles 3k,l with BBr3/MeOH resulted in
deprotection and subsequent lactonization to give the desired
products 15b,c (Scheme 10).
ether/petroleum etherˆ 1:3 ! 1:1 ! 3:1) afforded 3a as
a red solid
1
(742 mg, 53%, E/Z >98:2); H NMR (250 MHz, CDCl3): d ˆ 2.18 (s, 3H;
ArCH3), 2.25 (s, 3H; ArCH3), 6.50 6.63 (m, 2H; Ar), 6.88 (dd, J ˆ 7.7 Hz,
J ˆ 1.1 Hz, 1H; Ar), 7.07 7.14 (m, 3H; Ar, NH), 7.20 (dd, J ˆ 7.6 Hz, J ˆ
1.4 Hz, 1H; Ar), 7.24 7.27 (m, 1H; Ar), 7.30 7.44 (m, 1H; Ar), 7.54 (ddd,
J ˆ 7.9 Hz, J ˆ 7.8 Hz, J ˆ 1.5 Hz, 2H; Ar), 7.70 ppm (dd, J ˆ 7.8 Hz, J ˆ
1.4 Hz, 2H; Ar); 13C NMR (50.3 MHz, CDCl3): d ˆ 15.71 (ArCH3), 17.97
(ArCH3), 86.43 (C-CN), 116.97 (CH), 118.18, 119.05, 119.53 (C), 121.42,
123.96, 124.52, 126.53 (CH), 126.92 (C), 128.41, 128.59, 129.66, 130.75 (CH),
133.93 (C), 134.22 (CH), 146.02, 147.00, 149.18, 156.31 ppm (C); IR (KBr):
Scheme 10.Synthesis of indirubine analogues: 15b: R1 ˆ Me, R2 ˆ H:
53%, 15c: R1 ˆ H, R2 ˆ Me: 33%.
ꢁ
nÄ ˆ 3058 (w, Ar-H), 2924 (m, C-H), 2851 (w), 2200 (m, C N), 1652 (s), 1617
(s), 1596 (s), 1583 (s), 1491 (m), 1457 (m), 1337 (m), 1223 (s), 1183 (m), 1111
(w), 1037 (w), 749 cmÀ1 (s); UV/Vis (CHCl3): lmax (lg e) ˆ 460.0 nm (3.95),
‡
283.2 (4.24), 260.5 (4.19); MS (EI, 70 eV): m/z (%): 348 ([M] , 100), 322 (4),
256 (4); elemental analysis calcd (%) for C24H19N3 (349.4): C 82.49, H 5.48,
N 12.03; found: C 82.22, H 5.61, N 12.13.
Conclusions
Procedure 2 (use of potassium carbonate): A solution of phenylacetonitrile
(1a; 0.359 g, 3.06 mmol), oxalic acid bis(2-tolylimidoyl) dichloride (2a;
0.934 g, 3.06 mmol), and potassium carbonate (1.269 g, 9.18 mmol) in THF
(100 mL) was refluxed for five days under nitrogen.Chromatographic
purification (silica gel; diethyl ether/petroleum etherˆ 1:3 ! 1:1 ! 3:1)
afforded 3a as a red solid (582 mg, 54%, E/Z >98:2); elemental analysis
calcd (%) for C24H19N3 (349.4): C 82.49, H 5.48, N 12.03; found: C 82.24, H
5.68, N 12.07.
The NaH-mediated cyclization of arylacetonitriles with oxalic
acid bis(imidoyl) dichlorides allowed the synthesis of a great
variety of functionalized 2-alkylidene-3-iminoindoles.The
reactions are easy to carry out and the starting materials are
readily available.The cyclizations proceeded with excellent
chemo-, regio- and E/Z selectivity.Based on these results a
new domino process was developed: The domino ™cycliza-
tion lactamization∫ reaction of methyl 2-(cyanomethyl)ben-
zoate with bis(imidoyl) dichlorides allowed a convenient one-
pot synthesis of indolo[1,2-b]isoquinolin-5-ones related to
tryptanthrin.The hydrolytic cleavage of the arylimino group
provided an efficient synthesis of the parent heterocycles.
Thermolysis of 2-alkylidene-3-iminoindoles resulted in a
novel electrocyclization elimination reaction which provid-
ed a new and convenient approach to d-carbolines.These
compounds intercalate within DNA.Indirubine analogues
were prepared by deprotection and lactonization of function-
alized 2-alkylidene-3-iminoindoles.Indolo[1,2- b]isoquinolin-
5-ones, d-carbolines, and indirubine analogues are of great
pharmacological relevance, due to their antibiotic and cyto-
toxic activity, and occur in a variety of natural products.
Procedure 3 (use of sodium hydride): A solution of phenylacetonitrile (1a;
0.117 g, 1.00 mmol), oxalic acid bis(2-tolylimidoyl) dichloride (2a; 0.305 g,
1.00 mmol), and sodium hydride (0.072 g, 3.00 mmol) in THF (50 mL) was
refluxed for 3 d under nitrogen.Chromatographic purification (silica gel;
diethyl ether/petroleum etherˆ 1:3 ! 1:1 ! 3:1) afforded 3a as a red solid
(291 mg, 83%, E/Z >98:2); elemental analysis calcd (%) for C24H19N3
(349.4): C 82.49, H 5.48, N 12.03; found: C 82.37, H 5.51, N 12.14.
(E)-2-[1-Cyano-1-(4-bromophenyl)methylidene]-7-methyl-3-(2-tolyl)imi-
no-2,3-dihydro-1H-indole (3b): The reaction (procedure 3) of 4-bromo-
phenylacetonitrile (1b; 0.196 g, 1.00 mmol) and oxalic acid bis(2-tolylimi-
doyl) dichloride (2a; 0.305 g, 1.00 mmol) afforded 3b as an orange solid
(390 mg, 91%, E/Z > 98:2); 1H NMR (250 MHz, CDCl3): d ˆ 2.19 (s, 3H;
ArCH3), 2.23 (s, 3H; ArCH3), 6.50 6.64 (m, 2H; Ar), 6.86 (d, J ˆ 7.6 Hz,
1H; Ar), 7.07 7.30 (m, 5H; Ar, NH), 7.61 ppm (2 Â d, AA'XX', 4H; Ar);
13C NMR (50.3 MHz, [D6]acetone): d ˆ 16.28 (ArCH3), 17.96 (ArCH3),
85.87 (C-CN), 117.62 (CH), 118.78, 119.50 (C), 121.99 (CH), 122.15, 122.42
(C), 124.04, 125.22 (CH), 127.10 (C), 127.58, 131.55, 131.85, 133.18 (CH),
134.53 (C), 135.65 (CH), 148.26, 148.60, 150.41, 157.60 ppm (C); IR (KBr):
À
nÄ ˆ 3061 (w, Ar-H), 3011 (w), 2968 (w), 2922 (w, C H), 2860 (s), 2198 (m,
ꢁ
C N), 1644 (m), 1618 (m), 1588 (s), 1485 (s), 1458 (m), 1339 (s), 1221 (s),
1184 (m), 1110 (w), 1077 (m), 1009 (m), 792 (w), 747 (s), 721 cmÀ1 (m); UV/
Experimental Section
Vis (CHCl3): lmax (lg e) ˆ 461.5 nm (4.06), 287.5 (4.25), 260.9 (4.32); MS (EI,
‡
General comments: All solvents were dried by standard methods and all
70 eV): m/z (%): 428 ([M] , 100), 348 (40), 256 (4); elemental analysis calcd
reactions were carried out under an inert atmosphere.The oxalic acid
(%) for C24H18N3Br (428.3): C 67.30, H 4.24, N 9.81; found: C 67.10, H 4.47,
Chem. Eur. J. 2003, 9, 3951 3964
www.chemeurj.org
¹ 2003 Wiley-VCH Verlag GmbH & Co.KGaA, Weinheim
3957

P.Langer et al.
FULL PAPER
N 9.73. The reaction (procedure 1) of 1b (0.196 g, 1.00 mmol) and 2a
(0.305 g, 1.00 mmol) afforded 3b as an orange solid (80 mg, 19%, E/Z >
98:2); elemental analysis calcd (%) for C24H18N3Br (428.3): C 67.30, H 4.24,
N 9.81; found: C 67.17, H 4.29, N 9.67.
lmax (lg e) ˆ 480.1 nm (3.98), 466.3 (3.98), 350.6 (3.63); UV/Vis (CHCl3):
‡
lmax ˆ 474.4 nm; MS (EI, 70 eV): m/z (%): 346 ([M] , 100), 320 (16), 256
(4).
(E)-2-[1-Cyano-1-(2-cyanophenyl)methylidene]-7-methyl-3-(2-tolyl)imi-
no-2,3-dihydro-1H-indole (3g): The reaction (procedure 2) of 2-cyanophen-
ylacetonitrile (1d; 0.142 g, 1.00 mmol) and oxalic acid bis(2-tolylimidoyl)
dichloride (2a; 0.305 g, 1.00 mmol) afforded 3g as a red solid (150 mg,
(E)-2-[1-Cyano-1-(4-bromophenyl)methylidene]-3-phenylimino-2,3-dihy-
dro-1H-indole (3c): The reaction (procedure 3) of 4-bromophenylacetoni-
trile (1b; 0.196 g, 1.00 mmol) and oxalic acid bis(phenylimidoyl) dichloride
(2b; 0.277 g, 1.00 mmol) afforded 3c as a red solid (380 mg, 95%, E/Z
>98:2); 1H NMR (300 MHz, [D6]DMSO): d ˆ 6.42 (d, 1H; Ar), 6.63 (t,
1H; Ar), 6.95 7.07 (m, 2H; Ar), 7.20 7.35 (m, 2H; Ar), 7.44 7.76 ppm (m,
8H; Ar, NH); 13C NMR (75.5 MHz, [D6]DMSO): d ˆ 82.85 (C-CN), 111.96
(CH), 119.87 (C), 117.59 (CH), 119.08 (C), 120.44 (CH), 121.21 (C), 124.39,
125.50, 129.52, 130.89, 132.07 (CH), 132.82 (C), 133.84 (CH), 147.01, 148.98,
150.41, 157.41 ppm (C); IR (KBr): nÄ ˆ 3047 (m, Ar-H), 2807 (m), 2192 (m,
1
40%, E/Z >98:2); H NMR (250 MHz, CDCl3): d ˆ 2.23 (s, 3H; ArCH3),
2.41 (s, 3H; ArCH3), 6.80 (d, J ˆ 7.6 Hz, 1H; Ar), 6.89 6.96 (m, 2H; Ar),
7.14 7.33 (m, 5H; Ar, NH), 7.59 7.63 (m, 1H; Ar), 7.68 (t, J ˆ 7.7 Hz, 1H;
Ar), 7.96 (dd, J ˆ 7.9 Hz, J ˆ 1.0 Hz, 1H; Ar), 8.04 ppm (d, J ˆ 7.7 Hz, 1H;
Ar); 13C NMR (75.5 MHz, [D6]DMSO, Tˆ 1008C): d ˆ 16.60 (ArCH3),
21.28 (ArCH3), 86.95 (C-CN), 113.75 (C), 116.17 (CH), 121.45 (C), 121.94,
124.01, 124.47, 124.76 (CH), 125.71 (C), 126.04, 126.21 (CH), 127.03, 127.75
(C), 129.02 (CH), 129.25 (C), 130.29, 131.55, 136.51 (CH), 143.70, 144.60,
148.07, 152.24, 153.43 ppm (C); IR (KBr): nÄ ˆ 3060 (w, Ar-H), 2975 (w),
ꢁ
C N), 1638 (m), 1618 (m), 1579 (s), 1482 (m), 1464 (s),1403 (s), 1346 (s),
1219 (m), 1147 (w), 1094 (w), 828 (w), 750 (w), 693 cmÀ1 (m); UV/Vis
À
ꢁ
(DMF): lmax (lg e) ˆ 481.6 nm (3.89), 320.7 (3.73); UV/Vis (CHCl3): lmax
ˆ
2925 (w, C H), 2853 (w), 2217 (m, C N), 1648 (m), 1630 (s), 1611 (m), 1594
(m), 1578 (m), 1477 (s), 1455 (s), 1343 (s), 1280 (m), 1219 (m), 1166 (m),
1157 (m), 1112 (w), 1094 (m), 1017 (w), 794 (w), 767 (m), 749 (s), 736 cmÀ1
(w); UV/Vis (DMF): lmax (lg e) ˆ 461.4 nm (3.72), 334.8 (3.74); UV/Vis
‡
461.1 nm; MS (EI, 70 eV): m/z (%): 400 ([M] , 100), 320 (55), 243 (10);
elemental analysis calcd (%) for C22H14N3Br (400.3): C 66.01, H 3.53;
found: C 66.24, H 4.28.
‡
(CHCl3): lmax ˆ 450.1 nm; MS (EI, 70 eV): m/z (%): 374 ([M] , 100), 348
(E)-2-[1-Cyano-1-(4-bromophenyl)methylidene]-6-methyl-3-(3-tolyl)imi-
no-2,3-dihydro-1H-indole (3d): The reaction (procedure 3) of 4-bromo-
phenylacetonitrile (1b; 0.196 g, 1.00 mmol) and oxalic acid bis(3-tolylimi-
doyl) dichloride (2c; 0.305 g, 1.00 mmol) afforded 3d as an orange solid
(259 mg, 61%, E/Z >98:2).Only one regioisomer was selectively formed.
1H NMR (300 MHz, [D6]DMSO): d ˆ 2.26 (s, 3H; ArCH3), 2.38 (s, 3H;
ArCH3), 6.32 6.60 (m, 2H; Ar), 6.80 (s, d, 3H; Ar), 7.04 (d, 1H; Ar), 7.34
(t, 1H; Ar), 7.56 (d, AA'XX', 2H; Ar), 7.76 (d, AA'XX', 2H; Ar),
10.25 ppm (br, 1H; NH); 13C NMR (62.9 MHz, [D6]DMSO): d ˆ 21.07
(ArCH3), 21.72 (ArCH3) 82.54 (C-CN), 112.11, 114.73, 118.27 (CH), 119.28,
121.29 (C), 121.65, 125.03, 125.50, 129.42, 131.00, 132.18 (CH), 133.02,
139.07, 144.72, 147.64, 149.35, 150.61, 157.14 ppm (C); IR (KBr): nÄ ˆ 3057
(8); elemental analysis calcd (%) for C25H18N4 (374.4): C 80.19, H 4.85;
found: C 80.21, H 4.61.
(E)-2-[1-Cyano-1-(4-methyloxycarbonylphenyl)methylidene]-7-methyl-3-
(2-tolyl)imino-2,3-dihydro-1H-indole (3h): The reaction (procedure 3) of
(4-methoxycarbonylphenyl)acetonitrile (1e; 0.175 g, 1.00 mmol) and oxalic
acid bis(2-tolylimidoyl) dichloride (2a; 0.305 g, 1.00 mmol) afforded 3h as a
yellow solid (195 mg, 48%, E/Z >98:2); 1H NMR (250 MHz, CDCl3): d ˆ
2.20 (s, 3H; ArCH3), 2.24 (s, 3H; ArCH3), 3.97 (s, 3H; CO2CH3), 6.53 6.66
(m, 2H; Ar), 6.88 (d, J ˆ 7.7 Hz, 1H; Ar), 7.09 7.31 (m, 5H; Ar, NH), 7.79
(d, J ˆ 8.1 Hz, AA'XX', 2H; Ar), 8.20 ppm (d, J ˆ 8.1 Hz, AA'XX', 2H;
Ar); 13C NMR (75.5 MHz, CDCl3): d ˆ 15.76 (ArCH3), 18.04 (ArCH3),
52.45 (CO2CH3), 85.42 (C-CN), 116.93, 118.11 118.65, 119.77, 121.92, 124.07,
124.82, 126.63, 127.01, 128.37, 129.94, 130.06, 130.89, 134.40, 134.47, 145.85,
147.78, 149.05, 156.34, 166.34 ppm; IR (KBr): nÄ ˆ 3060 (w, Ar-H), 3014 (w),
ꢁ
(w, Ar-H), 3032 (w), 2950 (w), 2919 (w, C-H), 2192 (m, C N), 1650 (m),
1626 (m), 1589 (s), 1486 (m), 1449 (m), 1346 (m), 1225 (m), 1153 (m), 1115
(m), 1010 (m), 811 (w), 763 (m), 709 cmÀ1 (w); UV/Vis (CHCl3): lmax (lg
e) ˆ 458.9 nm (3.98), 281.0 (4.30), 266.6 (4.29); MS (EI, 70 eV): m/z (%):
À
ꢁ
2950 (w), 2924 (w, C H), 2196 (m, C N), 1710 (s), 1645 (s), 1587 (s), 1493
(m), 1482 (m), 1456 (m), 1342 (s), 1223 (s), 1184 (s), 1112 (s), 770 (m), 748
(s), 721 cmÀ1 (m); UV/Vis (CHCl3): lmax (lg e) ˆ 466.9 nm (3.67), 311.8
‡
428 ([M] , 16), 348 (24), 284 (64).
(E)-2-[1-Cyano-1-(3-bromophenyl)methylidene]-7-methyl-3-(2-tolyl)imi-
no-2,3-dihydro-1H-indole (3e): The reaction (procedure 2) of 3-bromo-
phenylacetonitrile (1c; 0.196 g, 1.00 mmol) and oxalic acid bis(2-tolylimi-
doyl) dichloride (2a; 0.305 g, 1.00 mmol) afforded 3e as a red solid (209 mg,
‡
(3.79), 261.0 (3.97); MS (EI, 70 eV): m/z (%): 406 ([M] , 100), 392 (84), 348
(66); the exact molecular mass for C26H21N3O2 m/z: 407.1633 Æ 2 mD
‡
([M] ) was confirmed by HRMS (EI, 70 eV).
1
49%, E/Z >98:2); H NMR (250 MHz, CDCl3): d ˆ 2.21 (s, 3H; ArCH3),
(E)-2-[1-Cyano-1-phenyl-methylidene]-6-bromo-3-(3-bromophenyl)imi-
no-2,3-dihydro-1H-indole (3i): The reaction (procedure 3) of phenyl-
acetonitrile (1a; 0.117 g, 1.00 mmol) and oxalic acid bis(3-bromophenyl-
imidoyl) dichloride (2d; 0.435 g, 1.00 mmol) afforded 3i as an orange solid
(213 mg, 44%, E/Z >98:2).Only the 6-bromo-substituted regioisomer was
selectively formed. 1H NMR (250 MHz, [D6]DMSO): d ˆ 6.37 (d, J ˆ
8.3 Hz, 1H; Ar), 6.86 (d, J ˆ 8.0 Hz, 1H; Ar), 7.01 (s, 1H; Ar), 7.19 (d,
J ˆ 9.0 Hz, 2H; Ar), 7.40 7.46 (m, 3H; Ar), 7.51 7.61 ppm (m, 4H; Ar);
13C NMR (50.3 MHz, CDCl3): d ˆ 86.08 (C-CN), 114.73 (CH), 115.91 (C),
116.75 (CH), 118.66 (C), 120.27 (CH), 122.29 (C), 123.14, 126.68, 126.95
(CH), 127.30 (C), 128.31, 128.56, 129.11, 131.37 (CH), 133.06, 146.04, 150.19,
2.24 (s, 3H; ArCH3), 6.52 6.65 (m, 2H; Ar), 6.87 (d, J ˆ 7.6 Hz, 1H; Ar),
7.06 7.22 (m, 4H; Ar, NH), 7.27 7.44 (m, 2H; Ar), 7.52 7.64 (m, 2H; Ar),
7.86 ppm (s, 1H; Ar); 13C NMR (125.7 MHz, [D4]MeOH): d ˆ 16.28
(ArCH3), 17.97 (ArCH3), 84.68 (C-CN), 117.98 (CH), 119.21, 120.72 (C),
122.44 (CH), 122.85, 124.08 (C), 124.47, 125.65 (CH), 127.53 (C), 127.87,
128.88, 131.86, 132.01, 132.29, 132.86, 136.10 (CH), 137.74, 148.82, 150.42,
150.73, 159.11 ppm (C); IR (KBr): nÄ ˆ 3061 (w, Ar-H), 3015 (w), 2970 (w),
À
ꢁ
2922 (w, C H), 2855 (w), 2197 (m, C N), 1645 (m), 1619 (m), 1590 (s), 1492
(m), 1458 (m), 1335 (s), 1219 (s), 1184 (w), 1110 (w), 1077 (w), 1028 (w), 752
(m), 724 cmÀ1 (w); UV/Vis (CHCl3): lmax (lg e) ˆ 461.0 nm (4.01), 286.3
‡
ꢁ
(4.24), 265.4 (4.25); MS (EI, 70 eV): m/z (%): 428 ([M] , 100), 348 (44), 256
151.50, 156.76 ppm (C); IR (KBr): nÄ ˆ 2921 (w), 2192 (w, C N), 1645 (s),
‡
(8); the exact molecular mass for C24H18N3Br m/z: 427.0684 Æ 2 mD ([M] )
1607 (s), 1581 (s), 1465 (m), 1449 (s), 1439 (s), 1337 (s), 1299 (m), 1227 (s),
1214 (m), 1016 (m), 902 (m), 878 (w), 759 (w), 743 (w), 704 cmÀ1 (w); UV/
Vis (CHCl3): lmax (lg e) ˆ 461.5 nm (4.01), 289.5 (4.37); MS (EI, 70 eV): m/z
was confirmed by HRMS (EI, 70 eV).The reaction (procedure 3) of 1c
(0.196 g, 1.00 mmol) and 2a (0.305 g, 1.00 mmol) afforded 3e as a red solid
(360 mg, 84%, E/Z >98:2).
‡
(%): 478 ([M] , 100), 398 (8), 318 (5); elemental analysis calcd (%) for
C22H13N3Br2 (479.2): C 55.15, H 4.21; found: C 55.12, H 2.99. The reaction
(procedure 1) of 1a (0.196 g, 1.00 mmol) and 2d (0.478 g, 1.10 mmol)
afforded 3i as an orange solid (40 mg, 8%, E/Z >98:2).
(E)-2-[1-Cyano-1-(2-cyanophenyl)methylidene]-3-phenylimino-2,3-dihy-
dro-1H-indole (3 f): The reaction (procedure 3) of 2-cyanophenylacetoni-
trile (1d; 0.142 g, 1.00 mmol) and oxalic acid bis(phenylimidoyl) dichloride
(2b; 0.277 g, 1.00 mmol) afforded 3 f as an orange solid (212 mg, 61%, E/Z
(E)-2-[1-Cyano-1-(2-methoxyphenyl)methylidene]-3-phenylimino-2,3-di-
hydro-1H-indole (3j): The reaction (procedure 1) of 2-methoxyphenyl-
acetonitrile (1 f; 0.147 g, 1.00 mmol) and oxalic acid bis(phenylimidoyl)
dichloride (2b; 0.277 g, 1.00 mmol) afforded 3j as a yellow solid (0.192 g,
0.546 mmol, 55%, E/Z >98:2); 1H NMR (250 MHz, CDCl3): d ˆ 3.86 (s,
3H; OCH3), 6.61 (d, J ˆ 7.4 Hz, 2H; Ar), 6.77 (d, J ˆ 8.0 Hz, 1H; Ar), 7.02
7.13 (m, 5H; Ar, NH), 7.16 7.25 (m, 2H; Ar), 7.41 (ddd, J ˆ 8.2 Hz, J ˆ
1
>98:2); H NMR (250 MHz, CDCl3): d ˆ 6.90 7.00 (m, 2H; Ar), 7.05 (d,
J ˆ 7.3 Hz, 2H; Ar), 7.22 7.29 (m, 1H; Ar), 7.43 7.54 (m, 4H; Ar, NH),
7.61 7.77 (m, 2H; Ar), 8.06 (dd, J ˆ 7.9 Hz, J ˆ 1.8 Hz, 2H; Ar), 9.08 ppm
(d, J ˆ 8.7 Hz, 1H; Ar); 13C NMR (75.5 MHz, CDCl3/[D4]methanol ˆ 1:1):
ˆ
d ˆ 85.17 (C CCN), 114.31 (C), 117.66, 118.63 (CH), 119.63 (C), 124.82,
124.94, 124.96 (CH), 125.26 (C), 125.71, 126.14, 129.33 (CH), 129.50 (C),
129.53, 132.38, 133.45 (CH), 145.36, 149.81, 153.88, 155.19 ppm (C); IR
7.5 Hz, J ˆ 1.6 Hz, 3H; Ar), 7.54 ppm (dd, J ˆ 7.7 Hz, J ˆ 1.6 Hz, 1H; Ar);
13
ꢁ
À
(KBr): nÄ ˆ 3046 (s, Ar-H), 2808 (m), 2212 (m, C N), 1656 (m), 1623 (s),
C NMR (50.3 MHz, CDCl3): d ˆ 56.25 (OCH3), 83.20 (C CN), 110.53,
1596 (m), 1485 (m), 1456 (s), 1403 (s), 1349 (s), 1217 (m), 1165 (m), 1114
(w), 1041 (w), 1028 (w), 797 (m), 756 (m), 717 cmÀ1 (w); UV/Vis (DMF):
112.47 (CH), 114.00 (CN), 118.16 (CH), 118.39, 118.59 (C), 120.85, 121.70
(CH), 121.97 (C), 124.35, 126.81, 129.31, 130.60, 131.27, 133.27 (CH), 147.46,
3958
¹ 2003 Wiley-VCH Verlag GmbH & Co.KGaA, Weinheim
www.chemeurj.org
Chem. Eur. J. 2003, 9, 3951 3964

Functionalized 2-Alkylidene-3-iminoindoles
3951 3964
147.55, 150.67, 156.65 ppm (C); IR (KBr): nÄ ˆ 3061 (w), 3014 (w), 2963 (w),
1H; Ar); 13C NMR (50.3 MHz, CDCl3): d ˆ 20.89 (ArCH3), 21.05 (ArCH3),
ꢁ
À
2934 (w), 2192 (m, C N), 1646 (s), 1620 (s), 1596 (s), 1485 (s), 1465 (s), 1434
55.43 (OCH3), 85.14 (C CN), 110.38, 114.02, 114.07, 118.32 (CH), 119.19
(m), 1345 (s), 1276 (m), 1254 (s), 1217 (s), 1148 (m), 1024 (m), 766 (m), 749
(C), 120.75, 126.82, 129.76 (CH), 130.47, 130.49 (C), 130.52, 134.03 (CH),
(s), 695 cmÀ1 (m); UV/Vis (CH3CN): lmax (lg e) ˆ 464.8 nm (3.93), 275.5
134.15, 135.25, 145.38, 147.65, 147.72, 156.28, 160.31 ppm (C); IR (KBr): nÄ ˆ
‡
ꢁ
(4.31), 220.9 (4.35); MS (EI, 70 eV): m/z (%): 353 ([M] , 12), 320 ([M À
3024 (w), 2996 (w), 2920 (m), 2860 (w), 2193 (m, C N), 1643 (s), 1620 (s),
‡
OMe] , 100), 245 (4).
1586 (s), 1502 (s), 1488 (s), 1434 (m), 1333 (s), 1290 (m), 1262 (m), 1225 (s),
1201 (s), 1170 (m), 1120 (m), 1048 (m), 830 (m), 817 (m), 784 (w), 767 (w),
697 cmÀ1 (w); UV/Vis (CH3CN): lmax (lg e) ˆ 480.6 nm (4.00), 282.8 (4.29),
(E)-2-[1-Cyano-1-(2-methoxyphenyl)methylidene]-7-methyl-3-(2-tolyl)-
imino-2,3-dihydro-1H-indole (3k): The reaction (procedure 1) of 2-meth-
oxyphenylacetonitrile (1 f; 0.147 g, 1.00 mmol) and oxalic acid bis(2-
tolylimidoyl) dichloride (2a; 0.305 g, 1.00 mmol) afforded 3k as an orange
solid (0.193 g, 0.509 mmol, 51%, E/Z >98:2); 1H NMR (250 MHz, CDCl3):
2.15 (s, 3H; ArCH3), 2.25 (s, 3H; ArCH3), 3.98 (s, 3H; OCH3), 6.48 (d, J ˆ
7.2 Hz, 1H; Ar), 6.56 (dd, J ˆ 7.7 Hz, J ˆ 7.3 Hz, 1H; Ar), 6.90 (d, J ˆ 7.7 Hz,
1H; Ar), 7.01 (br, 1H; Ar), 7.05 7.13 (m, 4H; Ar), 7.15- 7.29 (m, 3H; Ar),
7.43 (ddd, J ˆ 8.4 Hz, J ˆ 7.3 Hz, J ˆ 1.7 Hz, 1H; Ar), 7.64 ppm (dd, J ˆ
7.7 Hz, J ˆ 1.7 Hz, 1H; Ar); 13C NMR (50.3 MHz, CDCl3): d ˆ 15.70
‡
‡
222.6 (4.44); MS (EI, 70 eV): m/z (%): 379 ([M] , 60), 378 ([M À 1] , 100),
352 (44), 335 (10).
(E)-2-[1-Cyano-1-(4-methoxyphenyl)methylidene]-7-methyl-3-(2-tolyl)-
imino-2,3-dihydro-1H-indole (3o): The reaction (procedure 1) of 4-meth-
oxyphenylacetonitrile (1h; 0.147 g, 1.00 mmol) and oxalic acid bis(2-
tolylimidoyl) dichloride (2a; 0.305 g, 1.00 mmol) afforded 3o as a red solid
(0.115 g, 0.303 mmol, 30%, E/Z >98:2); 1H NMR (250 MHz, CDCl3): d ˆ
2.19 (s, 3H; ArCH3), 2.24 (s, 3H; ArCH3), 3.86 (s, 3H; OCH3), 6.48 6.61 (2
t, J ˆ 7.5 Hz, 2H; Ar), 6.87 (d, J ˆ 7.6 Hz, 1H; Ar), 7.02 7.13 (m, 5H; Ar,
NH), 7.19 (d, J ˆ 7.5 Hz, 1H; Ar), 7.27 (d, J ˆ 7.6 Hz, 1H; Ar), 7.61 ppm (d,
J ˆ 8.8 Hz, 2H; Ar); 13C NMR (50.3 MHz, CDCl3): d ˆ 15.71 (ArCH3),
17.93 (ArCH3), 55.37 (OCH3), 86.40 (C-CN), 114.99, 116.98 (CH), 118.21,
119.21, 119.59 (C), 121.20, 123.83, 124.33 (CH), 125.81 (C), 126.47 (CH),
126.81 (C), 129.72, 130.66, 134.09 (CH), 146.11, 146.38, 149.26, 156.31,
159.57 ppm (C); IR (KBr): nÄ ˆ 3063 (w), 3010 (w), 2956 (w), 2930 (w), 2198
À
(ArCH3), 18.03 (ArCH3), 56.17 (OCH3), 83.22 (C CN), 112.53, 117.06
(CH), 118.29, 119.29, 119.40 (C), 121.06, 121.92 (CH), 122.30 (C), 123.94,
124.36, 126.47 (CH), 126.96 (C), 130.47, 130.68, 131.43, 134.02 (CH), 146.26,
147.44, 149.30, 156.21, 156.46 ppm (C); IR (KBr): nÄ ˆ 3063 (w), 3014 (w),
ꢁ
2962 (w), 2936 (w), 2195 (m, C N), 1646 (m), 1619 (m), 1595 (s), 1492 (s),
1460 (s), 1434 (m), 1338 (s), 1268 (m), 1249 (m), 1223 (s), 1182 (m), 1112
(m), 1072 (m), 1023 (m), 851 (w), 795 (w), 750 cmÀ1 (s); UV/Vis (CH3CN):
lmax (lg e) ˆ 462.2 nm (3.85), 275.9 (4.30); MS (ESI): m/z (%): 781
ꢁ
(m, C N), 1644 (m), 1599 (s), 1510 (s), 1489 (m), 1459 (m), 1430 (m), 1381
‡
‡
([2M‡Na] , 50), 402 ([M‡Na] , 100), 348 (40).
(w), 1336 (s), 1301 (m), 1253 (s), 1219 (s), 1181 (s), 1111 (w), 1034 (m), 835
(m), 797 (w), 776 (w), 746 cmÀ1 (m); UV/Vis (CH3CN): lmax (lg e) ˆ
470.2 nm (4.02), 275.6 (4.32), 229.3 (4.29); MS (EI, 70 eV): m/z (%): 379
(E)-2-[1-Cyano-1-(2-methoxyphenyl)methylidene]-6-methyl-3-(3-tolyl)-
imino-2,3-dihydro-1H-indole (3l): The reaction (procedure 1) of 2-meth-
oxyphenylacetonitrile (1 f; 0.147 g, 1.00 mmol) and oxalic acid bis(3-
tolylimidoyl) dichloride (2c; 0.305 g, 1.00 mmol) afforded 3l as an orange
solid (0.268 g, 0.707 mmol, 71%, E/Z >98:2); 1H NMR (250 MHz, CDCl3):
d ˆ 2.25 (s, 3H; ArCH3), 2.36 (s, 3H; ArCH3), 3.93 (s, 3H; OCH3), 6.43 (d,
J ˆ 8.2 Hz, 1H; Ar), 6.56 (d, J ˆ 7.8 Hz, 1H; Ar), 6.57 (s, 1H; Ar), 6.83 (d,
J ˆ 7.5 Hz, 1H; Ar), 6.87 (s, 1H; Ar), 6.94 7.12 (m, 4H; Ar, NH), 7.27 (t,
J ˆ 7.7 Hz, 1H; Ar), 7.41 (td, J ˆ 7.5 Hz, J ˆ 1.7 Hz, 1H; Ar), 7.53 ppm (dd,
J ˆ 7.5 Hz, J ˆ 1.7 Hz, 1H; Ar); 13C NMR (50.3 MHz, CDCl3): d ˆ 22.11
‡
‡
([M] , 50), 378 ([M À 1] , 100), 364 (24), 348 (12), 335 (4); the exact
‡
molecular mass for C25H21N3O m/z: 379.1685 Æ 2 mD ([M] ) was confirmed
by HRMS (EI, 70 eV).
(E)-2-[1-Cyano-1-(2-tolyl)-methylidene]-3-phenylimino-2,3-dihydro-1H-
indole (3p): The reaction (procedure 1) of 2-tolylacetonitrile (1i; 0.131 g,
1.00 mmol) and oxalic acid bis(phenylimidoyl) dichloride (2b; 0.277 g,
1.00 mmol) afforded 3p as a yellow solid (0.249 g, 0.744 mmol, 74%, E/Z
1
>98:2); H NMR (250 MHz, CDCl3): d ˆ 2.45 (s, 3H; ArCH3), 6.58 6.74
À
(ArCH3), 25.20 (ArCH3), 56.26 (OCH3), 82.64 (C CN), 110.95, 112.48,
(m, 4H; Ar, NH), 7.05 (dd, J ˆ 8.3 Hz, J ˆ 1.1 Hz, 2H; Ar), 7.16 7.46 ppm
(m, 8H; Ar); 13C NMR (75.5 MHz, CDCl3): d ˆ 19.82 (ArCH3), 85.07 (C-
CN), 110.49, 118.17 (CH), 118.34 (C), 120.97, 124.50, 126.85, 126.90, 129.35,
129.36, 130.05, 131.36 (CH), 131.77 (C), 133.42 (CH), 137.94, 137.95, 147.32,
147.85, 150.85, 156.02 ppm (C); IR (KBr): nÄ ˆ 3059 (w, Ar-H), 3025 (w),
115.16 (CH), 116.14 (C), 118.98, 121.70, 121.94 (CH), 122.14, 123.80 (C),
124.92, 126.59, 129.04, 130.49, 131.30 (CH), 139.13, 144.43, 144.47, 147.88,
148.01, 150.79, 156.64 ppm (C); IR (KBr): nÄ ˆ 3059 (w), 3017 (w), 2992 (w),
ꢁ
2921 (w), 2191 (m, C N), 1646 (m), 1627 (s), 1594 (s), 1583 (s), 1490 (s),
À
ꢁ
1456 (s), 1436 (m), 1345 (s), 1273 (m), 1250 (s), 1220 (m), 1154 (m), 1116
2953 (w), 2922 (w, C H), 2187 (m, C N), 1647 (m), 1620 (m), 1588 (s), 1483
(m), 1465 (s), 1344 (s), 1220 (s), 1149 (m), 1101 (w), 1024 (w), 767 (w), 747
(m), 716 cmÀ1 (w); UV/Vis (CH3CN): lmax (lg e) ˆ 458.7 nm (3.95), 274.6
(m), 1026 (m), 809 (w), 756 (m), 749 cmÀ1 (m); UV/Vis (CH3CN): lmax (lg
‡
e) ˆ 461.7 nm (3.87), 280.7 (4.38); MS (EI, 70 eV): m/z (%): 379 ([M] , 8),
‡
‡
348 ([M À OMe] , 100), 332 (4).
(4.36), 226.0 (4.31); MS (EI, 70 eV): m/z (%): 334 ([M] , 16), 320 (100), 243
(4); elemental analysis calcd (%) for C23H17N3 (335.4): C 82.36, H 5.11, N
12.53; found: C 82.21, H 5.41, N 12.41.
(E)-2-[1-Cyano-1-(2-methoxyphenyl)methylidene]-5,7-dimethyl-3-(2,4-di-
methylphenyl)imino-2,3-dihydro-1H-indole (3m): The reaction (procedure
1) of 2-methoxyphenylacetonitrile (1 f; 0.441 g, 3.00 mmol) and oxalic acid
bis(2,4-dimethylphenylimidoyl) dichloride (2e; 1.005 g, 3.00 mmol) afford-
ed 3m as an orange solid (0.758 g, 1.860 mmol, 62%, E/Z >98:2). 1H NMR
(250 MHz, CDCl3): d ˆ 2.04, 2.11, 2.25, 2.37 (4 s, 4  3H; ArCH3), 3.94 (s,
3H; OCH3), 6.44 (s, 1H; Ar), 6.80 (d, J ˆ 7.9 Hz, 1H; Ar), 6.89 (s, 1H; Ar),
6.98 (s, 1H; Ar), 7.02 7.13 (m, 4H; Ar, NH), 7.39 (t, J ˆ 7.4 Hz, 1H; Ar),
7.61 ppm (dd, J ˆ 7.7 Hz, J ˆ 1.5 Hz, 1H; Ar); 13C NMR (50.3 MHz,
CDCl3): d ˆ 15.55 (ArCH3), 17.94 (ArCH3), 20.72 (ArCH3), 20.87 (ArCH3),
55.94 (OCH3), 82.18 (C-CN), 109.99 (C), 112.36, 116.89 (CH), 118.27,
119.06, 119.50 (C), 121.67 (CH), 122.31 (C), 123.83, 126.69 (CH), 127.15,
130.17 (C), 130.21, 131.22, 131.26 (CH), 133.75 (C), 134.81 (CH), 144.26,
146.53, 148.01, 156.12 ppm (C); IR (KBr): nÄ ˆ 3064 (w), 3001 (w), 2967 (w),
(E)-2-[1-Cyano-1-(3-tolyl)methylidene]-5-methyl-3-(4-tolyl)imino-2,3-di-
hydro-1H-indole (3q): The reaction (procedure 1) of 3-tolylacetonitrile
(1j; 0.131 g, 1.00 mmol) and oxalic acid bis(4-tolylimidoyl)chloride (2 f;
0.305 g, 1.00 mmol) afforded 3q as a red solid (0.225 g, 0.618 mmol, 62%,
E/Z >98:2); 1H NMR (250 MHz, CDCl3): d ˆ 2.04 (s, 3H; ArCH3), 2.40 (s,
6H; 2 ArCH3), 6.60 (s, 1H; Ar), 6.72 (d, J ˆ 8.0 Hz, 1H; Ar), 6.92 (d, J ˆ
8.1 Hz, 2H; Ar), 7.01 (d, J ˆ 8.2 Hz, 1H; Ar), 7.15 7.26 (m, 3H; Ar), 7.32
7.43 ppm (m, 4H; Ar, NH); 13C NMR (50.3 MHz, CDCl3): d ˆ 20.86
(ArCH3), 21.03 (ArCH3), 21.47 (ArCH3), 85.36 (C-CN), 110.44 (CH),
118.27 (C), 118.32 (CH), 119.42 (C), 125.47, 126.75, 129.14, 129.17, 129.25,
129.73 (CH), 130.29, 133.80 (C), 133.99 (CH), 134.05, 139.35, 145.52, 147.50,
147.78, 156.37 ppm (C); IR (KBr): nÄ ˆ 3023 (w), 2946 (w), 2946 (w), 2919
ꢁ
ꢁ
2943 (m), 2918 (m), 2196 (m, C N), 1644 (m), 1618 (s), 1594 (s), 1481 (s),
(m), 2195 (m, C N), 1662 (m), 1642 (s), 1621 (s), 1586 (s), 1502 (s), 1487 (s),
1435 (m), 1383 (m), 1332 (s), 1282 (m), 1249 (m), 1234 (m), 1204 (s), 1179
(m), 1119 (m), 1022 (m), 827 (w), 770 (m), 753 cmÀ1 (m); UV/Vis (CH3CN):
lmax (lg e) ˆ 474.5 nm (3.97), 280.3 (4.39); MS (EI, 70 eV): m/z (%): 407
1438 (m), 1382 (m), 1330 (s), 1289 (m), 1250 (m), 1223 (s), 1205 (m), 1119
(m), 1036 (w), 830 (w), 790 (w), 701 cmÀ1 (w); UV/Vis (CH3CN): lmax (lg
e) ˆ 480.7 nm (4.00), 308.1 (4.14), 284.0 (4.28); MS (EI, 70 eV): m/z (%):
‡
‡
‡
‡
([M] , 3), 406 ([M À H] , 6), 392 (8), 376 (100), 360 (2).
363 ([M] , 56), 362 ([M À H] , 100), 348 (52); the exact molecular mass for
‡
C25H21N3 m/z: 363.1735 Æ2 mD ([M] ) (363.1691 for the M À H isotope
(E)-2-[1-Cyano-1-(3-methoxyphenyl)-methylidene]-5-methyl-3-(4-tolyl)-
imino-2,3-dihydro-1H-indole (3n): The reaction (procedure 3) of 3-meth-
oxyphenylacetonitrile (1g; 0.147 g, 1.00 mmol) and oxalic acid bis(4-
tolylimidoyl) dichloride (2 f; 0.336 g, 1.10 mmol) afforded 3n as a red solid
(0.226 g, 0.596 mmol, 60%, E/Z >98:2); 1H NMR (250 MHz, CDCl3): d ˆ
2.06 (s, 3H; ArCH3), 2.40 (s, 3H; ArCH3), 3.85 (s, 3H; OCH3), 6.61 (s, 1H;
Ar), 6.70 (d, J ˆ 8.1 Hz, 1H; Ar), 6.93 (d, J ˆ 8.2 Hz, 1H; Ar), 7.03 (d, J ˆ
8.1 Hz, 1H; Ar), 7.15 7.26 (m, 5H; Ar, NH), 7.33(s, 1H; Ar), 7.39 ppm (t,
12
fragment
C
13C1H20N3) was confirmed by HRMS (EI, 70 eV).
24
(E)-2-[1-Cyano-1-(4-tolyl)methylidene]-4,6-dimethyl-3-(3,5-dimethylphe-
nyl)imino-2,3-dihydro-1H-indole (3r): The reaction (procedure 3) of
4-tolylacetonitrile (1k; 0.131 g, 1.00 mmol) and oxalic acid bis(3,5-dime-
thylphenylimidoyl) dichloride (2g; 0.367 g 1.10 mmol) afforded 3r as a red
solid (0.378 g, 0.964 mmol, 96%, E/Z >98:2); 1H NMR (250 MHz, CDCl3):
d ˆ 2.04, 2.14, 2.24, 2.37, 2.41 (5s, 5  3H; ArCH3), 6.46 (s, 1H; Ar), 6.77 (d,
Chem. Eur. J. 2003, 9, 3951 3964
www.chemeurj.org
¹ 2003 Wiley-VCH Verlag GmbH & Co.KGaA, Weinheim
3959

P.Langer et al.
FULL PAPER
J ˆ 7.9 Hz, 1H; Ar), 6.90 (s, 1H; Ar), 6.99 7.10 (m, 3H; Ar, NH), 7.31 (d,
J ˆ 8.1 Hz, AA', 2H; Ar), 7.57 ppm (d, J ˆ 8.2 Hz, XX', 2H; Ar); 13C NMR
(50.3 MHz, CDCl3): d ˆ 15.65, 18.00, 20.82, 20.96, 21.29 (ArCH3), 85.73 (C-
CN), 116.93 (CH), 118.35, 119.10, 119.39 (C), 123.99, 126.81 (CH), 127.28
(C), 128.22, 130.23 (CH), 130.55, 131.11 (C), 131.36 (CH), 133.99 (C),
134.96 (CH), 138.45, 144.11, 146.52, 147.36, 156.15 ppm (C); IR (KBr): nÄ ˆ
analysis calcd (%) for C25H17N3O (375.4): C 79.98, H 4.56; found: C
79.78, H 4.79.
12-Cyano-8-methyl-11-(3-tolylimino)-5,11-dihydroindolo[1,2-b]isoquino-
lin-5-one (5c) and 12-cyano-10-methyl-11-(3-tolylimino)-5,11-dihydroin-
dolo[1,2-b]isoquinolin-5-one (5d): The reaction (procedure 3) of methyl
2-(cyanomethyl)benzoate (4; 0.088 g, 0.50 mmol) and oxalic acid bis(3-
tolylimidoyl)chloride (2c; 0.168 g, 0.55 mmol) afforded the regioisomers
5c/5d as a yellow solid (104 mg, 55%).The product was obtained as an
inseparable 2.4:1 mixture of 5c (73 mg, 39%) and 5d (31 mg, 16%).The
regioisomeric ratio was determined by integration of the 1H NMR
spectrum (characteristic singlet of the proton at C-7).Spectroscopic data:
5c: 1H NMR (250 MHz, CDCl3): d ˆ 2.40 (s, 6H; Me), 6.83 (s, 1H; Ar,
C-2'), 6.87 (d, J ˆ 7.9 Hz, 2H; Ar), 6.98 (d, J ˆ 7.5 Hz, 1H; Ar), 7.06 (d, J ˆ
7.5 Hz, 1H; Ar), 7.33 (t, J ˆ 7.7 Hz, 1H; Ar), 7.67 (t, J ˆ 7.3 Hz, 1H; Ar), 7.84
(t, J ˆ 7.2 Hz, 1H; Ar), 8.09 (d, J ˆ 8.0 Hz, 1H; Ar), 8.48 (d, J ˆ 7.9 Hz, 1H;
Ar), 8.56 ppm (s, 1H; Ar, C7); 13C NMR (50.3 MHz, CDCl3): d ˆ 21.47
(CH3), 22.36 (CH3), 89.55 (C-CN), 113.75 (CN), 114.93 (CH), 117.77 (C),
118.57, 118.79, 125.87, 125.89, 125.90 (CH), 126.93 (C), 127.05, 128.52,
129.27, 129.65 (CH), 132.93 (C), 134.03 (CH), 137.74, 139.46, 144.65, 145.38,
ꢁ
3024 (w), 3010 (w), 2971 (w), 2944 (m), 2919 (m), 2861 (w), 2195 (m, C N),
1675 (m), 1646 (s), 1615 (s), 1583 (s), 1521 (m), 1510 (s), 1481 (s), 1448 (m),
1376 (m), 1329 (s), 1312 (m), 1225 (m), 1203 (s), 1120 (w), 1019 (w), 818 (m),
795 (w), 771 cmÀ1 (w); UV/Vis (CH3CN): lmax (lg e) ˆ 481.3 nm (3.92), 284.5
‡
(4.28), 235.1 (4.24); MS (EI, 70 eV): m/z (%): 391 ([M] , 56), 390 ([M À
‡
H] , 100), 376 (58).
(E)-2-{1-Cyano-1-[2-(N-methyl)pyrrolyl]methylidene}-7-methyl-3-(2-tolyl)-
imino-2,3-dihydro-1H-indole (3w): The reaction (procedure 2) of 2-(N-
methyl)pyrrolylacetonitrile (1m; 0.121 g, 1.00 mmol) and oxalic acid bis(2-
tolylimidoyl) dichloride (2a; 0.305 g, 1.00 mmol) afforded 3w as an orange
solid (0.042 g, 0.119 mmol, 12%, E/Z >98:2); 1H NMR (250 MHz, CDCl3):
d ˆ 2.19 (s, 3H; ArCH3), 2.25 (s, 3H; ArCH3), 3.83 (s, 3H; NCH3), 6.27
6.30 (m, 1H; Ar), 6.40 6.42 (m, 1H; Ar), 6.50 6.61 (m, 2H; Ar), 6.89 (d,
J ˆ 7.8 Hz, 1H; Ar), 7.06 7.36 ppm (m, 6H; Ar, NH); 13C NMR (50.3 MHz,
CDCl3): d ˆ 15.71 (ArCH3), 17.86 (ArCH3), 35.19 (NCH3), 77.34 (C-CN),
108.76, 110.44, 117.02 (CH), 117.68, 118.30, 119.43 (C), 121.19, 123.94 (CH),
124.07 (C), 124.49, 124.90, 126.47 (CH), 127.02 (C), 130.71, 134.15 (CH),
145.73, 148.06, 149.19, 156.02 ppm (C); IR (KBr): nÄ ˆ 3061 (w, Ar-H), 3012
149.96, 153.29 (C), 158.74 ppm (C O). 5d: 1H NMR (250 MHz, CDCl3):
ˆ
d ˆ 2.37 (s, 6H; Me), 6.73 (d, 1H; Ar), 6.78 (d, 1H; Ar), 6.82 (s, 1H; Ar,
C-2'), 6.87 (d, J ˆ 7.9 Hz, 2H; Ar), 7.43 (t, J ˆ 7.9 Hz, 1H; Ar), 7.67 (t, J ˆ
7.3 Hz, 1H; Ar), 7.84 (t, J ˆ 7.2 Hz, 1H; Ar), 8.07 (t, J ˆ 8.0 Hz, 1H; Ar),
8.48 (d, J ˆ 7.9 Hz, 1H; Ar), 8.68 ppm (d, J ˆ 8.2 Hz, 1H; Ar); 13C NMR
(50.3 MHz, CDCl3): d ˆ 21.41 (CH3), 22.36 (CH3), 89.55 (C-CN), 113.75
(CN), 115.35, 116.30 (CH), 117.77 (C), 120.23, 125.76, 125.81 (CH), 126.71
(C), 128.49, 128.77, 129.39, 129.98 (CH), 133.02 (C), 133.50, 133.95 (CH),
À
ꢁ
(w), 2952(s), 2923 (s, C H), 2853 (s), 2195 (m, C N), 1644 (m), 1618 (m),
1587 (s), 1492 (m), 1458 (m), 1339 (s), 1218 (s), 1181 (m), 1109 (w), 1040
(w), 794 (w), 746 cmÀ1 (m); UV/Vis (CHCl3): lmax (lg e) ˆ 483.4 nm (3.78),
ˆ
‡
137.74, 138.90, 142.51, 144.65, 150.26, 152.10 (C), 158.74 ppm (C O). 5c/5d:
276.4 (4.13), 254.4 (4.00); MS (EI, 70 eV): m/z (%): 352 ([M] , 100), 296
ꢁ
IR (KBr): nÄ ˆ 3062 (m, Ar-H), 2922 (w), 2221 (m, C N), 1682 (s), 1654 (s),
‡
(4); the exact molecular mass for C23H20N4 m/z: 352.1688 Æ 2 mD ([M] )
1598 (s), 1479 (m), 1450 (m), 1367 (s), 1308 (s), 1254 (m), 1141 (m), 788 (m),
772 (m), 760 (m), 705 (m), 690 cmÀ1 (m); UV/Vis (CHCl3): lmax (lg e) ˆ
419.9 nm (4.02), 403.4 (3.99), 323.9 (4.03); MS (ESI): m/z (%): 1523
was confirmed by HRMS (EI, 70 eV).
12-Cyano-11-phenylimino-5,11-dihydroindolo[1,2-b]isoquinolin-5-one
(5a): The reaction (procedure 3) of methyl 2-(cyanomethyl)benzoate (4;
0.088 g, 0.50 mmol) and oxalic acid bis(phenylimidoyl) dichloride (2b;
0.153 g, 0.55 mmol) afforded 5a as a yellow solid (144 mg, 83%). 1H NMR
(250 MHz, CDCl3): d ˆ 6.94 (d, J ˆ 7.8 Hz, 1H; Ar), 7.06 (m, 3H; Ar), 7.28
(m, 1H; Ar), 7.47 (dd, J ˆ 8.0 Hz, J ˆ 7.3 Hz, 2H; Ar), 7.56 (dd, J ˆ 7.1 Hz,
J ˆ 1.4 Hz, 1H; Ar), 7.72 (td, J ˆ 8.0 Hz, J ˆ 1.1 Hz, 1H; Ar), 7.88 (td, J ˆ
8.2 Hz, J ˆ 1.4 Hz, 1H; Ar), 8.16 (d, J ˆ 8.7 Hz, 1H; Ar), 8.56 (dd, J ˆ
8.0 Hz, J ˆ 0.9 Hz, 1H; Ar), 8.79 ppm (d, J ˆ 8.2 Hz, 1H; Ar); 13C NMR
(75.5 MHz, CDCl3, Tˆ 508C): d ˆ 84.80 (C-CN), 118.10, 118.31 (CH),
120.28 (C), 125.39, 126.17, 126.20, 126.24 (CH), 127.30 (C), 128.73, 129.59
(CH), 129.68 (C), 129.83 (CH), 133.18 (C), 133.95, 134.14 (CH), 140.85,
‡
‡
‡
([4M‡Na] , 5), 1148 ([3M‡Na] , 55), 773 ([2M‡Na] , 98), 398
‡
([M‡Na] , 100).
12-Cyano-9-methyl-11-(4-tolylimino)-5,11-dihydroindolo-[1,2-b]isoquino-
lin-5-one (5e): The reaction (procedure 3) of methyl 2-(cyanomethyl)ben-
zoate (4; 0.104 g, 0.59 mmol) and oxalic acid bis(4-tolylimidoyl) dichloride
(2 f; 0.217 g, 0.71 mmol) afforded 5e as a red solid (190 mg, 85%). 1H NMR
(300 MHz, CDCl3): d ˆ 2.17 (s, 3H; Me), 2.44 (s, 3H; Me), 6.90 (dd, 4J ˆ
1.5 Hz, 5J ˆ 0.6 Hz, 1H; Ar, C-10), 6.98 (d, 3J ˆ 8.2 Hz, AA'XX', 2H; Ar,
C-3', C-5'), 7.25 (d, 3J ˆ 8.0 Hz, AA'XX', 2H; Ar, C-2', C-6'), 7.30 (dd, 3J ˆ
8.0 Hz, 4J ˆ 1.3 Hz, 1H; Ar, C-8), 7.65 (ddd, 3J ˆ 8.2 Hz, 3J ˆ 7.2 Hz, 4J ˆ
1.1 Hz, 1H; Ar, C-3), 7.83 (ddd, 3J ˆ 7.3 Hz, 3J ˆ 7.2 Hz, 4J ˆ 1.5 Hz, 1H; Ar,
C-2), 8.12 (ddd, 3J ˆ 7.6 Hz, 4J ˆ 1.0 Hz, 5J ˆ 0.6 Hz, 1H; Ar, C-1), 8.51
(ddd, 3J ˆ 7.9 Hz, 4J ˆ 1.4 Hz, 5J ˆ 0.6 Hz, 1H; Ar, C-4), 8.63 ppm (d, 3J ˆ
8.4 Hz, 1H; Ar, C-7); 13C NMR (50.3 MHz, CDCl3): d ˆ 21.08 (C9-CH3),
21.22 (C4'-CH3), 89.10 (C12-CN), 113.86 (CN), 117.86 (C-7), 118.44 (C-2'
and C-6'), 120.40 (C-10a), 126.02 (C-1), 126.27 (C-10), 127.13 (C-4a), 128.57
(C-4), 129.60 (C-3), 129.97 (C-3' and C-5'), 133.20 (C-12a), 133.96 (C-2),
134.47 (C-8), 134.50 (C-11), 135.30 (C-4'), 136.18 (C-9), 142.53 (C-6a),
ˆ
144.69, 150.01, 153.75 (C), 158.86 ppm (C O); IR (KBr): nÄ ˆ 3071 (m, Ar-
ꢁ
H), 2219 (m, C N), 1669 (s), 1659 (s), 1603 (m), 1596 (s), 1487 (m), 1457 (s),
1401 (m), 1366 (s), 1336 (m), 1233 (m), 1127 (m), 779 (s), 757 (s), 719 (m),
704 cmÀ1 (s); UV/Vis (CHCl3): lmax (lg e) ˆ 422.6 nm (4.04), 403.2 (4.00),
‡
322.8 (3.93); MS (EI, 70 eV): m/z (%): 347 ([M] , 100), 318 (4).
12-Cyano-7-methyl-11-(2-tolylimino)-5,11-dihydroindolo[1,2-b]isoquino-
lin-5-one (5b): The reaction (procedure 3) of methyl 2-(cyanomethyl)ben-
zoate (4; 0.088 g, 0.50 mmol) and oxalic acid bis(2-tolylimidoyl) dichloride
(2a; 0.168 g, 0.55 mmol) afforded 5b as an orange solid (93 mg, 50%).
1H NMR (500 MHz, CDCl3): d ˆ 2.21 (s, 3H; CH3, C-2'), 2.60 (s, 3H; CH3,
C-7), 6.81 (d, J ˆ 7.8 Hz, 1H; Ar, C-10), 6.88 (dd, J ˆ 7.8 Hz, J ˆ 1.1 Hz, 1H;
Ar, C-6'), 6.96 (dd, J ˆ 7.8 Hz, J ˆ 7.6 Hz, 1H; Ar, C-9), 7.15 (td, J ˆ 7.5 Hz,
J ˆ 1.3 Hz, 1H; Ar, C-4'), 7.23 (td, J ˆ 7.7 Hz, J ˆ 0.8 Hz, 1H; Ar, C-5'), 7.31
(d, J ˆ 7.5 Hz, 1H; Ar, C-3'), 7.34 (d, J ˆ 7.5 Hz, 1H; Ar, C-8), 7.67 (td, J ˆ
7.9 Hz, J ˆ 1.1 Hz, 1H; Ar, C-3), 7.85 (td, J ˆ 8.0 Hz, J ˆ 1.4 Hz, 1H; Ar,
C-2), 8.10 (dd, J ˆ 8.0 Hz, J ˆ 1.1 Hz, 1H; Ar, C-1), 8.46 ppm (dd, J ˆ
8.0 Hz, J ˆ 1.4 Hz, 1H; Ar, C-4); 13C NMR (50.3 MHz, CDCl3): d ˆ 17.96
(C2'-CH3), 23.34 (C7-CH3), 89.80 (C-12-CN), 114.10 (C ˆ N), 116.67 (C-
10), 122.45 (C-10a), 123.25 (C-10), 125.27 (C-4'), 125.61 (C-1), 126.69 (C-
9&C-5'), 126.98 (C-2'), 127.87 (C-4a), 128.68 (C-4), 129.00 (C-7), 129.59 (C-
3), 131.02 (C-3'), 133.06 (C-12a), 133.88 (C-2), 137.78 (C-8), 143.28 (C-6a),
ˆ
147.24 (C-1'), 153.10 (C-11a), 158.68 ppm (C O); IR (KBr): nÄ ˆ 3065 (w,
ꢁ
Ar-H), 3029 (w), 2977 (w), 2923 (m), 2225 (m, C N), 1677 (s), 1650 (s), 1618
(m), 1600 (m), 1502 (m), 1478 (s), 1458 (m), 1356 (m), 1334 (s), 1301 (m),
1236 (m), 1213 (m), 1171 (m), 842 (m), 822 (m), 773 (m), 763 (m), 689 cmÀ1
(m); UV/Vis (CHCl3): lmax (lg e) ˆ 430.5 nm (4.01), 336.9 (4.02), 324.8
‡
(4.02); MS (EI, 70 eV): m/z (%): 375 ([M] , 100), 362 (15), 268 (60).
12-Cyano-8,10-dimethyl-11-(3,5-dimethylphenylimino)-5,11-dihydroindo-
lo-[1,2-b]isoquinolin-5-one (5 f): The reaction (procedure 3) of methyl
2-(cyanomethyl)benzoate (4; 0.189 g, 1.08 mmol) and oxalic acid bis(3,5-
dimethylphenylimidoyl)chloride (2g; 0.431 g, 1.29 mmol) afforded 5 f as a
red solid (418 mg, 96%). 1H NMR (250 MHz, CDCl3): d ˆ 2.14 (s, 3H; Me),
2.23 (s, 3H; Me), 2.39 (s, 3H; Me), 2.59 (s, 3H; Me), 6.79, 6.83 (2s, 2 Â 1H;
Ar, C-2' ‡ C-6'), 7.03 (s, 1H; Ar, C-7), 7.15 (s, 1H; Ar, C-9), 7.17 (s, 1H; Ar,
C-4'), 7.66 (t, 3J ˆ 7.9 Hz, 1H; Ar, C-3), 7.84 (td, 3J ˆ 8.1 Hz, 4J ˆ 1.1 Hz, 1H;
3
3
ˆ
143.49 (C-11), 148.49 (C-1'), 153.36 (C-11a), 158.40 ppm (C O); IR (KBr):
Ar, C-2), 8.10 (d, J ˆ 8.1 Hz, 1H; Ar, C-1), 8.46 ppm (d, J ˆ 8.4 Hz, 1H;
Ar, C-4); 13C NMR (75.5 MHz, CDCl3): d ˆ 18.02 (CH3), 20.89 (CH3), 21.04
(CH3), 23.28 (CH3), 89.37 (C12-CN), 114.34 (CN), 116.75 (C-2'), 122.73 (C),
123.50 (C-6'), 125.58 (C-1), 126.98 (C-7), 127.70 (C), 127.87 (C-4a), 128.55
(C),128.65 (C-4), 129.40 (C-3), 131.69 (C-9), 133.24 (C-12a), 133.76 (C-2),
135.16, 136.53 (C), 138.40 (C-4'), 141.44 (C), 144.05 (C-10a), 145.80, 153.03
ꢁ
nÄ ˆ 3062 (w), 2959 (w), 2921 (m), 2850 (w), 2217 (m, C N), 1684 (s), 1653
(s), 1635 (s), 1616 (s), 1602 (m), 1576 (m), 1559 (m), 1539 (m), 1481 (s), 1457
(m), 1436 (m), 1354 (m), 1310 (s), 1275 (m), 1241 (m), 1107 (m), 798 (m),
764 (m), 748 cmÀ1 (s); UV/Vis (CHCl3): lmax (lg e) ˆ 426.0 nm (4.02), 408.5
‡
(4.05), 326.6 (3.99); MS (ESI): m/z (%): 1147 ([3M‡Na] , 70), 773
‡
‡
‡
([2M‡Na] , 100), 398 ([M‡Na] , 50), 376 ([M‡H] , 6); elemental
ˆ
(C), 158.42 ppm (C O); IR (KBr): nÄ ˆ 3065 (m, Ar-H), 3013 (w), 2971 (w),
3960
¹ 2003 Wiley-VCH Verlag GmbH & Co.KGaA, Weinheim www.chemeurj.org Chem. Eur. J. 2003, 9, 3951 3964

Functionalized 2-Alkylidene-3-iminoindoles
3951 3964
ꢁ
2922 (m), 2218 (m, C N), 1688 (s), 1651 (s), 1606 (s), 1490 (s), 1477 (s), 1457
(m), 1378 (m), 1353 (m), 1330 (s), 1310 (s), 1279 (s), 1177 (s), 772 (m), 762
1.1 Hz, 1H; Ar, C-4); 13C NMR (50.3 MHz, CDCl3): d ˆ 22.04 (ArCH3),
91.74 (C-CN), 112.29 (C), 122.26 (CH), 124.95 (C), 125.64, 127.04, 128.29
(CH), 128.40, 128.80 (C), 130.87 (CH), 131.19 (C), 134.03 (CH), 139.14 (C),
(m), 687 cmÀ1 (m); UV/Vis (CHCl3): lmax (lg e) ˆ 418.0 nm (3.80), 325.6
‡
(3.98); MS (EI, 70 eV): m/z (%): 403 ([M] , 100), 388 (40), 376 (4); the
ˆ
ˆ
140.94 (CH), 145.69 (C), 156.89 (C5 O), 180.60 ppm (C11 O); IR (KBr):
‡
exact molecular mass for C27H21N3O m/z: 403.1685 Æ 2 mD ([M] ) was
ꢁ
nÄ ˆ 3068 (w), 3035 (w), 2963 (w), 2936 (w), 2228 (w, C N), 1716 (s), 1690 (s),
confirmed by HRMS (EI, 70 eV).
1631 (m), 1598 (m), 1588 (m), 1482 (m), 1455 (m), 1351 (m), 1323 (m), 1305
(s), 1280 (m), 1252 (m), 1246 (m), 1148 (m), 1097 (m), 1065 (m), 1036 (m),
1021 (m), 802 (m), 757 cmÀ1 (m); Fluorescence (CH3CN) Ex (Flmax): 335
(539.04) nm; UV/Vis (CH3CN): lmax (lg e) ˆ 422.5 nm (3.80), 332.1 (3.86),
12-Cyano-9-methoxy-11-(4-methoxyphenylimino)-5,11-dihydroindolo-
[1,2-b]isoquinolin-5-one (5g): The reaction (procedure 3) of methyl
2-(cyanomethyl)benzoate (4; 0.088 g, 0.50 mmol) and oxalic acid bis(4-
methoyxphenylimidoyl) dichloride (2h; 0.202 g, 0.60 mmol) afforded 5g as
a red solid (178 mg, 87%). 1H NMR (250 MHz, CDCl3): d ˆ 3.60 (s, 3H;
OCH3), 3.87 (s, 3H; OCH3), 6.76 (d, J ˆ 2.7 Hz, 1H; Ar), 7.00 7.08 (m, 3H;
Ar), 7.10 7.15 (m, 2H; Ar), 7.68 (td, J ˆ 8.2 Hz, J ˆ 1.1 Hz, 1H; Ar), 7.85
(td, J ˆ 7.9 Hz, J ˆ 1.4 Hz, 1H; Ar), 8.11 (d, J ˆ 7.9 Hz, 1H; Ar), 8.52 (dd,
J ˆ 8.0 Hz, J ˆ 1.2 Hz, 1H; Ar), 8.67 ppm (d, J ˆ 8.9 Hz, 1H; Ar); 13C NMR
(75.5 MHz, CDCl3, Tˆ 508C): d ˆ 55.57 (OCH3), 55.71 (OCH3), 89.45 (C-
CN), 110.48 (CH), 113.93 (C), 114.84, 119.09, 119.55, 120.58 (CH), 121.39
(C), 126.04 (CH), 127.20 (C), 128.54, 129.56 (CH), 133.27 (C), 133.86 (CH),
138.50, 142.75, 142.78, 153.09, 157.68, 158.28, 158.50 ppm (C); IR (KBr):
‡
293.2 (3.66); MS (EI, 70 eV): m/z (%): 286 ([M] , 100), 257 (8), 229 (11),
203 (4); the exact molecular mass for C18H10N2O2 m/z: 286.0742 Æ 2 mD
‡
([M] ) was confirmed by HRMS (EI, 70 eV).
12-Cyano-9-methyl-5,11-dihydroindolo[1,2-b]isoquinolin-5,11-dione (6e):
Starting with 5e (30.0 mg, 80.0 mmol) (procedure 4), 6e was obtained as a
yellow solid (22 mg, 0.075 mmol, 94%). Procedure 5: 100% yield. 1H NMR
3
(250 MHz, CDCl3): d ˆ 7.57 (d, J ˆ 8.3 Hz, 1H; Ar, C-8), 7.72 (s, 1H; Ar,
3
3
C-10), 7.77 (t, J ˆ 7.4 Hz, 1H; Ar, C-3), 7.89 (t, J ˆ 7.5 Hz, 1H; Ar, C-2),
8.12 (d, 3J ˆ 7.7 Hz, 1H; Ar, C-1), 8.53 (d, 3J ˆ 7.7 Hz, 1H; Ar, C-4),
8.55 ppm (d, J ˆ 8.3 Hz, 1H; Ar, C-7); 13C NMR (50.3 MHz, CDCl3): d ˆ
3
ꢁ
nÄ ˆ 2960 (w), 2220 (m, C N), 1674 (s), 1649 (s), 1604 (s), 1586 (s), 1502 (s),
21.03 (C9-CH3), 93.12 (C12-CN), 112.32 (CN), 117.98 (C-7), 123.27 (C-10a),
125.60 (C-10), 127.26 (C-1), 128.81 (C-4a), 129.00 (C-4), 131.44 (C-3), 131.88
(C-12a), 134.35 (C-2), 137.58 (C-9), 138.49 (C-8), 145.09 (C-6a), 157.87
1477 (s), 1433 (s), 1302 (s), 1260 (m), 1247 (s), 1210 (m), 1168 (m), 1026 (m),
848 (m), 770 (m), 759 (w), 734 (w), 688 cmÀ1 (m); UV/Vis (CHCl3): lmax (lg
e) ˆ 456.8 nm (3.89), 341.5 (4.03), 267.1 (4.56); MS (ESI) m/z (%): 1244
ˆ
ˆ
(C5 O), 180.64 ppm (C11 O); IR (KBr): nÄ ˆ 3069 (w), 3037 (w), 2957 (w),
‡
‡
‡
‡
([3M‡Na] , 30), 837 ([2M‡Na] , 100), 430 ([M‡Na] , 30), 408 ([M‡H] ,
ꢁ
2923 (m), 2225 (m, C N), 1719 (s), 1670 (s), 1634 (m), 1614 (m), 1600 (s),
16).
1484 (s), 1457 (m), 1352 (s), 1335 (s), 1299 (s), 1230 (m), 1168 (m), 1111 (m),
1127 (m), 1081 (m), 838 (m), 766 (s), 688 cmÀ1 (m); fluorescence (CH3CN)
Ex (Flmax): 285 (467.62), 395 (546.53) nm; UV/Vis (CH3CN): lmax (lg e) ˆ
425.9 nm (3.57), 360.3 (3.62), 344.0 (3.65); MS (EI, 70 eV): m/z (%): 286
Procedure
4 (synthesis of heterocycles 6 by reflux): A solution of
indolo[1,2-b]isoquinolin-5-one (5b; 129 mg, 0.34 mmol) in DMSO
(20 mL) was stirred at 1808C and the reaction was monitored by TLC.
The color of the reaction mixture turned from red to black.After
disappearance of the starting material (ca.16 h) the solvent was removed in
vacuo by bulb-to-bulb-distillation.Chromatographic purification (silica
gel, CH2Cl2) afforded 6b as a yellow solid (48 mg, 0.17 mmol, 48%).
Spectroscopic data: see below.
‡
([M] , 100), 257 (8), 229 (4).
8,10-Dimethyl-12-cyano-5,11-dihydroindolo[1,2-b]isoquinolin-5,11-dione
(6 f): Starting with 5 f (397 mg, 0.98 mmol) (procedure 4), 6 f was obtained
as a yellow solid (142 mg, 0.47 mmol, 48%). Procedure 5: 84% yield.
1H NMR (300 MHz, [D6]DMSO, Tˆ 1008C): d ˆ 2.38 (s, 3H; ArCH3), 2.62
(s, 3H; ArCH3), 7.50 (d, 4J ˆ 0.8 Hz, 1H; Ar, C-7), 7.54 (d, 4J ˆ 0.8 Hz, 1H;
Procedure 5 (synthesis of heterocycles 6 by treatment of 5 with HCl: A
solution of 5e (109 mg, 0.29 mmol) in THF (20 mL) was treated with an
aqueous solution of HCl (10%, 20 mL) and the solution was stirred at 208C
for 3 5 days (TLC monitoring).After disappearance of the starting
material, an aqueous solution of NaHCO3 was added to the solution.The
aqueous layer was extracted with diethyl ether and CH2Cl2.The combined
organic layers were dried (MgSO4), filtered, and concentrated to give 6e as
a yellow solid (83 mg, 0.29 mmol, 100%). Spectroscopic data: see below.
3
Ar, C-9), 7.82 (m, 1H; Ar, C-3), 7.97 (t, d, J ˆ 7.9 Hz, 2H; Ar, C-3, C-1),
8.38 ppm (ddd, 3J ˆ 7.9 Hz, 4J ˆ 1.2 Hz, 5J ˆ 0.7 Hz, 1H; Ar, C-4); 13C NMR
(75.5 MHz, [D6]DMSO, Tˆ 1008C): d ˆ 81.20 (C-CN), 108.15 (C), 112.38
(CN), 122.32 (CH), 125.14 (C), 125.63 (CH), 128.04 (C), 128.29 (CH),
128.86 (C), 130.83, 133.98 (CH), 137.02, 139.39 (C), 141.57 (CH), 143.94 (C),
ˆ
ˆ
156.79 (C5 O), 168.80 ppm (C11 O); IR (KBr): nÄ ˆ 3074 (w), 3046 (w),
ꢁ
3017 (w), 2962 (w), 2923 (w), 2222 (w, C N), 1716 (s), 1692 (s), 1681 (s),
1597 (s), 1481 (s), 1348 (s), 1324 (s), 1303 (s), 1297 (s), 1169 (s), 1099 (m),
1041 (m), 1029 (m), 988 (m), 967 (m), 803 (m), 794 (m), 765 cmÀ1 (s); MS
(EI, 70 eV): m/z (%): 300 ([M] , 100), 285 (8), 243 (4); the exact molecular
12-Cyano-5,11-dihydroindolo[1,2-b]isoquinolin-5,11-dione (6a): Starting
with 5a (38 mg, 0.11 mmol) (procedure 4), 6a was obtained as a yellow
solid (25 mg, 0.092 mmol, 84%). Procedure 5: 95% yield. 1H NMR
‡
‡
3
mass for C19H12N2O2 m/z: 300.0899 Æ 2 mD ([M] ) was confirmed by
(300 MHz, [D6]DMSO): d ˆ 7.48 (t, J ˆ 7.0 Hz, 1H; Ar), 7.84 7.93 (3  t,
3J ˆ 7.6 Hz, J ˆ 8.6 Hz, J ˆ 7.4 Hz, 3H; Ar), 8.00 (d, J ˆ 7.4 Hz, 2H; Ar),
3
3
3
HRMS (EI, 70 eV).
8.41 (d, J ˆ 7.7 Hz, 1H; Ar), 8.55 ppm (d, J ˆ 8.7 Hz, 1H; Ar); 13C NMR
(50.3 MHz, [D6]DMSO): d ˆ 91.11 (C12-CN), 112.84 (CN), 117.51 (CH),
123.17 (C), 125.12, 126.50, 127.11 (CH), 128.15 (C), 128.48, 131.45 (CH),
3
3
9-Methoxy-12-cyano-5,11-dihydroindolo[1,2-b]isoquinolin-5,11-dione (6g):
Starting with 5g (26 mg, 0.064 mmol) (procedure 4), 6g was obtained as
an orange solid (13 mg, 0.043 mmol, 67%). Procedure 5: 90% yield.
1H NMR (250 MHz, CDCl3): d ˆ 3.89 (s, 3H; OCH3), 7.27 (dd, 3J ˆ 8.9 Hz,
4J ˆ 2.7 Hz, 1H; Ar, C-8), 7.27 (d, 4J ˆ 2.6 Hz, 1H; Ar, C-10), 7.76 (ddd,
3J ˆ 7.9 Hz, 3J ˆ 7.4 Hz, 4J ˆ 1.2 Hz, 1H; Ar, C-2), 7.88 (ddd, 3J ˆ 7.8 Hz,
3J ˆ 7.4 Hz, 4J ˆ 1.5 Hz, 1H; Ar, C-3), 8.10 (dd, 3J ˆ 7.5 Hz, 5J ˆ 0.7 Hz, 1H;
Ar, C-7), 8.51 (dd, 3J ˆ 8.0 Hz, 4J ˆ 1.5 Hz, 1H; Ar, C-1), 8.55 ppm (d, 3J ˆ
ˆ
131.64 (C), 134.85, 137.69 (CH), 138.70, 146.78 (C), 157.68 (C5 O),
ˆ
180.92 ppm (C11 O); IR (KBr): nÄ ˆ 3073 (w), 3035 (w), 2960 (w), 2925
ꢁ
(m), 2228 (m, C N), 1713 (s), 1687 (s), 1629 (m), 1599 (s), 1559 (m), 1472
(s), 1460 (s), 1359 (s), 1337 (s), 1327 (s), 1309 (s), 1291 (m), 1196 (m), 1112
(s), 1075 (m), 977 (m), 768 (m), 755 (s), 699 cmÀ1 (m); fluorescence
(CH3CN) Ex (Flmax): 350 (510.52), 400 (507.14) nm; UV/Vis (CH3CN): lmax
(lg e) ˆ 419.4 nm (3.87), 354.3 (3.78), 328.0 (3.82); MS (EI, 70 eV): m/z (%):
5
7.9 Hz, J ˆ 1.0 Hz, 1H; Ar, C-4); 13C NMR (75.5 MHz, CDCl3): d ˆ 56.08
(C9-OCH3), 93.43 (C12-CN), 108.39 (CH), 112.21 (CN), 117.80 (C), 119.42
‡
272 ([M] , 100), 244 (8), 215 (10), 189 (4); the exact molecular mass for
(CH), 124.47 (C), 124.69, 127.36, 129.01 (CH), 129.09 (C), 131.45 (CH),
‡
C17H8N2O2 m/z: 272.0586 Æ 2 mD ([M] ) was confirmed by HRMS (EI,
ˆ
132.02 (C), 134.24 (CH), 141.32, 157.55 (C), 159.01 (C5 O), 180.45 ppm
70 eV); elemental analysis calcd (%) for C17H8N2O2 (272.3): C 75.00, H
2.96; found: C 75.30, H 3.24.
ˆ
(C11 O); IR (KBr): nÄ ˆ 3073 (w), 3040 (w), 3002 (w), 2939 (w), 2228 (w,
ꢁ
C N), 1718 (s), 1671 (s), 1630 (m), 1604 (m), 1486 (s), 1439 (m), 1344 (s),
1290 (m), 1262 (m), 1238 (m), 1199 (m), 1127 (m), 1083 (m), 1028 (m), 835
(w), 802 (w), 769 cmÀ1 (m); fluorescence (CH3CN) Ex (Flmax): 285
(454.96) nm; UV/Vis (CH3CN): lmax (lg e) ˆ 449.0 nm (3.57), 372.9 (3.92),
Synthesis of 6a from 3 f: Starting with 3 f (54 mg, 0.15 mmol) (procedure 4),
6a was obtained as a yellow solid (40 mg, 0.15 mmol, 94%). Spectroscopic
data: see above.
‡
356.0 (3.94); MS (EI, 70 eV): m/z (%): 302 ([M] , 100), 287 (52), 259 (12),
7-Methyl-12-cyano-5,11-dihydroindolo[1,2-b]isoquinolin-5,11-dione (6b):
Starting with 3g (93 mg, 0.25 mmol) (procedure 4), 6b was obtained as a
yellow solid (40 mg, 0.14 mmol, 56%). Procedure 5: 82% yield. H NMR
231 (10), 203 (6); the exact molecular mass for C18H10N2O3 m/z: 302.0691 Æ
‡
2 mD ([M] ) was confirmed by HRMS (EI, 70 eV).
1
(300 MHz, [D6]DMSO, Tˆ 1008C): d ˆ 2.64 (s, 3H; Ar, C7-CH3), 7.40 (t,
3J ˆ 7.5 Hz, 1H; Ar, C-9), 7.67 (dd, 3J ˆ 7.5 Hz, 4J ˆ 0.8 Hz, 1H; Ar, C-8),
7.73 (dd, 3J ˆ 7.5 Hz, 4J ˆ 0.8 Hz, 1H; Ar, C-10), 7.82 (m, 1H; Ar, C-3), 7.97
(td, 3J ˆ 7.9 Hz, 4J ˆ 1.1 Hz, 1H; Ar, C-2), 8.36 ppm (dd, 3J ˆ 7.9 Hz, 4J ˆ
Procedure 6 (synthesis of carbolines 7): A solution of 3s[4a] (321 mg,
1.00 mmol) in DMSO (20 mL) was stirred at 1808C and the reaction was
monitored by TLC.After disappearance of the starting material (ca.48 h)
the solvent was removed in vacuo by bulb-to-bulb-distillation.Chromato-
Chem. Eur. J. 2003, 9, 3951 3964
www.chemeurj.org
¹ 2003 Wiley-VCH Verlag GmbH & Co.KGaA, Weinheim
3961

P.Langer et al.
FULL PAPER
graphic purification (silica gel, CH2Cl2) afforded 7a as a yellow solid
(181 mg, 0.61 mmol, 61%). Spectroscopic data: see below.
7.52 (m, 6H; Ar), 7.55 (s, t, 2H; Ar), 8.12 (s, d, 2H; Ar), 10.35 ppm (br s,
1H; NH); 13C NMR (75.5 MHz, [D6]DMSO): d ˆ 20.29 (ArCH3), 20.55
(ArCH3), 20.90 (ArCH3), 111.05, 120.28 (CH), 121.23 (C), 122.41 (CH),
124.25, 124.48 (C), 126.70, 127.40 (CH), 127.72 (C), 128.32, 128.37, 128.48,
129.94, 130.10 (CH), 130.53, 133.54, 133.89, 137.80, 142.08, 142.18,
144.37 ppm (C); IR (KBr): nÄ ˆ 3049 (m), 3023 (m), 2965 (m), 2917 (m),
2859 (w), 1636 (m), 1612 (w), 1604 (w), 1562 (w), 1492 (s), 1443 (m), 1414
(m), 1329 (m), 1306 (m), 1295 (s), 1255 (m), 1211 (s), 1211 (s), 1136 (w),
1129 (w), 815 (m), 809 (m), 794 (w), 783 cmÀ1 (w); UV/Vis (CH3CN): lmax
(lg e) ˆ 400.7 nm (3.78), 386.4 (3.77), 347.8 (4.27); MS (EI, 70 eV): m/z (%):
5-Phenyl-6H-indolino[3,2-b]quinoline (7a): Starting with 3s (321 mg,
1.00 mmol) (procedure 6), 7a was obtained as a yellow solid (181 mg,
0.61 mmol, 61%). 1H NMR (500 MHz, [D6]DMSO): d ˆ 7.28 (td, 3J ˆ
8.0 Hz, 4J ˆ 1.1 Hz, 1H; Ar, C-9), 7.50 (tdd, 3J ˆ 8.0 Hz, 4J ˆ 1.3 Hz, 5J ˆ
3
4
0.6 Hz, 1H; Ar, C-3), 7.54 (dd, J ˆ 8.0 Hz, J ˆ 0.9 Hz, 1H; Ar, C-7), 7.59
3
4
5
(tdd, J ˆ 8.1 Hz, J ˆ 1.2 Hz, J ˆ 0.7 Hz, 1H; Ar, C-8), 7.61 7.71 (m, 6H;
3
4
5
Ar, Ph, C-2), 7.78 (ddd, J ˆ 8.0 Hz, J ˆ 1.4 Hz, J ˆ 0.8 Hz, 1H; Ar, C-4),
3
4
5
3
8.26 (ddd, J ˆ 7.8 Hz, J ˆ 1.2 Hz, J ˆ 0.6 Hz, 1H; Ar, C-1), 8.37 (dd, J ˆ
7.4 Hz, 5J ˆ 0.7 Hz, 1H; Ar, C-10), 10.94 ppm (s, 1H; NH); 13C NMR
(50.3 MHz, [D6]DMSO): d ˆ 111.83, 119.40 (CH), 121.09 (C), 121.22, 124.22
(CH), 124.73 (C), 125.05 (CH), 125.24 (C), 125.81, 128.38, 129.04, 129.14,
129.55, 130.16 (CH), 130.32, 134.00, 143.69, 144.40, 145.45 ppm (C); IR
(KBr): nÄ ˆ 3053 (m), 3021 (w), 2961 (w), 2926 (w), 1632 (m), 1614 (m), 1566
(w), 1489 (s), 1472 (m), 1399 (m), 1382 (m), 1338 (m), 1221 (m), 1052 (s),
1027 (s), 1006 (s), 826 (m), 766 (s), 756 (s), 748 (m), 736 (m), 697 cmÀ1 (m);
fluorescence (CH3CN) Ex (Flmax): 345 (426.20) nm; UV/Vis (CH3CN): lmax
(lg e) ˆ 397.9 nm (3.74), 381.3 (3.69), 340.8 (4.15); UV/Vis (CHCl3): lmax (lg
e) ˆ 396.9 nm (3.54), 380.5 (3.48), 342.7 (3.88); MS (EI, 70 eV): m/z (%):
‡
336 ([M] , 100), 320 (8), 305 (4); the exact molecular mass for C24H20N2
‡
m/z: 336.1626 Æ 2 mD ([M] ) was confirmed by HRMS (EI, 70 eV).
1,3,7,9-Tetramethyl-5-phenyl-6H-indolino[3,2-b]quinoline (7e): Starting
with 3u[4b] (66 mg, 0.18 mmol) (procedure 6), 7e was obtained as a yellow
solid (47 mg, 0.13 mmol, 76%). 1H NMR (250 MHz, CDCl3): d ˆ 2.44 (s,
6H; C3-CH3, C7-CH3), 2.54 (s, 3H; C9-CH3), 3.03 (s, 3H; C1-CH3), 7.18 (s,
1H; Ar, C-8), 7.38 (s, 1H; Ar, C-2), 7.44 (s, 1H; Ar, C-4), 7.46 (br s, 1H;
NH), 7.58 7.70 (m, 5H; Ar, Ph), 8.23 ppm (s, 1H; Ar, C-10); 13C NMR
(50.3 MHz, CDCl3): d ˆ 16.51 (C7-CH3), 18.78 (C1-CH3), 21.19 (C9-CH3),
21.88 (C3-CH3), 119.42 (C-7), 119.47 (C-10), 121.29 (C-4), 122.60 (C-4a),
125.11 (C-5), 128.35 (C-4'), 128.93 (C-2), 129.23 (C-2', C-6'), 129.60 (C-5a),
130.11 (C-3', C-5'), 130.71 (C-9), 131.31 (C-8), 134.42 (C-3), 135.07 (C-1'),
136.75 (C-1), 140.63 (C-6a), 142.25 (C-11a), 144.09 (C-10b), 145.15 ppm (C-
10a); IR (KBr): nÄ ˆ 3055 (w), 3021 (w), 2992 (w), 2964 (m), 2946 (m), 2920
(s), 1734 (w), 1631 (m), 1616 (m), 1600 (m), 1491 (s), 1453 (m), 1399 (m),
1386 (m), 1375 (m), 1362 (m), 1324 (m), 1297 (s), 1199 (s), 1031 (m), 856 (s),
803 (m), 772 (m), 703 cmÀ1 (m); fluorescence (CH3CN) Ex (Flmax): 350
(447.97) nm; UV/Vis (CH3CN): lmax (lg e) ˆ 401.1 nm (3.67), 385.3 (3.69),
‡
‡
294 ([M] , 100), 293 ([M À 1] , 100), 190 (4), 147 (3); the exact molecular
‡
mass for C21H14N2 m/z: 294.1152 Æ 2 mD ([M] ) was confirmed by HRMS
(EI, 70 eV).
Procedure 7 (synthesis of 7a by FVP): Product 7a was prepared from 3s[4a]
by flash-vacuum pyrolysis (FVP).Oven temperature: 550 8C.Vacuum
without N2 flow: 10À4 mbar, vacuum with N2 flow: 10À2 10À3 mbar.
Sublimation temperature: 100 1508C.Sublimation time: 15. h.Educt
input: 430 mg (1.338 mmol). Starting material residue in the sublimation
chamber: 353 mg (1.098 mmol). Starting material quantity in reaction:
77.0 mg (0.240 mmol). Chromatographic purification (silica gel, CH2Cl2)
afforded 7a as a yellow solid (45 mg, 0.15 mmol, 12% yield; 64% yield
related to sublimed starting material, 18% conversion).Spectroscopic
data: see above.
‡
350.2 (4.17); MS (EI, 70 eV): m/z (%): 350 ([M] , 100), 335 (4), 296 (8).
2,4,8,10-Tetramethyl-5-(4-tolyl)-6H-indolino[3,2-b]quinoline (7 f): Starting
with 3r (128 mg, 0.33 mmol) (procedure 6), 7 f was obtained as a yellow
solid (96 mg, 0.26 mmol, 80%). 1H NMR (250 MHz, CDCl3): d ˆ 2.45 (s,
6H; ArCH3), 2.55 (s, 6H; ArCH3), 3.03 (s, 3H; ArCH3), 7.19 (s, 1H; Ar),
7.38 (s, 1H; Ar), 7.44 7.54 (m, 6H; Ar ‡ NH), 8.21 ppm (s, 1H; Ar);
13C NMR (50.3 MHz, CDCl3): d ˆ 16.79 (ArCH3), 19.04 (ArCH3), 21.49
(ArCH3), 21.70 (ArCH3), 22.17 (ArCH3), 119.57 (CH), 119.68 (C), 121.65
(CH), 123.12, 125.54 (C), 129.00 (CH), 129.73 (C), 130.20, 130.26 (CH),
131.09 (C), 131.41 (CH), 132.35, 134.49, 135.79, 137.17, 138.38, 140.86,
142.94, 144.73 ppm (C); IR (KBr): nÄ ˆ 3052 (w), 3014 (w), 2963 (m), 2943
(m), 2917 (s), 2859 (w), 1686 (m), 1517 (s), 1499 (s), 1491 (s), 1468 (m), 1448
(m), 1385 (m), 1374 (m), 1296 (s), 1199 (s), 1035 (w), 856 (m), 827 (m),
801 cmÀ1 (m); fluorescence (CH3CN) Ex (Flmax): 395 (444.19) nm; UV/Vis
(CH3CN): lmax (lg e) ˆ 401.1 nm (3.67), 386.1 (3.67), 350.0 (4.22); MS (EI,
1,7-Dimethyl-5-phenyl-6H-indolino[3,2-b]quinoline (7b): Starting with 3a
(92 mg, 0.26 mmol) (procedure 6), 7b was obtained as a yellow solid
(47 mg, 0.15 mmol, 55%). 1H NMR (300 MHz, [D6]DMSO, Tˆ 608C): d ˆ
2.53 (ArCH3), 2.97 (ArCH3), 7.28 (t, 3J ˆ 7.9 Hz, 1H; Ar), 7.48 (d, 3J ˆ
7.1 Hz, 2H; Ar), 7.57 (d, 3J ˆ 7.9 Hz, 3H; Ar), 7.63 7.72 (m, 4H; Ar), 8.55
(d, 3J ˆ 7.9 Hz, 1H; Ar), 10.93 ppm (s, 1H; Ar); 13C NMR (75.5 MHz,
[D6]DMSO, Tˆ 608C): 17.03 (ArCH3), 18.32 (ArCH3), 117.76 (C), 120.42,
120.49 (CH), 122.04 (C), 123.37 (CH), 125.03 (C), 125.63, 128.94, 129.04,
129.21, 130.05 (CH), 131.34 (C), 132.26 (CH), 132.44, 132.48, 133.15, 138.11,
141.01, 144.40 ppm (C); IR (KBr): nÄ ˆ 3059 (w), 3028 (w), 2971 (w), 2921
(w), 1666 (s), 1644 (m), 1611 (m), 1586 (m), 1524 (s), 1502 (m), 1474 (m),
1457 (s), 1395 (m), 1290 (m), 1252 (m), 1218 (m), 1189 (m), 1159 (m), 1040
(m), 824 (w), 754 (s), 728 (m), 709 cmÀ1 (s); fluorescence (CH3CN) Ex
(Flmax): 340 (428.90) nm; UV/Vis (CH3CN): lmax (lg e) ˆ 398.3 nm (3.38),
‡
70 eV): m/z (%): 364 ([M] , 16), 296 (44), 148 (16), 121 (100); the exact
‡
molecular mass for C24H20N2 m/z: 364.1939 Æ 2 mD ([M] ) was confirmed
by HRMS (EI, 70 eV).
1,7-Dimethyl-5-(4-methoxyphenyl)-6H-indolino[3,2-b]quinoline
(7g):
‡
381.3 (3.33), 343.1 (3.75); MS (ESI): m/z (%): 324 (20), 323 ([M‡H] , 100),
Starting with 3o (55 mg, 0.14 mmol) (procedure 6), 7g was obtained as a
yellow solid (37 mg, 0.10 mmol, 71%). 1H NMR (250 MHz, CDCl3): d ˆ
2.49 (s, 3H; ArCH3), 3.05 (s, 3H; ArCH3), 3.94 (s, 3H; OCH3), 7.16 (d, J ˆ
322 ([M]À, 10), 321 ([M À H]À, 100).
3,9-Dimethyl-5-phenyl-6H-indolino[3,2-b]quinoline (7c): Starting with
3t[4a] (45 mg, 0.13 mmol) (procedure 6), 7c was obtained as a yellow solid
(23 mg, 0.07 mmol, 55%). 1H NMR (250 MHz, [D6]DMSO): d ˆ 2.41 (s,
3H; C3-CH3), 2.49 (s, 3H; C9-CH3), 7.40 (2 d, 2H; Ar, C-1, C-7), 7.49 (d,
3J ˆ 8.6 Hz, 1H; Ar, C-2), 7.51 (s, 1H; Ar, C-10), 7.59 7.63 (m, 3H; Ar, Ph),
3
8.7 Hz, 2H; C-3', C-5', AA' Ar), 7.26 (t, J ˆ 7.5 Hz, 1H; Ar), 7.37 (d, J ˆ
6.7 Hz, 2H; Ar), 7.54 (t, d (XX'), J ˆ 8.6 Hz, 3H; Ar), 7.65 (br, 1H; NH),
3
3
7.74 (d, J ˆ 8.1 Hz, 1H; Ar), 8.42 ppm (d, J ˆ 7.6 Hz, 1H; Ar); 13C NMR
(50.3 MHz, CDCl3): d ˆ 16.56 (ArCH3), 18.84 (ArCH3), 55.40 (OCH3),
114.68, 119.70 (CH), 119.81 (C), 120.15 (CH), 122.63 (C), 122.74, 124.67
(CH), 125.40, 125.89 (C), 126.34 (CH), 126.84 (C), 129.94 (CH), 130.43 (C),
131.26 (CH), 137.32, 142.50, 144.08, 145.17, 159.66 ppm (C); IR (KBr): nÄ ˆ
3065 (w), 3020 (w), 2964 (w), 2941 (w), 2918 (m), 1628 (m), 1606 (m), 1517
(m), 1501 (s), 1474 (m), 1444 (m), 1391 (s), 1366 (m), 1315 (m), 1286 (m),
1242 (s), 1214 (m), 1185 (s), 1067 (m), 1023 (s), 833 (m), 824 (m), 765 (s),
747 cmÀ1 (s); fluorescence (CH3CN) Ex (Flmax): 340 (427.33) nm; UV/Vis
(CH3CN): lmax (lg e) ˆ 399.4 nm (3.77), 382.4 (3.73), 343.4 (4.15); MS (EI,
3
7.66 7.72 (m, 2H; Ar, Ph), 8.12 (d, J ˆ 8.7 Hz, 1H; Ar, C-8), 8.14 (s, 1H;
Ar, C-4), 10.71 ppm (s, 1H; NH); 13C NMR (75.5 MHz, [D6]DMSO): d ˆ
20.85 (ArCH3), 21.47 (ArCH3), 111.48 (C-7), 120.76 (C-4), 121.26 (C-10a),
122.69 (C-10), 124.41 (C), 124.67 (C), 128.00 (C-2), 128.11 (C), 128.24 (C-
4'), 128.88 (C-8), 129.00 (C-3', C-5'), 130.09 (C-2', C-6'), 130.54 (C-1), 130.76
(C-6a), 134.16 (C-5), 142.22 (C), 142.45 (C), 144.58 ppm (C-10b); IR (KBr):
nÄ ˆ 3053 (m), 3021 (w), 2950 (w), 2919 (m), 2857 (w), 1634 (w), 1611 (w),
1565 (w), 1494 (s), 1442 (m), 1415 (m), 1393 (w), 1329 (m), 1307 (m), 1295
(s), 1254 (m), 1217 (s), 1211 (s), 1133 (w), 1015 (w), 837 (w), 819 (m), 813
(m), 697 cmÀ1 (m); fluorescence (CH3CN) Ex (Flmax): 345 (438.68) nm;
UV/Vis (CH3CN): lmax (lg e) ˆ 384.3 nm (3.59), 347.9 (4.09), 280.9 (4.54);
‡
70 eV): m/z (%): 352 ([M] , 100), 307 (6), 176 (4); the exact molecular mass
‡
for C24H20N2O m/z: 352.1576 Æ 2 mD ([M] ) was confirmed by HRMS (EI,
70 eV).
‡
Synthesis of 7g from 10: Starting with 10[4b] (73 mg, 0.16 mmol) (procedure
MS (EI, 70 eV): m/z (%): 322 ([M] , 100), 305 (8), 277 (2).
6), 7g was obtained as
Spectroscopic data: see above.
3,9-Dimethyl-5-(3-methoxyphenyl)-6H-indolino[3,2-b]quinoline
Starting with 3n (113 mg, 0.30 mmol) (procedure 6), 7 h was obtained as
a yellow solid (30 mg, 0.085 mmol, 53%);
3,9-Dimethyl-5-(3-tolyl)-6H-indolino[3,2-b]quinoline (7d): Starting with
3q (131 mg, 0.36 mmol) (procedure 6), 7d was obtained as a yellow solid
(76 mg, 0.23 mmol, 63%). 1H NMR (300 MHz, [D6]DMSO, Tˆ 1008C):
d ˆ 2.41 (s, 3H; ArCH3), 2.45 (s, 3H; ArCH3), 2.49 (s, 3H; ArCH3), 7.34
(7 h):
3962
¹ 2003 Wiley-VCH Verlag GmbH & Co.KGaA, Weinheim
www.chemeurj.org
Chem. Eur. J. 2003, 9, 3951 3964

Functionalized 2-Alkylidene-3-iminoindoles
3951 3964
3
a yellow solid (34 mg, 0.10 mmol, 32%). 1H NMR (250 MHz, CDCl3): d ˆ
2.49 (s, 3H; ArCH3), 2.54 (s, 3H; ArCH3), 3.86 (s, 3H; OCH3), 7.08 (t, 3J ˆ
8.2 Hz, 1H; Ar), 7.10 (t, 3J ˆ 8.1 Hz, 1H; Ar), 7.16 (d, 3J ˆ 7.6 Hz, 1H; Ar),
7.27 (d, 3J ˆ 6.8 Hz, 1H; Ar), 7.36 (dd, 3J ˆ 8.1 Hz, 4J ˆ 1.5 Hz, 1H; Ar), 7.48
2H; Ar), 7.48 7.56 (t, d (AA') ‡ s, 4 H; 3  Ar, NH), 7.63 (d, J ˆ 8.4 Hz,
3
3
1H; Ar), 7.77 (d, J ˆ 8.3 Hz, 2H; XX', Ar), 8.41 ppm (d, J ˆ 7.7 Hz, 1H;
Ar); 13C NMR (50.3 MHz, CDCl3): d ˆ 16.57 (ArCH3), 18.81 (ArCH3),
119.72 (CH), 119.92 (C), 120.39, 122.27 (CH), 122.53, 122.75, 124.53, 124.79
(C), 125.05, 126.50 (CH), 129.99 (C), 130.15, 131.81, 132.52 (CH), 133.82,
137.50, 142.53, 143.94, 145.31 ppm (C); IR (KBr): nÄ ˆ 3051 (w), 3021 (w),
2957 (w), 2917 (m), 1613 (m), 1592 (m), 1500 (s), 1487 (s), 1474 (s), 1390 (s),
1378 (s), 1314 (s), 1241 (m), 1213 (s), 1188 (m), 1165 (m), 1063 (w), 1014 (s),
836 (m), 819 (w), 755 (s), 747 cmÀ1 (m); fluorescence (CH3CN) Ex (Flmax):
345 (434.47) nm; UV/Vis (CH3CN): lmax (lg e) ˆ 399.6 nm (3.86), 383.2
3
4
3
(dd, J ˆ 6.8 Hz, J ˆ 1.9 Hz, 1H; Ar), 7.52 (t, J ˆ 8.0 Hz, 1H; Ar), 7.63 (s,
1H; Ar), 7.95 (br s, 1H; NH), 8.25 (d, 3J ˆ 8.7 Hz, 1H; Ar), 8.33 ppm (d,
1H; Ar); 13C NMR (50.3 MHz, CDCl3): d ˆ 21.26 (ArCH3), 21.92 (ArCH3),
55.39 (OCH3), 21.70 (ArCH3), 22.17 (ArCH3), 110.50, 114.02, 115.45,
121.93, 122.32 (CH), 122.55 (C), 123.26 (CH), 124.96, 125.13 (C), 128.69,
129.17 (CH), 129.67 (C), 130.34, 130.76 (CH), 131.04, 135.03, 135.97, 141.48,
143.28, 145.09, 160.16 ppm (C); IR (KBr): nÄ ˆ 3051 (w), 3024 (w), 2963 (m),
2918 (m), 2856 (m), 1652 (m), 1614 (m), 1597 (s), 1588 (s), 1492 (s), 1460 (s),
1427 (m), 1391 (m), 1330 (m), 1293 (s), 1255 (s), 1246 (s), 1209 (s), 1133 (m),
1034 (m), 816 (m), 800 (m), 762 (w), 701 cmÀ1 (w); UV/Vis (CH3CN): lmax
(lg e) ˆ 400.6 nm (3.72), 386.9 (3.72), 347.9 (4.20); MS (EI, 70 eV): m/z (%):
(3.82), 343.9 (4.24); MS (EI, 70 eV): m/z (%): 402 ([M] , 81Br isotope, 100),
‡
400 ([M] , 79Br isotope, 98), 321 (10), 306 (8), 160 (10); the exact molecular
‡
mass for C23H17N279Br m/z: 400.0575 Æ 2 mD ([M] ) was confirmed by
‡
HRMS (EI, 70 eV).
1,7-Dimethyl-5-(4-methyloxycarbonylphenyl)-6H-indolino[3,2-b]quino-
line (7l): Starting with 3 h (106 mg, 0.26 mmol), 7l was isolated as a yellow
solid (40 mg, 0.11 mmol, 40%). 1H NMR (250 MHz, CDCl3): d ˆ 2.49 (s,
3H; ArCH3), 3.04 (s, 3H; ArCH3), 4.00 (s, 3H; CO2CH3), 7.26 (t, 3J ˆ
7.7 Hz, 1H; Ar), 7.29 (t, 3J ˆ 7.9 Hz, 1H; Ar), 7.38 (d, 3J ˆ 7.1 Hz, 1H; Ar),
7.53 (d, 3J ˆ 6.8 Hz, 1H; Ar), 7.61 (d, 3J ˆ 8.4 Hz, 1H; Ar), 7.71 (d, 3J ˆ
8.2 Hz, 2H; AA', Ar), 7.75 (s, 1H; NH), 8.29 (d, 3J ˆ 8.2 Hz, 2H; XX', Ar),
8.41 ppm (d, 3J ˆ 7.8 Hz, 1H; Ar); 13C NMR (50.3 MHz, CDCl3): d ˆ 16.57
(ArCH3), 18.81 (ArCH3), 18.81 (CO2CH3), 119.75 (CH), 120.00 (C), 120.43,
122.25 (CH), 122.42, 124.61, 124.74 (C), 125.15, 126.57 (CH), 129.93, 130.19
(C), 130.24, 130.30, 130.47 (CH), 137.51, 139.89, 142.63, 143.83, 145.35 (C),
‡
352 ([M] , 100), 337 (6), 293 (4); the exact molecular mass for C24H20N2O
‡
m/z: 352.1576 Æ 2 mD ([M] ) was confirmed by HRMS (EI, 70 eV).
1,7-Dimethoxy-5-phenyl-6H-indolino[3,2-b]quinoline (7i): Starting with
3v[4b] (83 mg, 0.22 mmol) (procedure 6), 7i was obtained as a yellow solid
(59 mg, 0.17 mmol, 77%). 1H NMR (300 MHz, [D6]DMSO): d ˆ 3.93 (s,
3H; OCH3), 4.04 (s, 3H; OCH3), 7.07 (d, 3J ˆ 7.3 Hz, 1H; Ar), 7.17 (d, 3J ˆ
3
3
8.0 Hz, 2H; Ar), 7.23 (t, J ˆ 7.7 Hz, 1H; Ar), 7.35 (t, J ˆ 7.7 Hz, 1H; Ar),
7.50 7.63 (m, 5H; Ph), 7.95 (d, 3J ˆ 7.0 Hz, 1H; Ar), 10.75 ppm (s, 1H;
NH); 13C NMR (75.5 MHz, [D6]DMSO): d ˆ 55.47 (OCH3), 55.59 (OCH3),
104.72, 110.13, 113.32, 116.26, 120.21 (CH), 122.93 (C), 124.88 (CH), 126.07,
126.48 (C), 128.06, 128.67, 130.19 (CH), 130.67, 134.23, 134.30, 135.96,
144.18, 145.97, 155.47 ppm (C); IR (KBr): nÄ ˆ 3064 (w), 3030 (w), 2932 (w),
2831 (w), 1633 (m), 1609 (m), 1588 (m), 1508 (s), 1491 (s), 1478 (s), 1443
(m), 1391 (s), 1350 (m), 1319 (m), 1257 (s), 1216 (m), 1174 (m), 1109 (s),
1079 (m), 1023 (m), 816 (w), 758 (s), 728 (m), 714 cmÀ1 (m); fluorescence
(CH3CN) Ex (Flmax): 400 (553.52) nm; UV/Vis (DMF): lmax (lg e) ˆ
403.4 nm (3.81), 387.1 (3.78), 346.5 (4.05); MS (EI, 70 eV): m/z (%): 354
ˆ
166.69 ppm (C O); IR (KBr): nÄ ˆ 3060 (w), 3041 (w), 2948 (w), 2920 (w),
1711 (s), 1612 (s), 1500 (m), 1474 (m), 1437 (m), 1395 (s), 1370 (m), 1316
(m), 1289 (s), 1279 (s), 1217 (m), 1190 (m), 1119 (m), 1021 (m), 776 (m), 763
(m), 750 (m), 724 cmÀ1 (m); UV/Vis (CH3CN): lmax (lg e) ˆ 399.9 nm (3.81),
‡
344.1 (4.14), 276.3 (4.70); MS (EI, 70 eV): m/z (%): 380 ([M] , 100), 321
‡
([M À CO2Me] , 12), 305 (6); the exact molecular mass for C25H20N2O2
‡
m/z: 380.1525 Æ 2 mD ([M] ) was confirmed by HRMS (EI, 70 eV).
‡
([M] , 100), 337 (12), 325 (36), 309 (26), 279 (4).
(1Z,2Z)-1,2-Bis(2'-oxocumaran-3'-ylidene)-1,2-bis(phenylamino)ethane
(14): The reaction (procedure 3) of 2-cumaranone (148 mg, 1.10 mmol) and
oxalic acid bis(phenylimidoyl) dichloride (2b; 277 mg, 1.00 mmol) afforded
14 as a yellow solid (55 mg, 12%). 1H NMR (250 MHz, CDCl3): d ˆ 6.85
7.00 (m, 6H; Ar), 7.05 7.21 (m, 12H; Ar), 10.83 ppm (s, 2H; NH);
13C NMR (50.3 MHz, CDCl3): d ˆ 93.69 (C-CO), 110.46, 118.80 (CH),
122.22 (CH, Ph), 122.29 (C), 124.12, 126.09, 126.68 (CH), 129.42 (CH, Ph),
5-(4-Bromophenyl)-6H-indolino[3,2-b]quinoline (7j): Starting with 3c
(38 mg, 0.09 mmol) (procedure 6), 7j was obtained as an orange solid
(17 mg, 0.05 mmol, 48%). Product 8 (15 mg, 0.05 mmol, 49%) was isolated
as a second product.Spectroscopic data for 8: see below. 1H NMR
(300 MHz, [D6]DMSO): d ˆ 7.30 (t, 1H; Ar), 7.48 (d, t, 2H; Ar), 7.56 (d,
2H; AA', Ar), 7.58 (t, 1H; Ar), 7.63 (td, 1H; Ar), 7.75 (d, 1H; Ar), 7.84 (d,
2H; XX', Ar), 8.23 (d, 1H; Ar), 8.37 (d, 1H; Ar), 10.91 ppm (br, 1H; NH);
13C NMR (75.5 MHz, [D6]DMSO): d ˆ 111.70, 119.43 (CH), 121.02 (C),
121.23 (CH), 121.88, 123.87 (C), 123.93 (CH), 124.43 (C), 125.19, 125.84,
129.15, 129.61 (CH), 130.30 (C), 131.98, 132.34 (CH), 133.22, 143.57, 144.36,
145.47 ppm (C); IR (KBr): nÄ ˆ 3062 (w), 3020 (w), 2955 (m), 2923 (s), 2853
(s), 1712 (m), 1627 (m), 1614 (s), 1606 (s), 1484 (s), 1470 (m), 1397 (m), 1383
(m), 1338 (m), 1219 (m), 1143 (m), 1072 (m), 1011 (s), 832 (m), 771 (w), 753
(s), 747 cmÀ1 (s); fluorescence (CH3CN) Ex (Flmax): 340 (428.96) nm; UV/
Vis (DMF): lmax (lg e) ˆ 486.3 nm (3.09), 404.9 (3.39), 343.7 (3.82); MS (EI,
ˆ
136.50, 146.26, 150.19 (C), 170.60 ppm (C O); IR (KBr): nÄ ˆ 3057 (w), 2925
(w), 1711 (s), 1614 (s), 1596 (s), 1575 (s), 1497 (m), 1455 (m), 1439 (m), 1329
(m), 1296 (m), 1246 (s), 1146 (s), 1128 (s), 1087 (s), 1022 (w), 985 (w), 973
(w), 861 (w), 784 (m), 751 (m), 692 cmÀ1 (m); UV/Vis (CH3CN): lmax (lg
e) ˆ 389.9 nm (4.37), 248.3 (4.30), 229.6 (4.30); MS (ESI): m/z (%): 966
‡
([2M‡Na] , 80), 965 ([2M À H]À, 30), 910 (36), 854 (50), 829 (20), 729 (16),
‡
495 ([M‡Na] , 20), 472 ([M]À, 30), 471 ([M]À, 100).
Procedure 8 (synthesis of indirubine derivatives 15): BBr3 (1m solution in
CH2Cl2, 2.04 mL, 2.04 mmol) was added to a solution of (E)-2-[1-cyano-1-
(2-methoxyphenyl)methylidene]-7-methyl-3-(2-tolyl)imino-2,3-dihydro-
1H-indole (3k; 193 mg, 0.51 mmol) in CH2Cl2 (10 mL) at 08C.The color of
the reaction mixture changed from orange to deep violet.The mixture was
stirred and warmed to room temperature overnight.The solution was
poured into an aqueous solution of potassium tert-butanolate (10 mL, 1m).
After extraction of the aqueous layer (3 Â CH2Cl2) the combined organic
layers were dried (Na2SO4) and the solvent was removed in vacuo.
Chromatographic purification (silica gel; petroleum ether/diethyl ether ˆ
30:1) afforded 15b as a violet solid (99 mg, 0.27 mmol, 53%).
‡
‡
70 eV): m/z (%): 374 ([M] , 81Br isotope, 43), 373 ([M] , 79Br isotope, 43),
326 (64), 324 (62), 245 (100), 216 (8), 190 (16).
(E)-2-[1-Cyano-1-(4-bromophenyl)methylidene]-3-oxo-2,3-dihydro-1H-
indole (8): 1H NMR (300 MHz, [D6]DMSO, Tˆ 508C): d ˆ 6.97 (d, 3J ˆ
7.4 Hz, 1H; Ar, C-7), 7.09 (t, 3J ˆ 7.1 Hz, 1H; Ar, C-5), 7.58 (d, 3J ˆ 8.7 Hz,
2H; AA', Ar, C-2', C-6'), 7.60 (t, 3J ˆ 7.0 Hz, 1H; Ar, C-6), 7.65 (d, 3J ˆ
7.6 Hz, 1H; Ar, C-4), 7.77 (d, 3J ˆ 8.7 Hz, 2H; XX', Ar, C-3', C-5'),
10.41 ppm (br, 1H; NH); 13C NMR (75.5 MHz, [D6]DMSO): d ˆ 87.50 (C-
CN), 112.57 (C-5), 117.49 (CN), 119.38 (C-3a), 121.53 (C-7), 122.25 (C-7a),
124.84 (C-4), 130.81 (C-2', C-6'), 131.30 (C-1'), 132.16 (C-3', C-5'), 137.45 (C-
ˆ
6), 142.78 (C-2), 152.29 (C-4'), 184.02 ppm (C O); IR (KBr): nÄ ˆ 3064 (w),
Synthesis of (2E)-7-Methyl-2-(2'-oxocumaran-3'-ylidene)-3-(2-tolyl)imino-
2,3-dihydro-1H-indole (15b): 1H NMR (250 MHz, [D6]DMSO): d ˆ 2.07 (s,
3H; ArCH3), 2.37 (s, 3H; ArCH3), 6.07 (d, 3J ˆ 7.4 Hz, 1H; Ar), 6.61 (t,
ꢁ
3057 (w), 2923 (w), 2211 (m, C N), 1712 (s), 1624 (s), 1602 (s), 1483 (s),
1467 (s), 1407 (m), 1333 (s), 1311 (m), 1239 (m), 1215 (s), 1147 (m), 1085
(m), 1009 (s), 879 (w), 833 (w), 746 (s), 716 cmÀ1 (w); fluorescence
(CH3CN) Ex (Flmax): 395 (422.58) nm; UV/Vis (CH3CN): lmax (lg e) ˆ
479.9 nm (3.74), 322.0 (3.96), 275.8 (4.33); MS (EI, 70 eV): m/z (%): 326
3
3J ˆ 7.6 Hz, 1H; Ar), 6.94 (d, J ˆ 7.4 Hz, 1H; Ar), 7.10 7.23 (m, 4H; Ar),
7.28 7.40 (m, 3H; Ar), 8.58 (d, 3J ˆ 7.4 Hz, 1H; Ar), 9.70 ppm (s, 1H; NH);
13C NMR (50.3 MHz, CDCl3): d ˆ 15.51 (ArCH3), 17.16 (ArCH3), 89.30 (C-
CO), 108.95, 117.38 (CH), 119.23 (C), 122.61, 122.77, 122.82, 123.20, 123.47,
125.21 (CH), 125.38, 126.47 (C), 127.03 (CH), 127.32 (C), 130.82, 135.12
([M] , 81Br isotope, 56), 324 ([M] , 79Br isotope, 56), 245 (100), 216 (8), 190
‡
‡
(16); the exact molecular mass for C16H9N2O79Br m/z: 323.9898 Æ 2 mD
‡
([M] ) was confirmed by HRMS (EI, 70 eV).
ˆ
(CH), 148.02, 150.70 (C), 164.68 ppm (C O); IR (KBr): nÄ ˆ 2924 (w), 1726
5-(4-Bromophenyl)-1,7-dimethyl-6H-indolino[3,2-b]quinoline (7k): Start-
ing with 3b (88 mg, 0.20 mmol), 7k was isolated as a yellow solid (58 mg,
0.14 mmol, 71%). 1H NMR (250 MHz, CDCl3): d ˆ 2.49 (s, 3H; ArCH3),
3.04 (s, 3H; ArCH3), 7.26 (t, 3J ˆ 7.7 Hz, 1H; Ar), 7.38 (2  d, 3J ˆ 7.1 Hz,
(w), 1690 (w), 1648 (m), 1626 (s), 1605 (s), 1595 (s), 1575 (s), 1524 (m), 1483
(m), 1457 (s), 1434 (m), 1302 (m), 1291 (m), 1230 (m), 1205 (m), 1184 (m),
1153 (m), 1095 (w), 1064 (w), 752 cmÀ1 (s); fluorescence (CH3CN) Ex
(Flmax): 340 (418.46) nm; UV/Vis (CH3CN): lmax (lg e) ˆ 538.2 nm (3.75),
Chem. Eur. J. 2003, 9, 3951 3964
www.chemeurj.org
¹ 2003 Wiley-VCH Verlag GmbH & Co.KGaA, Weinheim
3963

P.Langer et al.
FULL PAPER
‡
291.0 (4.13), 271.4 (4.11); MS (EI, 70 eV): m/z (%): 365 ([M] , 64), 348 (44),
259 (100), 182 (4).
[7] We refer to the reactive species used as dianions although they may
represent base associated monolithiated reagents.Bislithiated nitriles:
a) EM. .Kaiser, LE. .Solter, RA. .Schwarz, RD. .Beard, CR. .
(2E)-8-Methyl-2-(2'-oxocumaran-3'-ylidene)-3-(3-tolyl)imino-2,3-dihydro-
1H-indole (15c): Starting with 3l (70 mg, 0.18 mmol) (procedure 8), 15c
Hauser, J. Am. Chem. Soc. 1971, 93, 4237; b) bislithiated sulfones:
a
violet solid (22 mg, 0.06 mmol, 33%). 1H NMR
M.W.Thomson, B.M.Handwerker, S.A.Katz, R.B.Belser,
J. Org.
was obtained as
Chem. 1988, 53, 906, and references therein; c) J.Vollhardt, H.-J.Gais,
K.L.Lukas, Angew. Chem. 1985, 97, 607; Angew. Chem. Int. Ed. Engl.
1985, 24, 608.
(250 MHz, [D6]DMSO): d ˆ 2.31 (s, 3H; ArCH3), 2.41 (s, 3H; ArCH3),
3
6.47 (s, 1H; Ar), 6.48 (s, 1H; Ar), 6.85 (d, J ˆ 8.4 Hz, 3H; Ar), 7.08 (t, d,
3J ˆ 7.9 Hz, 3H; Ar), 7.20 (dd, 3J ˆ 7.7 Hz, 4J ˆ 1.2 Hz, 1H; Ar), 7.35 (t, 3J ˆ
7.7 Hz, 1H; Ar), 8.90 ppm (d, 1H; NH); 13C NMR (50.3 MHz, CDCl3): d ˆ
20.67 (ArCH3), 21.31 (ArCH3), 81.50 (C-CO), 111.44, 114.57, 116.35, 118.09
(CH), 118.37 (C), 119.30 (CH), 119.74 (C), 120.63 (CH), 123.04 (C), 124.41,
125.14 (CH), 128.28 (C), 128.97, 129.59, 130.62 (CH), 138.64, 144.07, 149.14,
[8] For reviews of domino and sequential reactions, see: a) L.F.Tietze, U.
Beifuss, Angew. Chem. 1993, 105, 137; Angew. Chem. Int. Ed. Engl.
1993, 32, 131; b) L.F.Tietze, Chem. Rev. 1996, 96, 115.
[9] For indolo[1,2-b]isoquinolin-5-ones, see: a) H.de Diesbach, O.Jacobi,
¬
C.Taddei, Helv. Chim. Acta 1940, 23, 469; b) J.-Y. Merour, S.Piroelle,
ˆ
150.61, 154.93 (C), 165.78 ppm (C O); IR (KBr): nÄ ˆ 2954 (m), 2923 (s),
F.Cossais, Heterocycles 1993, 36, 1287; c) R.F.C.Brown, N.Choi,
2853 (m), 1652 (m), 1629 (s), 1607 (s), 1598 (s), 1576 (s), 1523 (w), 1457 (s),
1330 (m), 1300 (m), 1229 (m), 1176 (m), 1146 (s), 1095 (m), 1061 (m), 794
(m), 755 (m), 749 cmÀ1 (m); fluorescence (CH3CN) Ex (Flmax): 340
(426.02) nm; UV/Vis (CH3CN): lmax (lg e) ˆ 531.1 nm (3.76), 290.4 (4.20);
K.J.Coulston, F.W.Eastwood, F.Ercole,
d) G.L.Humphrey, L.Dalton, J.A.Joule, D.I.C.Scopes,
Soc. Perkin Trans. 1983, 2413; e) R.Grigg, V.Sridharan, P.
Stevenson, S.Sukirthalingam, T.Worakun, Tetrahedron 1990, 46, 4003.
Liebigs Ann. 1997, 1931;
J. Chem.
1
‡
MS (ESI): m/z (%): 366 ([M‡H] , 100), 365 ([M]À, 54), 364 ([M À H]À,
[10] J.Bergman, J-.O.Lindstrˆm, U.Tilstam,
and references therein.
Tetrahedron 1985, 41, 2881,
100).
Materials and methods for DNA intercalation experiments: A 35mer
oligonucleotide GAAAGAAGCGTTTTCGCTTCTTTCTTTTCTTTCTT,
capable of forming triple- and double-helical structures by folding back on
itself under suitable conditions, was used for the UV studies.UV thermal
melting profiles were obtained with a Kontron Uvikon 922 spectropho-
tometer equipped with a Peltier element.Readings of absorbance A at
260 nm versus temperature T were recorded with a heating rate of
0.58CminÀ1 controlled by home-written software.Measurements were
performed in 200 mm NaCl and 10 mm PIPES buffer, pH 7.0, on the
olignucleotide in the absence and presence of the polycyclic compound
using quartz cuvettes of 1 cm optical path length.Prior to each melting
experiment the samples were annealed by heating to 908C for 5 min
followed by slow cooling to room temperature.Because of hysteresis
effects on successive heating and cooling cycles, melting temperatures Tm
were taken as the temperature for half-dissociation of the DNA triplex or
duplex upon heating and were determined from the first derivative plot dA/
dT versus temperature.
[11] a) L.Randriambola, -JC. .Quirion, C.Kan-Fan, H-P..Husson,
Tetrahedron Lett. 1987, 28, 2123; b) S.Takano, T.Sato, K.Inomata,
K.Ogasawara, J. Chem. Soc. Chem. Commun. 1991, 462.
¬
¬
[12] d-Carbolines: a) J.-Y. Merour, A.Me rour, Synthesis 1994, 767, and
refereces therein; for b-carbolines, see: b) J.Kobayashi, J.-f.Cheng, T.
Ohta, S.Nozoe, Y.Ohizumi, T.Sasaki, J. Org. Chem. 1990, 55, 3666;
c) T.G.Hagen, K.F.Koehler, P.W.Codding, P.Skolnick, J.M.Cook,
J. Med. Chem. 1990, 33, 2343; d) P.Rocca, F.Marsais, A.Godard, G.
Queguiner, Tetrahedron 1993, 49, 3325.
[13] K.Cimanga, T.De Bruyne, L.Pieters, M.Claeys, A.Vlietinck,
Tetrahedron Lett. 1996, 37, 1703.
[14] S.C.Benson, J.E.Li, J.K.Snyder,
J. Org. Chem. 1992, 57, 5285.
[15] a) K.N.Kilminster, M.Sainsbury, J. Chem. Soc. Perkin Trans. 1 1972,
2264; b) Y.Oikawa, O.Yonemitsu, J. Chem. Soc. Perkin Trans. 1 1976,
1479.
[16] a) A.N. Tackie, G.L. Boye, M.H.M. Sharaf, P.L. Schiff, Jr., R.C.
Crouch, T.D.Spitzer, R.L.Johnson, J.Dunn, D.Minick,
J. Nat. Prod.
1993, 56, 653; b) J.L.Pousset, M-.T.Martin, A.Jossang, B.Bodo,
Phytochemistry 1995, 39, 735; c) S.Y.Ablordeppey, P.Fan, A.M.
Clark, A.Nimrod, Bioorg. Med. Chem. 1999, 7, 343; d) P.Fan, S.Y.
Ablordeppey, J. Heterocycl. Chem. 1997, 34, 1789; e) T.-L. Ho, D.-G.
Jou, Helv. Chim. Acta 2002, 85, 3823.
[1] For reactions of 2- and 3-vinylindoles as 4p-components in Diels
Alder reactions, see: a) S.Blechert, R.Knier, H.Schroers, T.Wirth,
Synthesis 1995, 592; b) U.Pindur, M.Rogge, M.Rehn, W.Massa, B.
Peschel, J. Heterocycl. Chem. 1994, 31, 981, and references therein;
[17] a) R.Hoessel, S.Leclerc, J.A.Endicott, M.E.M.Nobel, A.Lawrie, P.
Tunnah, M.Leost, E.Damiens, D.Marie, D.Marko, E.Niederberger,
W.Tang, G.Eisenbrand, L.Meijer, Nat. Cell Biol. 1999, 1, 60; b) R.P.
¬
c) J.Le vy, J.Sapi, J.-Y.Laronze, D.Royer, L.Toupet, Synlett 1992, 601.
[2] For 2-alkylidene-3-oxindoles and their use in the synthesis of the
¬
Maskey, I.Gr¸n-Wollny, H.H.Fiebig, H.Laatsch,
Angew. Chem.
aristotelia and other alkaloid core structures: a) J.-Y. Merour, L.
2002, 114, 623; Angew. Chem. Int. Ed. 2002, 41, 597.
[18] a) F.Johnson, W.A.Nasutavicus, J. Org. Chem. 1962, 27, 3953; b) A.
Wang, H.Zhang, E.R.Biehl, Heterocycles 2000, 53, 291.
Chichereau, E.Desarbre, P.Gadonneix, Synthesis 1996, 519; b) E.
Wenkert, S.Liu, Synthesis 1992, 323; c) Y.Davion, B.Joseph, J-.Y.
¬
¬
Merour, Synlett 1998, 1051; d) A.Buzas, J-.Y.Me rour, Synthesis 1989,
¬
¬
[19] For the oxidation of alkyl and benzyl halides and tosylates by DMSO,
see: a) N.Kornblum, J.W.Powers, G.J.Anderson, W.J.Jones, H.O.
Larson, O.Levand, W.M.Weaver, J. Am. Chem. Soc. 1957, 79, 6562;
458; e) J.-Y. Merour, A.Me rour, Synthesis 1994, 767; f) W.Shen, C.A.
Coburn, W.G.Bornmann, S.J.Danishefsky, J. Org. Chem. 1993, 58,
611; g) K.Paulvannan, J.R.Stille, J. Org. Chem. 1994, 59, 1613.
[3] For push pull heterocycles, see: a) R.Gompper, H-U. .Wagner,
Angew. Chem. 1988, 100, 1492; Angew. Chem. Int. Ed. Engl. 1988, 27,
1437; for NIR dyes, see: b) J.Fabian, H.Nakazumi, M.Matsuoka,
Chem. Rev. 1992, 92, 1197; for recent examples of indole-derived
photochromic spirooxazines: c) V.Malatesta, R.Millini, L.Monta-
nari, J. Am. Chem. Soc. 1995, 117, 6258; d) S.Delbaere, C.Bochu, N.
Azaroual, G.Buntinx, G.Vermeersch, J. Chem. Soc. Perkin Trans. 2
1997, 1499.
b) N.Kornblum, W.J.Jones, G.J.Anderson,
J. Am. Chem. Soc. 1959,
81, 4113; c) R.T.Major, H.-J.Hess, J. Org. Chem. 1958, 23, 1563; d) A.
Helms, D.Heiler, G.McLendon, J. Am. Chem. Soc. 1992, 114, 6227.
[20] For an intermolecular Diels Alder reaction of arylimines, see: G.
Babu, P.T.Perumal, Tetrahedron Lett. 1998, 39, 3225.
[21] J.L. Mergny, G. Duval-Valentin, C.H. Nguyen, L. Perrouault, B.
¬
¬ ¡
Faucon, M.Rouge e, T.Montenay-Garestier, E.Nisagni, C.He lene,
Science 1992, 256, 1681.
[22] a) D.Leitner, K.Weisz, J. Biomol. Struct. Dyn. 2000, 17, 993; b) A.
Dunger, H.-H. Limbach, K. Weisz, J. Am. Chem. Soc. 2000, 122,
[4] a) P.Langer, J.Wuckelt, M.Dˆring, H.Gˆrls, J. Org. Chem. 2000, 65,
3603; b) P.Langer, J.T.Anders, Eur. J. Org. Chem. 2001, 3953.
[5] For reviews of work from our laboratory, see: a) P.Langer, Chem. Eur.
J. 2001, 7, 3858; b) P.Langer, M.Dˆring, Eur. J. Org. Chem. 2002, 221;
c) P.Langer, Synthesis 2002, 441.
10109; c) D.Leitner, W.Schrˆder, K.Weisz,
5886.
Biochemistry 2000, 39,
Received: November 8, 2002
[6] D.Lindauer, R.Beckert, M.Dˆring, P.Fehling, H.Gˆrls,
J. Prakt.
Revised: March 3, 2003 [F4566]
Chem. 1995, 337, 143.
3964
¹ 2003 Wiley-VCH Verlag GmbH & Co.KGaA, Weinheim
www.chemeurj.org
Chem. Eur. J. 2003, 9, 3951 3964