Enhancing activity and thermostability of lipase A from Serratia marcescens by site-directed mutagenesis

Article abstract of DOI:10.1016/j.enzmictec.2016.07.006

Lipases as significant biocatalysts had been widely employed to catalyze various chemical reactions such as ester hydrolysis, ester synthesis, and transesterification. Improving the activity and thermostability of enzymes is desirable for industrial appli

Full text of DOI:10.1016/j.enzmictec.2016.07.006

Accepted Manuscript
Title: Enhancing activity and thermostability of Lipase A from
Serratia marcescens by site-directed mutagenesis
Author: Mohsen Mohammadi Zargham Sepehrizadeh Azadeh
Ebrahim-Habibi Ahmad Reza Shahverdi Mohammad Ali
Faramarzi Neda Setayesh
PII:
S0141-0229(16)30135-1
DOI:
Reference:
http://dx.doi.org/doi:10.1016/j.enzmictec.2016.07.006
EMT 8939
To appear in:
Enzyme and Microbial Technology
Received date:
Revised date:
Accepted date:
15-2-2016
20-5-2016
15-7-2016
Please cite this article as: Mohammadi Mohsen, Sepehrizadeh Zargham,
Ebrahim-Habibi Azadeh, Shahverdi Ahmad Reza, Faramarzi Mohammad Ali,
Setayesh Neda.Enhancing activity and thermostability of Lipase A from Serratia
marcescens by site-directed mutagenesis.Enzyme and Microbial Technology
http://dx.doi.org/10.1016/j.enzmictec.2016.07.006
This is a PDF file of an unedited manuscript that has been accepted for publication.
As a service to our customers we are providing this early version of the manuscript.
The manuscript will undergo copyediting, typesetting, and review of the resulting proof
before it is published in its final form. Please note that during the production process
errors may be discovered which could affect the content, and all legal disclaimers that
apply to the journal pertain.

Enhancing activity and thermostability of Lipase A from Serratia marcescens by
site-directed mutagenesis
Mohsen Mohammadi1, Zargham Sepehrizadeh2 , Azadeh Ebrahim-Habibi3,4* , Ahmad Reza
Shahverdi2 , Mohammad Ali Faramarzi2, Neda Setayesh2*
1Department of Pharmaceutical Biotechnology, Faculty of Pharmacy, Lorestan University of Medical Sciences,
Khorramabad, Iran
2Department of Pharmaceutical Biotechnology and Pharmaceutical Biotechnology Research Center, School of
Pharmacy, Tehran University of Medical Sciences, Tehran, Iran
3Biosensor Research Center, Endocrinology and Metabolism Molecular-Cellular Sciences Institute, Tehran
University of Medical Sciences, Tehran, Iran
4 Endocrinology and Metabolism Research Center, Endocrinology and Metabolism Clinical Sciences Institute,
Tehran University of Medical Sciences, Tehran, Iran
*Corresponding authors
1

Graphical abstract
Highlights
 We examine the effect of site-direct mutagenesis on the thermal stability and
activity of SML.
 Four mutant lipases of SML were constructed by site-direct mutagenesis
 The thermal stability and activity of SML (wild type and mutants) was
compared.
 Using protein modeling program and creating mutation, can enhance lipase
activity and/or thermostability of SML
2

Abstract
Lipases as significant biocatalysts had been widely employed to catalyze various chemical
reactions such as ester hydrolysis, ester synthesis, and transesterification. Improving the activity
and thermostability of enzymes is desirable for industrial applications. The lipase of Serratia
marcescens belonging to family I.3 lipase has a very important pharmaceutical application in
production of chiral precursors. In the present study, to achieve improved lipase activity and
thermostability, using computational predictions of protein, four mutant lipases of SML
(MutG2P, MutG59P, Mut H279K and Mut L613W A614P) were constructed by site-directed
mutagenesis . The recombinant mutant proteins were over-expressed in E. coli and purified by
affinity chromatography on the Ni-NTA system. Circular dichroism spectroscopy, differential
scanning calorimetry and kinetic parameters (Km and kcat) were determined. Our results have
shown that the secondary structure of all lipases was approximately similar to one another. The
MutG2P and MutG59P were more stable than wild type by approximately 2.3 and 2.9 in T1/2,
respectively. The catalytic efficiency (kcat/Km) of MutH279K was enhanced by 2-fold as
compared with the wild type (p<0.05). These results indicate that using protein modeling program
and creating mutation, can enhance lipase activity and/or thermostability of SML and it also could
be used for improving other properties of enzyme to the desired requirements as well as further
mutations.
Key words: Family I.3 Lipase, Site-directed mutagenesis, Serratia marcescens, Differential
scanning calorimetry , CD spectra
3

1. Introduction
Lipases (triacylglycerol acylhydrolases, EC 3.1.1.3) are serine hydrolases that catalyze both
the hydrolysis and the synthesis reactions [1]. Moreover, microbial lipases do not require
cofactors and possess broad substrate specificity, hence are widely used in a variety of industrial
applications such as the synthesis of fine chemicals and optically active pharmaceuticals [2].
Lipases have been widely produced by microorganisms, mainly bacterial, and are commercially
important due to their diversity in catalytic activity, high yield and low cost production, as well as
the relative ease of genetic manipulation [3, 4]. Bacterial lipases based on the difference in amino
acid sequence and biochemical properties classified into eight different families (I-VIII). Family I,
being the largest group and is further divided into seven subfamilies (I.1-I.7) with the first three
subfamilies (I.1-I.3) including of gram-negative bacteria true lipases [5, 6]. Subfamily I.1 and I.2
lipases share relatively high amino-acid sequence similarity, in-contrast subfamily I.3 lipases
possess low amino-acid sequence similarity (<20%) to either family I.1 or family I.2 lipases [7].
In the other hand, those have higher molecular size than lipases from subfamilies I.1 and I.2 and
both the lack of Cys residue [8]. Family I.3 lipases, which are represented by lipases from
Serratia marcescens (SML) and Pseudomonas fluorescens, are separated from other lipases not
only by their amino acid sequences but also by their secretion mechanisms and biological
properties [9]. The SML is composed of 613-614 amino acid residues with a molecular weight
between 64-65kDa [10, 11]. The lipase A from Serratia marcescens has been the subject of
research for more than 30 years, as it is used for production the large- scale kinetic resolution of
racemic 3-(4-methoxyphenyl) glycidic acid methyl ester which it is a chiral precursor for
diltiazem synthesis, a calcium-channel blocker and coronary vasodilator [12] . In recent years,
many efforts have been made to improve lipase activity, and in particular, to enhance lipase
stability. Various strategies to protect lipases from inactivation and to increase the operational
4

stability and activity of lipases have been developed, including the use of chemical modification
of structure, protein engineering, medium engineering, etc [13]. Many factors are that influence
enzyme stability, which of all potentially deactivating factors, temperature is the best-studied
[14]. In order to use lipases as biocatalysts in industrial applications, it is desirable improving
properties such as the thermostability and activity, that prolongs product shelf half -life, increase
energy efficiency, and save costs hence, there is great interest to generate enzymes with desired
properties [15-17]. Nevertheless to achieve the above objective, requires the use of the modern
methods of genetic engineering combined with an increasing knowledge of the structure and
function of lipases [18, 19]. Thermostable lipases are more attention for industrial processes
because the reactions might be performed at elevated temperatures therefore should be the
structure of enzyme in harsh condition is maintained , furthermore includes other advantages such
as increased solubility of lipid substrates in water, faster reaction and reduced possible risk of
contamination [20, 21]. To improve one or more properties such as the thermostability and the
activity of the enzyme ,widely used strategy include hydrogen bonding, the formation of disulfide
bridges, hydrophobic or aromatic interactions, ion pairing, etc [22]. Therefore, to achieve these
goals a suitable and efficient method must choose. For this purpose, there are two major and
principally different routes: (i) the first, structure-based rational design, in here requires to
structural information and knowledge about three-dimensional (3D) of protein. Using this method
can predict and improved the activity and stability of enzyme, for example, the site-directed
mutation (SDM) technique here is used [23-26] . The second, (ii) random or “irrational”
mutagenesis design, relying on entirely random mutagenesis techniques by various protocols for
generating large variant libraries of genes, followed by screening or selection for improved
variants for specific properties of an enzyme, such as utilizing the gene (DNA) shuffling and
error-prone PCR (epPCR) technique. In here for directed evolution usually does not require prior
knowledge of the structure of the enzyme (protein) [27-32]. The fact that the rational protein
5

design methods through computational models have been developed and it have provided a new
valuable tool for improving enzyme properties to the desired requirements [33]. This method has
experienced important with varying degrees of success in recent years, with considerable
achievements in the design of novel enzymes ([34-36]. Structural features of an enzyme can affect
the thermostability as well as plays a crucial role in promoting thermostability. For example,
thermostability is associated with large numbers of electrostatic interactions, a large number and
tight metal-binding sites, high packing density and core hydrophobicity. Thus, a rational approach
( e.g. site-directed mutagenesis) can be used in the presence of empirical testing to enzyme
engineering as well as optimizing the activity and thermal properties of an enzyme
[37].Understanding the structural basis of altered properties of proteins due to changes, provides
useful insight in designing proteins with improved catalytic activity or thermostability. We
describe here progress in improving the stability and activity of SML by rational site-directed
mutagenesis (SDM) based on homology modeling and molecular dynamics (MD) simulations as
well as experimentally testing. In this study, four mutant proteins of SML were designed and
constructed, and was analyzed enzyme activity and thermostability.
2. Materials and methods
2.1. Bacterial strains, plasmids, enzymes, materials and culture conditions
Marine Serratia marcescens (GenBank No. GQ471957), which is deposited into the
Microorganisms collection of the Microbial Technology and Products (MTP) Research Center of
Iran (Collection No. UTMS 2342), was utilized for experiments. Escherichia coli XL1 -Blue
[recA1 endA1 gyrA96 thi-1 hsdR17 supE44 [F’ proAB lacIqZΔ15 Tn10 (Tetr)] (Novagen-USA)
-
and Escherichia coli BL21 (DE3) [F- ompT hsdSB (rB- mB ) gal dcm (lcIts857 ind1 Sam7 nin5
lacUV5-T7 gene1] (Novagen-USA) were employed as host strains for the gene manipulation and
protein expression, respectively. The plasmids used for the cloning and protein expression was
6

pUC19 Ampr and pET-28a (+) Kanr (Novagen-USA). All the restriction enzymes were from
Thermo Scientific (USA), all the kits were purchased from Qiagen (USA)/ Roche (Germany). All
other chemicals and reagents used in the study were of good analytica grade, obtained from
Merck (Germany)/Sigma Aldrich (USA). The S. marcescens was grown in a nutrient broth (0.3%
beef extract, 0.5% peptone and 0.5% NaCl) at 30 ◦C. LB medium (1% peptone, 0.5% yeast
extract, 1% NaCl) or solid medium contained bacto-agar (1.5%) were used for culture and growth
of E.coli at 37 ◦C. Ampicillin (100g/ml) and Kanamycin (50g/ml) were added to medium for
recombinant E.coli when needed. Isopropyl β-1-D-thiogalactopyranoside (IPTG) was used at
indicated time point for induction of lipase production when needed. The cell growth was
determined by measuring the optical density at 600 nm using a spectrophotometer.
2.2. Construction of wild-type expression plasmid
The genomic DNA of S.marcescens was extracted by the bacteria genomic DNA extraction
kit (Roche Germany). The SML gene (lipA) (accession no. KF372589) of S. marcescens was
amplified using Pwo DNA polymerase (Roch) according to the procedures recommended by the
Supplier in combination of primer 1 (5′-GCCCATATGGGCATCTTTAGCTATAAGG-3′),
primer 2 (5′- TAGGATCCTTAGGCCAACACCACCTGATC -3′) where, the underlined bases
represent the NdeI site for primer 1, and BamHI site for primer 2. The ATG codon for the
initiation of the translation and the sequence complementary, TAA, to the termination codon are
shown in bold type. The PCR products were digested with with NdeI and BamHI , purified, and
ligated into the NdeI and BamHI sites of pET-28a(+) vector and was then transformed into XL-1
Blue cells for cloning and verification through sequencing. The verified pET28a-LipA was
transformed into E. coli BL21 (DE3) for overexpresssion of the lipA gene.
7

2.3. Homology model
2.3.1. Computational design of mutants
In order to identify potential mutations that would lead to enhanced catalytic activity and
thermostability, studied SML structure was modelled using the homology model module of MOE
2012.10 based on the existing crystal structures of SML (PDB code 2QUA). Identification of
putative mutations was performed based on two approaches: comparison of SML structure with
Pseudomonas lipase (PML) (PDB code 2Z8X) and direct investigation on SML structure itself. In
order to evaluate catalytic activity of SML, the obtained SML model was superimposed on PML
structure and calcium-binding sites were compared in the two enzymes. Hence, the MutH279K
mutant was constructed. Direct investigation on 3D structure of SML was performed using
Protein Design Module of MOE 2012.10 [38] which includes a rotamer exploration of the
proposed mutations and a molecular dynamics simulation of the obtained mutants in order to
identify putative sites. In which it was used to calculate dihedral angles ψ against φ of amino acid
residues in protein structure, where changing residues would result in higher thermostability.
Therefore, three mutants, MutG2P, MutG59P and pMutL613W-A614P were constructed.
2.4.
Site-directed mutagenesis
Site- directed mutagenesis (SDM) was carried out using splicing by the overlap extension
method (SOE) [39] to create the four mutants of SML. Plasmid of pET28a-LipA was used as
template for mutagenesis that involved the application of primers as described in Table 1. The
1845 bp amplicons obtained were cloned into pET-28a (+). Expression plasmids derived from
pET-28a (+), which carry different SML mutant genes, were named pMutG2P, pMutG59P,
pMutH279K and pMutL613W-A614P, and were transformed into E. coli XL1-Blue. The
nucleotide sequence of the mutated genes was verified by DNA sequencing. E. coli BL21 (DE3)
8

cells were transformed with the constructs then transformants were selected on Luria-Bertani
medium plates supplemented with kanamycin (50g/ml) for expression.
2.5. Overexpression and purification of recombinant enzymes
For Overexpression , single colonies of each clone E.coli BL (DE3) harboring the pET28a-
LipA and mutant plasmids were inoculated in 5 ml of LB broth containing 50g/ml kanamycin
and grown at 37 o C overnight with shaking. The resulting cultures were used to inoculate 200 ml
of the same medium until OD600 reached spanning 0.7-0.8, isopropyl-L-D-thiogalactopyranoside
(IPTG) was added to a final concentration 1 mM, and the cells were cultivated further at 35 °C for
o
12 hours. Cells were harvested by centrifugation at (5000×g, 10 min, 4 C) and washed twice
with 50mM Tris-HCl, pH 8.0 solution. The cell pellet was then resuspended in buffer A (6 M
Guanidine Hydrochloride, 20mM NaH2PO4, 500 mM NaCl, pH 7.8) and the cells were disrupted
by gentle sonication treatment, cooled on ice, for six cycles, 10 s and 30 s intervals. The
o
supernatant was obtained by centrifugation at (15000 × g, 20 min, 4 C). The eight ml of the
supernatant fraction containing soluble recombinant lipase was mixed with 1.5 ml of nickel
affinity resin (Ni-NTA, Invitrogen) previously equilibrated with buffer B (8 M Urea , 20 mM
o
Sodium Phosphate pH 7.8 , 500 mM NaCl), incubated for 1 h at 22 C and applied to an empty
column. The column was washed several times with buffer B (pH 6). Finally, recombinant
proteins were refolded and eluted with buffer C containing 100 mM Tris- HCl, pH 8.0, 250 mM
NaCl, 20 mM CaCl2, and 250 mM imidazole. The fractions containing protein solution were
pooled and several times was dialyzed using dialysis tubing (12 kDa cut-off ) for overnight at 4
°C against 50 mM Tris- HCl (pH 8.0) buffer containing 150 mM NaCl, 10mM CaCl2. The protein
eluted from the column was used for biochemical characterization. The protein concentration was
determined according to [40] using bovine serum albumin (BSA) as a standard and absorbance
was recorded at 605 nm. Finally, proteins were used for biochemical characterization.
2.6. Enzyme assay
9

The residual and relative enzyme activities were determined by a spectrophotometric method
at 410nm in 1-cm path length cells with a double-beam using p-nitrophenyl laurate (p-NPC12) as
the substrate. Assay mixtures as follows: One part of Solution A , p-nitrophenyl laurate (in
isopropanol ) 5mM (to a final concentration (0.5mM) as substrate , and nine part of Solution B,
50mM Tris –HCl (pH 8.00) buffer , containing 5mM CaCl2 ,0.1% (w/v) gum arabic 0.2% (w/v)
sodium deoxycholate 0.4% (v/v) Triton X-100 . Therefore, 950 l of the substrate solution was
mixed with 50 l of the enzyme solution (20-60 g) to make a final volume 1ml. The activity
assay was done at indicated temperature for 5 minutes. The reaction was terminated by addition
of 25 l of 0.5 M EDTA solution. The molar absorptivity of p-nitrophenol in same buffer was
experimentally determined as 14200 M-1 cm-1. The background hydrolysis of the substrate was
deducted by using a reference sample of identical composition to the incubation mixture. One unit
of enzymatic activity was defined as the amount of enzyme that liberated one mol of p-
nitrophenol per min under standard assay conditions [11]. The total enzyme activity was defined
in U and specific activity was defined as U/mg of protein. The experiments were performed triplet
and the processed data were given as the means ±SD of triplicate measurements from three
independent determinations for each enzyme.
2.7. Gel electrophoresis
The expression level of rSML (wild type and mutated lipases) in the cells , molecular mass
and the purity of the proteins were analyzed by 12% sodium dodecyl sulfate polyacrylamide gel
electrophoresis (SDS-PAGE) according to [41] followed by staining with Coomassie brilliant
blue R-250 and destined with methanol/acetic-acid/water (3:1:6 v/v/v).
2.8. Effects of temperature and pH on lipase activity and stability
Effects of temperature and pH on lipase activity wild type and mutated proteins were
measured by the spectrophotometric assay at 410 nm using p-nitrophenyl laurate (p-NPC12) as the
10

substrate. The optimal temperature for activity was determined under various temperatures (30-50
oC) at the optimum pH value using a circulation water bath and the relative activities (%) were
measured. The thermal stability of SMLs , wild –type and mutants, was tested by pre-incubating
the enzyme sample at various temperatures ranging from 25 to 80 oC with 5 oC increments for 1 h
in optimal pH buffer. Immediately after chilling the samples on ice, the residual activity (%) at
the optimum temperature for each enzyme was determined under the standard reaction conditions.
The optimal pH for the purified lipases was evaluated by incubating the enzyme–substrate at
various pH from 4 to 12 in following buffers: 50mM sodium acetate buffer, 50mM Tris– HCl
buffer, and 50mM glycine/NaOH buffer. Enzyme reactions at each pH value were carried out at
optimum temperature and their relative activities (%) were measured. In order to determine the
stability for enzymes at pH values of 4.0 and 12.0, a pre-incubation was performed at each pH
value at room temperature for 24 h. The residual activity (%) was measured using the standard
assay as described previously.
2.9. Substrate specificity
The substrate specificity was determined by the spectrophotometric assay, by incubating the
purified lipases with four the p NP-derived ester in various lengths (p NP acetate, C2; p NP
butyrate, C4; as short- chain fatty acid esters, p NP laurate, C12; as medium- chain fatty acid
ester; p NP palmitate, C16 as long- chain fatty acid ester) as substrate and measuring the amount
of p NP released.
2.10. Kinetic Parameters
The kinetic parameters were calculated using the spectrophotometric activity assay with
varied concentrations of pNPC12 (0.05–2.0 mM) as substrate of the lipase. The kinetic parameters,
affinity constant (Km), maximal velocity (Vmax), and the turnover number (kcat) values, were
calculated from the experimental data using Sigma plot 12 software. The parameter Catalytic
efficiency was also obtained by using the equation kcat/Km.
11

2.11. Statistical analysis of data
The data reported in all figures and tables are an average of triplicate observations and were
subjected to one-way analysis of variance (ANOVA) and compared by F-test using the
STATISTICA 20 (Stat Soft, Inc., USA) software package. The final values was presented as
mean ± standard deviation. Differences were considered to be significant when P<0.05.
2.12. Circular dichroism (CD)
The circular dichroism (CD) spectrum was determined on Aviv circular dichroism
spectrometer model 215 (Aviv Instruments, NJ, and USA). The far-UV (260-200 nm) CD
spectrum was measured in 50mM Tris-HCl (pH 8.0) containing 0.15 M NaCl and 10 mM CaCl2
o
at 25 C. The protein concentration and optical path length were 0.2 mg ml-1 and 0.1 cm,
respectively .The buffer 50mM Tris-HCl (pH 8.0) with 0.15 M NaCl and 10 mM CaCl2 was used
as blank and its spectrum was subtracted to CD spectrum of protein. The results are expressed as
molar ellipcity []λ(deg cm2 dmol -1) by using a mean amino acid residue weight (MWR) of 110.
The CD unit used is the mean residue ellipticity for CD spectrum in the far-UV range. The
ellipticities are calculated from the following relations, [θ]λFar = (θm × 100 MWR)/(c.l.n) where
θm is the measured ellipticity in degrees wavelength λ, c is the protein concentration in mole per
liter, l is the light path length of the cell in centimeter and n is the number of residues.
2.13. Differential scanning calorimetry (DSC)
Thermal analysis (thermograms) of samples was analyzed using a Differential Scanning
Calorimeter (DSC- 823 e, Mettler Toledo, Switzerland). Approximately 4-5 mg of Freeze-dried
protein using a small spatula were weighed in an aluminium pan (Mettler, ME-27331, Mettler-
Toledo Switzerland) and 10l of 50mM Tris-HCl (pH 8.0) containing 0.15 M NaCl and 10 mM
CaCl2 was added and hermetically sealed. The DSC analyzer was calibrated using an empty
sealed aluminium pan as reference. DSC scans were performed in the range between 20 and 95
°C, at a scan rate of 60 °C/h in a nitrogen atmosphere. Thermograms, denaturation temperatures
12

(Td), were determined automatically using Origin Software (STARe Thermal analysis version 3.1
software; Mettler Toledo, Switzerland) at which the denaturation peak in the thermogram is a
maximum.
3. Results and discussion
3.1. Rational design of mutations and production of Mutants
Three-dimensional model structure of S. marcescens lipase A belonging to family I.3 lipase
with 614 amino acid residues (and high similarity to SML 2QUA.pdb) shows that the polypeptide
chain is folded into two domains (N-C). The N-catalytic domain contains the active site residues
Ser207, Asp256, and His314 is composed of residues from 1 to 320, and C-terminal β-sandwich
domain is formed by residues 321 to 614 [6, 11, 12]. It was shown earlier from structural and
biochemical/biophysical studies on family I.3 lipases that the N-catalytic domain both are nearly
identical with each other, except for the structures of two lids, termed lid 1 and lid 2, and the
Ca2+-binding sites [5]. The lid is a surface loop, covering the active-site of lipases and its
conformation is changed upon interfacial activation, therefore providing the interaction between
the active- site serine residue and the substrate [9, 42]. The N-catalytic domain of SML possesses
calcium-binding sites Ca1 and Ca2, while PML has one additional site indicated as Ca1–Ca3. As
the Ca3 site is missing in the SML structure, it may be mentioned that all three Ca2+-binding sites
in the N-catalytic domain of family I.3 lipase are not conserved [5, 42, 43]. The Ca1 site of
SML is related to the lid, which is an α-helical polypeptide chain overing the active site, and
which is anchored in its position by the Ca2+ ion. This ion is coordinated by Asp153
(monodentate) and Asp157 (bidentate), the carbonyl oxygen atoms of Thr118 and Ser144, and the
side chain of Gln120 the coordination sphere is completed by a water molecule. [12]. All the
residues participating in Ca-binding site are strongly conserved in lipases of family I.3 with the
13

same residue numbers. Mutation at this site prevents the formation of the Ca1 site and almost
fully abolishes the enzymatic activity as for PML [43, 44]. The Ca+2 ion of the Ca2 site is
heptacoordinated by the side chains of Glu254 (monodentate), Asp276 (bidentate) and Asn285,
main chain oxygen atoms of Asn284, and two water molecules [12]. Residues adjacent to
calcium in the Ca3 site of PML are shown in Fig. 1A, as P277, K278, E279, T282, D283, K336,
and D337. Equivalent residues of SML (obtained by structural superimposition, Fig.2B) are P278,
H279, T280, T283, N284, K337 and D338. Comparison of residues composition of SML with
PML in this region, as well as their orientation shows that H279 of SML to be the most prominent
difference between these two regions. In one of the crystallized structures of SML (2QUB.A), it
could be observed that in absence of a calcium ion, K337 side chain interacts with the backbone
of H279. In conclusion, as there is one Lysine residue instead of this Histidine in PML, and as this
residue seemed to be the most important differing part in the structure, hence, it was hypothesized
that a mutation of H279K may lead to the formation of a calcium-binding site structure in SML.
In fact, the Ca3 site may play an important role in increasing activity and /or thermal stability of
family I.3 lipases .It has been shown that in a family I.3 lipase from Pseudomonas sp. MIS38
(PML), by removing the Ca3 site through the mutation of Asp337 to Ala (D337A-PML), the
stabilization was decreased .It has been shown that a family I.3 lipase from Pseudomonas sp.
MIS38 (PML) by removing the Ca3 site through the mutation of Asp337 to Ala (D337A-PML),
the stabilization was decreased [5] as well as a lipase from pseudomonas fragi has been shown
that mutations in the lid region affected in chain length specificity, activity and thermostability of
the enzyme [45]. It has been proposed that the lids of family I.3 lipases to interact with the
substrate and open conformation must be stabilized by the Ca2+ ion bound and in the absence of
this Ca2+ ion, the lid structure in the open conformation may be unstable [42]. Thus Ca2+ ion is
essential for lipase activity and the conformational change of calcium-stimulated lipases
associated with ca- binding sites that includes a change in their secondary structures as well an
14

increase in α-helix and β-sheet contents [46]. Several studies showed that family I.3 lipases
requires Ca2+ ion for activity , Ca2+ -dependent activity , and do not a functional conformation in
the absence of the Ca2+ ion [5, 9, 42, 43, 46].Further exploring possibilities to stabilize the
protein, other mutations were investigated using the Protein Design module of MOE program,
using SML model . Mutation of glycine to to proline was systematically explored in the whole
protein. Stability of a protein can be increased by selected amino acid substitutions that decrease
the configurational entropy of unfolding [47].Generally proline residues is the only naturally
occurring amino acid in which the side chain is connected to the backbone nitrogen, forming a
five-membered pyrrolidine ring. Proline residues exhibit special dihedral angles of φ against ψ of
amino acid residues in the protein backbone [48]. The proline residues due to the pyrrolidine ring,
has the lowest conformational entropy than any other residues hence it can decrease the
conformational entropy of the unfolded structures, thus stabilizes the protein. The pyrrolidine
ring can decrease the conformational entropy of the unfolded structures, therefore proline has the
lowest conformational entropy than any other residues [47, 49]. In contrast glycine, in the
unfolded state, is the residue with the highest conformational entropy [50]. Thus, changing
glycine to proline may result into increase in the stability of proteins by decreasing the entropic
difference between the unfolded and the folded state. The effect of all glycine to proline
substitutions was checked, and finally G2 and G59 mutations were predicted to result in best
stability. Location of these glycine residues and modelled mutations are represented in Fig. 2A, B,
C, D, where, in case of P59, potential new interactions may happen (e.g. with L150 and S60).
Substitution of Gly residues with Pro increases the free energy difference and local rigidity and
influences the stability of the enzyme. Mutational studies on various proteins have been reported
by proline substitution as an important factor involved in increased thermostability [51-58]. Since
the C-terminal of family I.3 lipase is suggested to play an important role in the enzyme stability
[59], inducing a mutation at this site was also considered. As shown in Fig. 2 E,F, L613 and
15

A614 residues are the last residues of the sequence and it was hypothesized that mutation of these
residues to more voluminous W613 and P614 would result into less conformational freedom, as
well as potential for other interactions of the tryptophan side chain. According to a study that was
carried out on a lipase has been reported that the tryptophan residues affected the thermal stability
[60].
3.2. Cloning, expression and purification of SML and its mutants
The wild-type lipase A and its four mutants were cloned into the pET-28a (+) vector under
the control of the T7 promoter for expression of protein. The performance of the mutation and the
absence of PCR-generated random mutations were confirmed by DNA sequencing. Sequence
analysis of the cloned fragments revealed one major open reading frame of 1845 bps, which
encodes a polypeptide of 614 residues. The sequence of wild-type lipase A from S. marcescens in
this study has been submitted to GenBank and is available under accession number AGT95802.
The recombinant lipases were overexpressed in E. coli BL21 (DE3) cells transformed with PET-
28a (+) which places the lipase gene under control of a T7 promoter and induced with IPTG. The
inclusion bodies were solubilized and purified in the presence of 6M Gn-HCl or 8 M urea as well
as refolded in the presence of the Ca+2 ions. The proteins, with a histidine tag in N-terminal region
of the protein, were purified by one-step purification using metal-affinity chromatography on Ni-
NTA resin column. The recombinant lipases attached to Ni-NTA resin column was eluted with
imidazole. To avoid any interferences, remaining imidazole from the elution was removed by
dialysis against 50mM Tris-HCl. After protein purification, the recombinant lipases were
confirmed by a single band on an SDS-PAGE gel with an apparent molecular mass of 65 kDa
stained with Coomassie Brilliant Blue (Fig. 3) this molecular mass of S. marcescens lipase is in
agreement with previous reports [10, 61, 62].
16

3.3. Biochemical characterization
3.3.1. Effect of temperature and pH on enzyme activity and stability
The effect of temperature on the activity of the SML and its mutants was analyzed at 30-50
oC. The enzymes exhibited high activities at temperatures range of 37–45°C, and displayed their
optimal activity at 42◦C (Fig. 4a). Therefore, no tangible changes in optimum temperature of
mutants were observed compared with wild type. The identical results for optimum temperature
also reported for S. marcescens Sr41 8000 lipase [63] and S. marcescens ECU1010 lipase [64].
To evaluate the improvement in thermostability, the residual activity of wild type and the mutants
after pre-incubation for 1h over a temperature range from 25◦C to 80◦C was measured. As shown
in Fig. 4b. All enzymes retained above 100 % activity at temperatures below 35°C, but the
stability of the enzymes decreased when the temperature was over 50°C, however the two
mutants, MutG2P and MutG59P, displayed favorable effects on thermostability and retained
activity higher than that of wild type. The thermo stability /tolerance of any of the lipases from
Serratia species as well as mutation on the thermal stability have not yet been reported so far. The
lipases from S. marcescens Sr41 8000 [63] and S. marcescens ECU1010 [64] are two of the
reported examples of SML that without showing the details reported the lipase (wild type)
retained 60-70% activity after being incubated at 50°C for 1 h. The effect of pH on the catalytic
activity of mutants and wild type recombinant lipases was investigated in the pH range 4.0–12.0
(Fig. 4c). All enzymes were displayed highest activity at pH values between 7.0 and 9.0. The
optimum pH of wild type and mutants was pH 8.0 at 42°C and no distinct changes were found in
the mutants. The pH- stability profile in the form of residual activity was presented in Fig. 4d, as
that showed the highest residual activity all enzymes was observed in the pH 9.0 value. This is
somewhat similar to that reported for lipases from S. marcescens optimum pH (pH 7.5-8.0) and
pH stability (pH 6.0-8.0) [65], and Serratia marcescens Sr41 8000 optimum pH: 8.0 and pH
stability (pH 6.0-8.0) [63], and S. marcescens ECU1010 optimum pH: 8.0 and pH stability (pH
17

6.0-9.0) [64], and S. marcescens SM6 optimum pH: 8.0 and pH stability (pH 6.0-10) [66].
Therefore both the wild type lipase and mutants display the similar profiles in pH stability and
were very stable at alkaline pH and decreased activities at acidic pH values. In addition an
increase in stability was observed with the increase in pH buffers this is particularly was shown in
the MutH279K compared with wild type and other mutants. The relative increase in pH stability
of the MutH279K may be associated with basic property of lysine as similar results have been
obtained on some other lipase [67].
3.4. Substrate specificity
The substrate specificity of enzymes, were evaluated towards several p-nitrophenyl esters of
different chain lengths having alkyl chain lengths of C2, C4, C12, and C16, by
spectrophotometrically under the assay conditions. As shown in Fig.5, the highest hydrolytic
activity was obtained with C4 and C12 p-nitrophenyl esters, with a remarkable preference of
toward p-nitrophenyl laurate (C12) whereas with reduce was the activities toward C2 and C16
esters, indicating a clear preference of the enzyme for medium acyl chain lengths. As it has been
reported a lipase from S. marcescens Sr41 8000 [63] showed the highest activity on substrates
with short-chain length (C4–C8) rather than the long chain length. On the other hand the lipases
from S. marcescens ES-2 (44, 50) [62, 68], exhibited maximum activity towards substrates with
medium-chain length (C8–C12).
3.5. Kinetic parameters
Kinetic parameters of S. marcescens lipase (wild type and mutants) were determined by
measuring rates of hydrolysis of different concentrations of pNPC12 as substrate using a
spectrophotometric activity assay. The kinetic parameters such as, affinity constant (Km),
maximal velocity (Vmax), turnover number (kcat), and catalytic efficiency (kcat/Km) were
determined for five enzymes. The results are summarized in Table 2. Kinetic data was plotted
and shown in Fig.6. The MutH279K displayed a affinity constant (Km) of 0.36 mM and
18

maximal velocity (Vmax) of 1207 mol/min/mg that compared to the wild type , exhibited
significant increase of lipase activity (P<0.05). The catalytic efficiency (kcat/Km ) for MutH279K
was twofold greater than that the wild type enzyme, showing that substitution His279 by Lys and
formation of additional calcium binding sites might lead to an increase in the enzyme activity.
Therefore, it can serve as a good candidate for the engineering of enzyme. The Km value of Mut
L613WA614P was 0.63mM, which was higher than to that of wild type enzyme (0.39 mM)
showing this mutation decreased the enzyme affinity for the substrate, however its maximal
velocity (Vmax) and turnover number (kcat) was slightly higher in compared with wild type.The
affinity constant (Km), maximal velocity (Vmax), turnover number (kcat), and catalytic efficiency
(kcat/Km) of the thermostable mutants, the MutG2P and MutG59P, was almost similar as that of
the wild type enzyme and no significant differences was observed (p>0.05) therefore, in spite of
the increase of MutG2P and MutG59P thermal stability, but not observed important change in the
kinetic parameters. The effects of mutagenesis on activity of different microbial lipases were
investigated by site-directed mutagenesis using substitution different amino acids around or far
from the active site. The results reveal that substitution the amino acid residues, affects enzyme
catalysis activity [45, 67, 69-74].
3.6. CD spectra
To inspect whether the secondary structure of SML is changed by the
mutations , the far- CD spectrum of the wild type and mutant lipases , MutG2P , MutG59P ,
Mut H279K and Mut L613WA614, were measured in 50 mM Tris- HCI (pH 8.0) containing 10
mM CaCl2, at 25°C as previously described. The far-UV CD spectrum (below 250 nm) reflects
the secondary structure of the protein [75]. Results indicated the far-UV CD spectrum of mutant
proteins were similar to those of the wild type protein (Fig. 7), suggesting that the overall
19

secondary structures of several SML mutants were not significantly changed by mutations. A
similar spectral without change has been observed for a family I.3 lipase from Pseudomonas sp.
MIS38 (PML) where five single and two double mutations were created [69].
3.7. Differential scanning calorimetry (DSC)
Differential scanning calorimetry (DSC) was performed on SMLs to evaluate their thermal
stability. The lipases were submitted to gradual temperature increase from the initial temperature
of 25 °C to the final temperature of 95 °C at a scan rate of 60 °C/h. The denaturation process was
characterized by determining the midpoint of denaturation temperature (Td), during which half of
the protein molecules were in a denatured state. Based on these results the peak denaturation
temperature (Td) of the enzymes were 53.02°C for wild type, 55.29°C for MutG2P, 55.88°C
MutG59P, 52.82 °C for Mut H279K and 53.96°C for Mut L613WA614P as are shown in Fig. 8.
As observed, Td both MutG2P and MutG59P respectively 2.3 and 2.8 °C were higher than to that
of wild type as was expected. Thermal denaturation of H279K was similar to those of the wild
type. However, DSC thermogram of Mut L613WA614P was 0.9 °C higher when compared with
that of the wild type but it was less important than to that of MutG2P and MutG59P.According to
computational analysis of the enzyme structure it was expected that the thermostability of the Mut
L613WA614P would be higher, but based on results the increased thermostability of Mut
L613WA614P is not significant comparing to that of MutG2P and/or MutG59P. Until now,
limited information is available regarding the effect of site-directed amino acid substitutions on
the thermostability of SML. Other lipases , H. lanuginosa lipase, has also been reported by
substitution G225P, the temperature stability was increased about 2 oC measured by DSC [76].
4. Conclusion
20

In conclusion, we explored the thermal stability and activity of SML by site-directed
mutagenesis. Hence three mutants of SML (MutG2P, MutG59 and Mut L613W A614P) with
improved thermal stability were successfully obtained by proline substitution mutagenesis.
Especially, mutations MutG2P and MutG59 increased thermal stability without distinct loss of
specific activity and catalytic efficiency. This shows the importance of proline residues for the
thermal stability of SML and makes SML potentially more useful in industrial processes. As
described above, proline stabilizes a protein by decreasing the backbone conformational entropy
of the unfolded state. The MOE predicts the stability of proline mutations due to calculating
thermodynamic quantities (entropic and enthalpic contributions) in protein stability modulation.
Therefore, the preceding glycine residues at the site where proline is replaced can be candidate
mutation sites for improving thermal stability of SML. However, this remains replacing another
amino acid by proline using MOE program and three-dimensional structure analysis of SML to
the greater thermal stability. On the other hand, one mutant obtained by the substitution of
histidine 279 for lysine, H279K, caused an increase in lipase activity compared with wild type,
and shows the important role of His 279 in SML in lipase activity. Our starting hypothesis was a
probable formation of one additional calcium-binding site in SML via this substitution. However,
it should be noted that the aspartate residue (D283) observed in the original calcium binding site
of PML is also involved in the interaction with the calcium ion. The corresponding residue is
N284 in SML, which lacks one oxygen atom compared with D283, and may lead to a potentially
weaker interaction. With regard to the experimental results, it may be suggested that combining
the successful mutations G2P, G59P, and H279K could result in both higher stability and activity
in SML. Since these residues are located relatively far from each other, and since the mutations to
proline had not adversely affected the enzyme’s activity, a simultaneous increase in activity and
stability could be achieved. Overall, in our study, hypothesized stabilizing mutations to proline
residue were more successful in the N-terminal region of the enzyme. Interestingly, the third
21

successful mutation is also located in the N-terminal domain of the enzyme’s structure. This is
suggestive of a real potential for this domain as a target for increasing the enzyme’s activity and
stability. The reported mutations are novel in SML, and show the effectiveness of rationally
designed point mutations as a possible way for improvement activity or thermal stability of SML
for potential industrial applications.
Acknowledgments
This research was supported by the Biotechnology Research Center of Tehran University of Medical
Sciences (grant number 24331). We thank for providing financial support.
References
[1] Sharma R, Chisti Y, Banerjee UC. Production, purification, characterization, and applications of
lipases. Biotechnology advances. 2001;19:627-62.
[2] Ghanem A, Aboul‐Enein HY. Application of lipases in kinetic resolution of racemates. Chirality.
2005;17:1-15.
[3] Gupta R, Gupta N, Rathi P. Bacterial lipases: an overview of production, purification and biochemical
properties. Applied microbiology and biotechnology. 2004;64:763-81.
[4] Treichel H, de Oliveira D, Mazutti MA, Di Luccio M, Oliveira JV. A review on microbial lipases
production. Food and Bioprocess Technology. 2010;3:182-96.
[5] Kuwahara K, Angkawidjaja C, Matsumura H, Koga Y, Takano K, Kanaya S. Importance of the Ca2+-
binding sites in the N-catalytic domain of a family I. 3 lipase for activity and stability. Protein Engineering
Design and Selection. 2008;21:737-44.
[6] Jaeger K, Dijkstra B, Reetz M. Bacterial biocatalysts: molecular biology, three-dimensional structures,
and biotechnological applications of lipases. Annual Reviews in Microbiology. 1999;53:315-51.
[7] Angkawidjaja C, You D-J, Matsumura H, Koga Y, Takano K, Kanaya S. Extracellular overproduction
and preliminary crystallographic analysis of a family I. 3 lipase. Acta Crystallographica Section F:
Structural Biology and Crystallization Communications. 2007;63:187-9.
[8] Arpigny J, Jaeger K. Bacterial lipolytic enzymes: classification and properties. Biochem J.
1999;343:177-83.
[9] Amada K, Haruki M, Imanaka T, Morikawa M, Kanaya S. Overproduction in Escherichia coli,
purification and characterization of a family I. 3 lipase from Pseudomonas sp. MIS38. Biochimica et
Biophysica Acta (BBA)-Protein structure and molecular enzymology. 2000;1478:201-10.
[10] Long Z-D, Xu J-H, Zhao L-L, Pan J, Yang S, Hua L. Overexpression of Serratia marcescens lipase in
Escherichia coli for efficient bioresolution of racemic ketoprofen. Journal of Molecular Catalysis B:
Enzymatic. 2007;47:105-10.
[11] Mohammadi M, Sepehrizadeh Z, Ebrahim-Habibi A, Shahverdi AR, Faramarzi MA, Setayesh N.
Bacterial expression and characterization of an active recombinant lipase A from Serratia marcescens with
truncated C-terminal region. Journal of Molecular Catalysis B: Enzymatic. 2015;120:84-92.
22

[12] Meier R, Drepper T, Svensson V, Jaeger K-E, Baumann U. A calcium-gated lid and a large β-roll
sandwich are revealed by the crystal structure of extracellular lipase from Serratia marcescens. Journal of
Biological Chemistry. 2007;282:31477-83.
[13] Shu Z-Y, Jiang H, Lin R-F, Jiang Y-M, Lin L, Huang J-Z. Technical methods to improve yield,
activity and stability in the development of microbial lipases. Journal of Molecular Catalysis B:
Enzymatic. 2010;62:1-8.
[14] Eijsink VG, Gåseidnes S, Borchert TV, van den Burg B. Directed evolution of enzyme stability.
Biomolecular engineering. 2005;22:21-30.
[15] Cho A-R, Yoo S-K, Kim E-J. Cloning, sequencing and expression in Escherichia coli of a
thermophilic lipase from Bacillus thermoleovorans ID-1. FEMS microbiology letters. 2000;186:235-8.
[16] Suen WC, Zhang N, Xiao L, Madison V, Zaks A. Improved activity and thermostability of Candida
antarctica lipase B by DNA family shuffling. Protein Engineering Design and Selection. 2004;17:133-40.
[17] Acharya P, Rajakumara E, Sankaranarayanan R, Rao NM. Structural basis of selection and
thermostability of laboratory evolved Bacillus subtilis lipase. Journal of molecular biology.
2004;341:1271-81.
[18] Jaeger K-E, Eggert T, Eipper A, Reetz M. Directed evolution and the creation of enantioselective
biocatalysts. Applied microbiology and biotechnology. 2001;55:519-30.
[19] Petrounia IP, Arnold FH. Designed evolution of enzymatic properties. Current Opinion in
Biotechnology. 2000;11:325-30.
[20] Abdel-Fattah YR. Optimization of thermostable lipase production from a thermophilic Geobacillus sp.
using Box-Behnken experimental design. Biotechnology Letters. 2002;24:1217-22.
[21] Rathi P, Goswami V, Sahai V, Gupta R. Statistical medium optimization and production of a
hyperthermostable lipase from Burkholderia cepacia in a bioreactor. Journal of applied microbiology.
2002;93:930-6.
[22] Xiao Z, Bergeron H, Grosse S, Beauchemin M, Garron M-L, Shaya D, et al. Improvement of the
thermostability and activity of a pectate lyase by single amino acid substitutions, using a strategy based on
melting-temperature-guided sequence alignment. Applied and environmental microbiology. 2008;74:1183-
9.
[23] Matthews BW. Studies on protein stability with T4 lysozyme. Advances in protein chemistry.
1994;46:249-78.
[24] Ó’Fágáin C. Enzyme stabilization—recent experimental progress. Enzyme and Microbial
Technology. 2003;33:137-49.
[25] Eijsink VG, Bjørk A, Gåseidnes S, Sirevåg R, Synstad B, van den Burg B, et al. Rational engineering
of enzyme stability. Journal of biotechnology. 2004;113:105-20.
[26] van den Burg B, Eijsink VG. Selection of mutations for increased protein stability. Current opinion in
biotechnology. 2002;13:333-7.
[27] Lutz S, Patrick WM. Novel methods for directed evolution of enzymes: quality, not quantity. Current
opinion in biotechnology. 2004;15:291-7.
[28] Cherry JR, Fidantsef AL. Directed evolution of industrial enzymes: an update. Current opinion in
biotechnology. 2003;14:438-43.
[29] Robertson DE, Steer BA. Recent progress in biocatalyst discovery and optimization. Current opinion
in chemical biology. 2004;8:141-9.
[30] Zhao H, Chockalingam K, Chen Z. Directed evolution of enzymes and pathways for industrial
biocatalysis. Current Opinion in Biotechnology. 2002;13:104-10.
[31] Arnold FH, Wintrode PL, Miyazaki K, Gershenson A. How enzymes adapt: lessons from directed
evolution. Trends in biochemical sciences. 2001;26:100-6.
[32] Turner NJ. Directed evolution of enzymes for applied biocatalysis. Trends in biotechnology.
2003;21:474-8.
[33] Tobin MB, Gustafsson C, Huisman GW. Directed evolution: the ‘rational’basis for ‘irrational’design.
Current opinion in structural biology. 2000;10:421-7.
[34] Lehmann M, Wyss M. Engineering proteins for thermostability: the use of sequence alignments
versus rational design and directed evolution. Current Opinion in Biotechnology. 2001;12:371-5.
23

[35] Gerlt JA, Babbitt PC. Enzyme (re) design: lessons from natural evolution and computation. Current
opinion in chemical biology. 2009;13:10-8.
[36] Röthlisberger D, Khersonsky O, Wollacott AM, Jiang L, DeChancie J, Betker J, et al. Kemp
elimination catalysts by computational enzyme design. Nature. 2008;453:190-5.
[37] Siddiqui KS, Poljak A, De Francisci D, Guerriero G, Pilak O, Burg D, et al. A chemically modified α-
amylase with a molten-globule state has entropically driven enhanced thermal stability. Protein
Engineering Design and Selection. 2010;23:769-80.
[38] S. Chemical Computing Group Inc. (2012) Molecular Operating Environment (MOE). 1010
Sherbrooke St West, Montreal, QC, Canada, H3A 2R7. 2012.
[39] R.M. Horton iBAWE. Curr Meth Appl. 1993;15:251-66.
[40] Bradford MM. A rapid and sensitive method for the quantitation of microgram quantities of protein
utilizing the principle of protein-dye binding. Analytical biochemistry. 1976;72:248-54.
[41] Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4.
nature. 1970;227:680-5.
[42] Angkawidjaja C, You D-j, Matsumura H, Kuwahara K, Koga Y, Takano K, et al. Crystal structure of
a family I. 3 lipase from Pseudomonas sp. MIS38 in a closed conformation. FEBS letters. 2007;581:5060-
4.
[43] Amada K, Kwon H-J, Haruki M, Morikawa M, Kanaya S. Ca 2+-induced folding of a family I. 3
lipase with repetitive Ca 2+ binding motifs at the C-terminus. FEBS letters. 2001;509:17-21.
[44] Hyun-Ju K, Amada K, Haruki M, Morikawa M, Kanaya S. Identification of the histidine and aspartic
acid residues essential for enzymatic activity of a family I. 3 lipase by site-directed mutagenesis. FEBS
letters. 2000;483:139-42.
[45] Santarossa G, Lafranconi PG, Alquati C, DeGioia L, Alberghina L, Fantucci P, et al. Mutations in the
“lid” region affect chain length specificity and thermostability of a Pseudomonas fragi lipase. FEBS letters.
2005;579:2383-6.
[46] Kim KR, Kwon DY, Yoon SH, Kim WY, Kim KH. Purification, refolding, and characterization of
recombinant Pseudomonas fluorescens lipase. Protein expression and purification. 2005;39:124-9.
[47] Matthews B, Nicholson H, Becktel W. Enhanced protein thermostability from site-directed mutations
that decrease the entropy of unfolding. Proceedings of the National Academy of Sciences. 1987;84:6663-7.
[48] Wedemeyer WJ, Welker E, Scheraga HA. Proline cis-trans isomerization and protein folding.
Biochemistry. 2002;41:14637-44.
[49] Suzuki Y, Hatagaki K, Oda H. A hyperthermostable pullulanase produced by an extreme thermophile,
Bacillus flavocaldarius KP 1228, and evidence for the proline theory of increasing protein thermostability.
Applied Microbiology and Biotechnology. 1991;34:707-14.
[50] Sriprapundh D, Vieille C, Zeikus JG. Molecular determinants of xylose isomerase thermal stability
and activity: analysis of thermozymes by site-directed mutagenesis. Protein engineering. 2000;13:259-65.
[51] Watanabe K, Hata Y, Kizaki H, Katsube Y, Suzuki Y. The refined crystal structure of Bacillus cereus
oligo-1, 6-glucosidase at 2.0 Å resolution: structural characterization of proline-substitution sites for
protein thermostabilization. Journal of molecular biology. 1997;269:142-53.
[52] Zhu GP, Xu C, Teng MK, Tao LM, Zhu XY, Wu CJ, et al. Increasing the thermostability of D-xylose
isomerase by introduction of a proline into the turn of a random coil. Protein engineering. 1999;12:635-8.
[53] Igarashi K, Ozawa T, Ikawa-Kitayama K, Hayashi Y, Araki H, Endo K, et al. Thermostabilization by
proline substitution in an alkaline, liquefying α-amylase from Bacillus sp. strain KSM-1378. Bioscience,
biotechnology, and biochemistry. 1999;63:1535-40.
[54] Dixon M, Nicholson H, Shewchuk L, Baase W, Matthews B. Structure of a hinge-bending
bacteriophage T4 lysozyme mutant, Ile3→ Pro. Journal of molecular biology. 1992;227:917-33.
[55] Hardy F, Vriend G, Veltman O, Van der Vinne B, Venema G, Eijsink V. Stabilization of Bacillus
stearothermophilus neutral protease by introduction of prolines. FEBS letters. 1993;317:89-92.
[56] Watanabe K, Masuda T, Ohashi H, Mihara H, Suzuki Y. Multiple Proline Substitutions Cumulatively
Thermostabilize Bacillus Cereus ATCC7064 Oligo‐1, 6‐Glucosidase. European Journal of Biochemistry.
1994;226:277-83.
[57] Watanabe K, Suzuki Y. Protein thermostabilization by proline substitutions. Journal of Molecular
Catalysis B: Enzymatic. 1998;4:167-80.
24

[58] Nakamura S, Tanaka T, Yada RY, Nakai S. Improving the thermostability of Bacillus
stearothermophilus neutral protease by introducing proline into the active site helix. Protein engineering.
1997;10:1263-9.
[59] Kuwahara K, Angkawidjaja C, Koga Y, Takano K, Kanaya S. Importance of an extreme C-terminal
motif of a family I. 3 lipase for stability. Protein Engineering Design and Selection. 2011;24:411-8.
[60] Zhu K, Jutila A, Tuominen EK, Patkar SA, Svendsen A, Kinnunen PK. Impact of the tryptophan
residues of Humicola lanuginosa lipase on its thermal stability. Biochimica et Biophysica Acta (BBA)-
Protein Structure and Molecular Enzymology. 2001;1547:329-38.
[61] Akatsuka H, Kawai E, Omori K, Komatsubara S, Shibatani T, Tosa T. The lipA gene of Serratia
marcescens which encodes an extracellular lipase having no N-terminal signal peptide. Journal of
bacteriology. 1994;176:1949-56.
[62] Lee K-W, Bae H-A, Lee Y-H. Molecular cloning and functional expression of esf gene encoding
enantioselective lipase from Serratia marcescens ES-2 for kinetic resolution of optically active (S)-
flurbiprofen. Journal of microbiology and biotechnology. 2007;17:74-80.
[63] Matsumae H, Shibatani T. Purification and characterization of the lipase from Serratia marcescens
Sr41 8000 responsible for asymmetric hydrolysis of 3-phenylglycidic acid esters. Journal of fermentation
and bioengineering. 1994;77:152-8.
[64] Zhao L-L, Xu J-H, Zhao J, Pan J, Wang Z-L. Biochemical properties and potential applications of an
organic solvent-tolerant lipase isolated from Serratia marcescens ECU1010. Process Biochemistry.
2008;43:626-33.
[65] Kawai E, Akatsuka H, Sakurai N, Idei A, Matsumae H, Shibatani T, et al. Isolation and analysis of
lipase-overproducing mutants of Serratia marcescens. Journal of bioscience and bioengineering.
2001;91:409-15.
[66] Li X, Tetling S, Winkler UK, Jaeger K-E, Benedik MJ. Gene cloning, sequence analysis, purification,
and secretion by Escherichia coli of an extracellular lipase from Serratia marcescens. Applied and
environmental microbiology. 1995;61:2674-80.
[67] Kolling DJ, Bertoldo JB, Brod FCA, Vernal J, Terenzi H, Arisi ACM. Biochemical and structural
characterization of two site-directed mutants of Staphylococcus xylosus lipase. Molecular biotechnology.
2010;46:168-75.
[68] Bae H-A, Lee K-W, Lee Y-H. Enantioselective properties of extracellular lipase from Serratia
marcescens ES-2 for kinetic resolution of (S)-flurbiprofen. Journal of Molecular Catalysis B: Enzymatic.
2006;40:24-9.
[69] Cheng M, Angkawidjaja C, Koga Y, Kanaya S. Calcium-independent opening of lid1 of a family I. 3
lipase by a single Asp to Arg mutation at the calcium-binding site. Protein Engineering Design and
Selection. 2014;27:169-76.
[70] Branneby C, Carlqvist P, Magnusson A, Hult K, Brinck T, Berglund P. Carbon-carbon bonds by
hydrolytic enzymes. Journal of the American Chemical Society. 2003;125:874-5.
[71] Patkar SA, Svendsen A, Kirk O, Clausen IG, Borch K. Effect of mutation in non-consensus sequence
Thr-X-Ser-X-Gly of Candida antarctica lipase B on lipase specificity, specific activity and thermostability.
Journal of Molecular Catalysis B: Enzymatic. 1997;3:51-4.
[72] Nagao T, Shimada Y, Sugihara A, Tominaga Y. Increase in stability of Fusarium heterosporum lipase.
Journal of Molecular Catalysis B: Enzymatic. 2002;17:125-32.
[73] Fujii R, Nakagawa Y, Hiratake J, Sogabe A, Sakata K. Directed evolution of Pseudomonas aeruginosa
lipase for improved amide-hydrolyzing activity. Protein Engineering Design and Selection. 2005;18:93-
101.
[74] Wang C, Cai S, Wu Y. R182K double-mutagenesis of Penicillium expansum lipase. Chin J
Biotechnol Bull. 2007;4:165-8.
[75] Kelly SM, Jess TJ, Price NC. How to study proteins by circular dichroism. Biochimica et Biophysica
Acta (BBA)-Proteins and Proteomics. 2005;1751:119-39.
[76] Bryan PN. Protein engineering of subtilisin. Biochimica et Biophysica Acta (BBA)-Protein Structure
and Molecular Enzymology. 2000;1543:203-22.
25

Figure legends
Fig. 1. Comparison of residues surrounding calcium ion in PML with equivalent residues in SML. A:
Calcium binding site in PML. Residues are shown that are located in 5.0 Å distance from calcium. B:
Equivalent residues in SML model. Backbone atoms that were not involved in interactions have been
hidden for better visualization. Dots indicate putative hydrogen bonds.
26

Fig.2. Glycine 2 location in SML (A) and potential mutation to proline 2 (B). Glycine 59 location in SML
(C) and potential mutation to proline 59 (D). Location and adjacent residues to L613 and A614 (E) as well
as the effect of mutating these residues to W613 and P614 (F).
27

28

Fig.3. SDS-PAGE (12% gel) analysis of overexpressed proteins. The SML-WT (wild type) and mutants
were overproduced in the E. coli BL21 (DE3) cells transformed with plasmid PET-28a (+) derivatives
carrying the lipA gene as described in Materials and Methods. The gel was stained by Coomassie brilliant
blue R-250. Lane M, molecular weight marker (kilo Daltons, kDa) ; lane 1, cell lysates without induction
(control) ; lane 2, 3 ,4 ,5 and 6 precipitate of cell lysate (Inclusion Body) SML-WT , MutG2P, MutG59P,
Mut H279K and Mut L613W A614P respectively, induced by 1mM IPTG; lane 8,9,10,11 and 12 , purified
SML-WT , MutG2P, MutG59P, Mut H279K and Mut L613W A614P respectively. Recombinant proteins
are indicated by arrows which are approximately 65kD.
29