Mechanism of the 6-hydroxy-3-succinoyl-pyridine 3-monooxygenase flavoprotein from Pseudomonas putida S16

Article abstract of DOI:10.1074/jbc.M114.558049

6-Hydroxy-3-succinoyl-pyridine (HSP) 3-monooxygenase (HspB), a flavoprotein essential to the pyrrolidine pathway of nicotine degradation, catalyzes pyridine-ring β-hydroxylation, resulting in carbon-carbon cleavage and production of 2,5-dihydroxypyridine. Here, we generated His₆-tagged HspB in Escherichia coli, characterized the properties of the recombinant enzyme, and investigated its mechanism of catalysis. In contrast to conclusions reported previously, the second product of the HspB reaction was shown to be succinate, with isotope labeling experiments providing direct evidence that the newly introduced oxygen atom of succinate is derived from H₂O. Phylogenetic analysis reveals that HspB is the most closely related to two p-nitrophenol 4-monooxygenases, and the experimental results exhibit thatp-nitrophenol is a substrate of HspB. The reduction of HspB (with maxima at 375 and 460 nm, and a shoulder at 485 nm) by NADH was followed by stopped-flow spectroscopy, and the rate constant for reduction was shown to be stimulated by HSP. Reduced HspB reacts with oxygen to form a C_(4a)-(hydro)peroxyflavin intermediate with an absorbance maximum at -400 nm within the first few milliseconds before converting to the oxidized flavoenzyme species. The formed C_(4a)-hydroperoxyflavin intermediate reacts with HSP to form an intermediate that hydrolyzes to the products 2,5-dihydroxypyridine and succinate. The investigation on the catalytic mechanism of a flavoprotein pyridine-ring β-position hydroxylase provides useful information for the biosynthesis of pyridine derivatives.

Full text of DOI:10.1074/jbc.M114.558049

Enzymology:
Mechanism of the
6
3
-Hydroxy-3-succinoyl-pyridine
-Monooxygenase Flavoprotein from
Pseudomonas putida S16
Hao Yu, Robert P. Hausinger, Hong-Zhi Tang
and Ping Xu
J. Biol. Chem. 2014, 289:29158-29170.
doi: 10.1074/jbc.M114.558049 originally published online August 29, 2014
Access the most updated version of this article at doi: 10.1074/jbc.M114.558049
Find articles, minireviews, Reflections and Classics on similar topics on the JBC Affinity Sites.
Alerts:
•
•
When this article is cited
When a correction for this article is posted
Click here to choose from all of JBC's e-mail alerts
This article cites 41 references, 12 of which can be accessed free at
http://www.jbc.org/content/289/42/29158.full.html#ref-list-1

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 289, NO. 42, pp. 29158–29170, October 17, 2014
2014 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.
©
Mechanism of the 6-Hydroxy-3-succinoyl-pyridine
-Monooxygenase Flavoprotein from Pseudomonas putida S16
*
3
Received for publication, February 14, 2014, and in revised form, August 27, 2014 Published, JBC Papers in Press, August 29, 2014, DOI 10.1074/jbc.M114.558049
‡1
‡
§
‡
Hao Yu (于浩) , Robert P. Hausinger , Hong-Zhi Tang (唐鸿志) , and Ping Xu (许平)
From the State Key Laboratory of Microbial Metabolism, and School of Life Sciences and Biotechnology, Shanghai Jiao Tong
‡
§
University, Shanghai 200240, People’s Republic of China and the Department of Microbiology and Molecular Genetics, Michigan
State University, East Lansing, Michigan 48824
Background: Mechanistic information is limited on pyridine ␤-hydroxylation monooxygenases.
Results: The catalytic mechanism of HspB was determined.
Conclusion: An observable C(4a)-hydroperoxyflavin intermediate reacts with 6-hydroxy-3-succinoyl-pyridine to form 2,5-
dihydroxypyridine and succinate during the catalysis.
Significance: This study expands our understanding of pyridine hydroxylases and their pyridine metabolisms.
6
-Hydroxy-3-succinoyl-pyridine (HSP) 3-monooxygenase the pyrrolidine pathway of nicotine degradation in Pseudomo-
(
HspB), a flavoprotein essential to the pyrrolidine pathway of nas putida strain S16, is a flavin-dependent monooxygenase
nicotine degradation, catalyzes pyridine-ring ␤-hydroxylation, (1–4) that contains an FAD cofactor and depends on NADH as
resulting in carbon-carbon cleavage and production of 2,5-dihy- a co-substrate. This pyridine-ring ␤-hydroxylation monooxy-
droxypyridine. Here, we generated His -tagged HspB in Esche- genase (Fig. 1A) is responsible for converting HSP to 2,5-dihy-
6
richia coli, characterized the properties of the recombinant droxypyridine (2,5-DHP) (1), a precursor for the important
enzyme, and investigated its mechanism of catalysis. In contrast drug 5-aminolevulinic acid that is used for cancer therapy (5).
to conclusions reported previously, the second product of the Pyridine derivatives are extensively used in functional materials
HspB reaction was shown to be succinate, with isotope labeling and found in natural products that possess important biological
experiments providing direct evidence that the newly intro- activities. Organic chemical synthesis of pyridine compounds is
duced oxygen atom of succinate is derived from H O. Phyloge- commonly accompanied by the formation of by-products
2
netic analysis reveals that HspB is the most closely related to two (6–8), resulting in prohibitively high costs for the pure
p-nitrophenol 4-monooxygenases, and the experimental results chemicals; thus, biocatalysis is an attractive alternative syn-
exhibit that p-nitrophenol is a substrate of HspB. The reduction thetic technology, allowing in some cases reactions that are
of HspB (with maxima at 375 and 460 nm, and a shoulder at 485 not easily conducted by classical organic chemistry (9).
nm) by NADH was followed by stopped-flow spectroscopy, and Information on biocatalytic enzymes involved in the metab-
the rate constant for reduction was shown to be stimulated by olism of pyridine derivatives is sparse (10) despite their ubiq-
HSP. Reduced HspB reacts with oxygen to form a C -(hy- uity in the environment (11).
(4a)
dro)peroxyflavin intermediate with an absorbance maximum at
Pyridine-ring hydroxylation monooxygenases can be subdi-
ϳ400 nm within the first few milliseconds before converting to vided according to whether they catalyze ␣-, ␤-, or ␥-hydroxy-
the oxidized flavoenzyme species. The formed C -hydroper- lation of the pyridine ring (Fig. 1A). In contrast to benzene, the
(4a)
oxyflavin intermediate reacts with HSP to form an intermediate electron density is unevenly distributed over the pyridine ring,
that hydrolyzes to the products 2,5-dihydroxypyridine and suc- which thus influences the positional reactivity and the interac-
cinate. The investigation on the catalytic mechanism of a flavo- tion with enzymes. Most of the reported pyridine ring ␣-hy-
protein pyridine-ring ␤-position hydroxylase provides useful droxylation monooxygenases are multicomponent molybde-
information for the biosynthesis of pyridine derivatives.
num-containing proteins (12–14). In addition to HspB (EC
.14.13.163), two other flavin-dependent pyridine-ring ␤-hy-
droxylation monooxygenases have been isolated and studied:
1
2
6
-Hydroxy-3-succinoyl-pyridine (HSP) 3-monooxygenase 6-hydroxynicotinate3-monooxygenase(6HN3M, EC1.14.13.114)
(
HspB), encoded by the first gene in the nic2 cluster involved in (12, 15) and 2,6-dihydroxypyridine 3-monooxygenase (DHPH, EC
.14.13.10) (16) (Fig. 1A). These three monooxygenases have
1
low sequence identities to each other (Fig. 2), and either they
are unable to transform the corresponding homocyclic analogs
or they exhibit low activity. Significantly, mechanistic informa-
tion is limited on pyridine ␤-hydroxylation monooxygenases;
e.g. no catalytic mechanism has been reported for any of these
enzymes.
*
This work was supported in part by grants from the Chinese National Natural
Science Foundation Grants 31230002, 31270154, and 31121064, “Shanghai
Rising-Star Program” Grant 13QA1401700, and the “Chen Xing” project from
Shanghai Jiao Tong University.
1
2
To whom correspondence should be addressed. Tel.: 86-21-34206647; Fax:
8
6-21-34206723; E-mail: pingxu@sjtu.edu.cn.
The abbreviations used are: HSP, 6-hydroxy-3-succinoyl-pyridine; HspB, HSP
-monooxygenase; 2,5-DHP, 2,5-dihydroxypyridine; 6HN3M, 6-hydroxynico-
3
tinate 3-monooxygenases; DHPH, 2,6-dihydroxypyridine 3-monooxygenase;
His-HspB, recombinant His-tagged HspB; SSA, succinate semialdehyde; SP,
PNP 4-monooxygenase; 4HPA1M, 4-hydroxyphenylacetate 1-monooxyge-
3-succinoyl-pyridine; ESI, electrospray ionization; PNP, p-nitrophenol; PnpA,
nase; PHB1H, p-hydroxybenzoate 1-hydroxylase; CT, charge-transfer.
2
9158 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 289•NUMBER 42•OCTOBER 17, 2014

Mechanism of 6-Hydroxy-3-succinoyl-pyridine 3-Monooxygenase
tive half-reaction (21–25). The enzyme-FAD complexes are
first reduced by NAD(P)H, and the reduced enzymes then react
with oxygen to form a C -(hydro)peroxyflavin species. These
(
4a)
oxidants have been proposed to react with the substrates,
resulting in the formation of products and the C -hydroxy-
(
4a)
flavin that dehydrates to the oxidized flavin. Flavin-dependent
monooxygenases have been studied for over 40 years, and many
of these enzymes are well understood in terms of structures,
kinetics, and mechanisms (21, 26, 27). Nevertheless, additional
enzymes with new biochemical properties are likely to be
uncovered, particularly those involved in the metabolism of
pyridine derivatives.
In this study, we present the characterization of heterolo-
gously expressed His-tagged HspB (His-HspB) from Esche-
richia coli cells. The second product of HspB reaction, previ-
ously suggested to be succinate semialdehyde (SSA) (1), is
shown here to be succinic acid with the added oxygen atom
derived from solvent rather than O . Transient kinetics of the
2
reductive and oxidative half-reactions of His-HspB in the pres-
ence and absence of HSP (as well as with the product 2,5-DHP
and the alternate substrate p-nitrophenol) were investigated to
reveal mechanistic insights about the unique reaction catalyzed
by this flavoprotein. A scheme for the catalytic mechanism is
proposed. This study establishes key features of the catalytic
mechanism of HspB that will likely apply to related enzymes,
thus offering a new catalytic potential for the metabolism of
pyridine derivatives.
EXPERIMENTAL PROCEDURES
Materials—HSP was produced as previously described (28).
ϩ
FAD, NADH, and NAD were purchased from Sigma. 2,5-
DHP was purchased from SynChem OHG (Kassel Corp., Kas-
1
8
sel, Germany). H O was obtained from the Shanghai
2
Research Institute of Chemical Industry (Shanghai, China). All
other regents and solvents used in this study were of analytical
FIGURE 1. Reactions of several flavin-dependent monooxygenases. A,
␤
DHPH. B, enzymes acting on benzene ring-containing substrates: PnpA,
-hydroxylases acting on pyridine-containing substrates: HspB, 6HN3M, and grade and commercially available. P. putida S16 can be
obtained from the German Culture Collection (DSMZ, Braun-
schweig, Germany) under the accession number DSM 28022.
Overexpression and Purification of Heterologously Expressed
4
HPA1M, and PHB1H.
Flavin-dependent monooxygenases constitute a large family
of flavoenzymes, and more than 130 members have been His-HspB—The DNA fragment containing hspB was amplified
described since 1957 (17). These enzymes have been classified by Pfu DNA polymerase (New England Biolabs, Ipswich, MA)
into eight groups, labeled A through H. A phylogenetic analysis using DNA primers hspB-H-F (ATACCATGGTGAGCA-
of selected flavin-dependent monooxygenases (Fig. 2) reveals TGAAACAGCGCGTAAT) and hspB-H-R (GTGCTCGA-
that HspB is associated with the group A enzymes, even though GAAAGGTTTCCATAGTCTCTGGAA). PCR products,
it contains two Rossmann-folds (i.e. nucleotide binding sites treated with NcoI and XhoI, were ligated into the expression
with the characteristic “GXGXXG(X)
(E/D)” motif), which vector pET28a (Invitrogen), which was treated with the same
16–17
is a property of group B flavin-dependent monooxygenases. HspB endonucleases. The reconstructed plasmid pET28a-hspB was
exhibits the highest sequence identity with the flavoenzymes transferred into E. coli BL21(DE3) cells for heterologous
that use non-pyridine-containing substrates: PnpA from Pseu- expression. Recombinant E. coli strains were grown at 37 ºC in
domonas sp. WBC-3 (18), PnpA2 from P. putida DLL-E4 (19), Luria-Broth medium containing 50 ␮g of kanamycin/ml. The
and 4-hydroxyphenylacetate 1-monooxygenase (4HPA1M) culture was induced by adding 0.2 mM isopropyl ␤-D-thiogalac-
from Ralstonia solanacearum (20). These enzymes, along with topyranoside until reaching an A
between 0.6 and 0.8, and
6
00 nm
p-hydroxybenzoate 1-monooxygenase (PHB1H), catalyze ring then the culture was grown at 16 ºC for 10 h. E. coli cells were
hydroxylations para to an existing hydroxyl group (Fig. 1B), harvested by centrifugation and re-suspended in 20 mM Tris-
similar to the pyridine ring ␤-hydroxylases noted above (Fig. HCl (pH 8.0) buffer. Cells were disrupted by ultrasonication
1
A).
and His-HspB was purified on a His-Trap column using a liquid
Flavin-dependent monooxygenases have catalytic reactions chromatography system (AKTA, GE Healthcare) following
that involve two steps: a reductive half-reaction and an oxida- standard procedures. The eluted sample was loaded onto a
OCTOBER 17, 2014•VOLUME 289•NUMBER 42
JOURNAL OF BIOLOGICAL CHEMISTRY 29159

Mechanism of 6-Hydroxy-3-succinoyl-pyridine 3-Monooxygenase
FIGURE 2. Phylogenetic analysis of HspB. A, sequences of regions surrounding the two Rossmann-fold motifs of HspB. B, phylogenetic tree of HspB with
selected group A/B flavin-dependent monooxygenases constructed by using the neighbor-joining method (see “Experimental Procedures”). GenBank acces-
sion numbers or protein IDs are shown at the end of each name. The lengths of the lines are proportional to the genetic distance between proteins. The bar
represents 0.2 amino acid substitutions per site, and the tree is unrooted. BVMO, Baeyer-Villiger monooxygenase; FMO, flavin-containing monooxygenase.
Superdex 200 column that had been pre-equilibrated with 20 mM Tris-HCl, pH 8.0). Spectra were recorded using a UV-2550
mM Tris-HCl (pH 8.0) buffer. The collected His-HspB was pre- spectrophotometer.
served at Ϫ70 ºC for further study.
To estimate the uncoupling reaction of His-HspB with (or
Enzyme Assays—To test the in vitro activity of His-HspB, without) substrates, hydrogen peroxide production was mea-
HSP and NADH were mixed with the recombinant enzyme in sured. Specifically, 100 ␮l of enzyme reaction mixture (1 ␮M
air-saturated 20 mM Tris-HCl buffer (pH 8.0) at 25 ºC. The enzyme, 250 ␮M HSP, 200 ␮M NADH, in Tris-HCl buffer (pH
decrease in absorbance at 340 nm, which was monitored by 8.0) with continuous aeration) was terminated after 5 min and
using a UV-2550 spectrophotometer (Shimadzu, Kyoto, Japan) combined with 700 ␮l of detection solution (5 mM 4-aminoan-
TM
Ϫ1
or a 96-well plate reader (Victor X3, 2030 Multilabel Reader, tipyrene, 10 mM vanillic acid, and 40 units ml horseradish
PerkinElmer Life Sciences), was used to calculate the enzyme peroxidase in 0.2 M NaCl and 0.2 M MOPS (pH 7.5)). The com-
activity of HspB. The activity of His-HspB with 3-succinoyl- bined mixture was incubated at 37 ºC for 5 min. The absorb-
pyridine (SP) was determined under the same conditions. In ance was recorded at 498 nm to detect the product resulting
some experiments His-HspB powder was used, obtained by from the generation of H O .
2
2
1
8
using vacuum freeze-drying methods.
Product Analysis and O Isotope Experiments—The prod-
Anerobic reduction of protein-bound FAD was performed in ucts of the His-HspB reaction, which was terminated by addi-
an anaerobic work station AW200SG (Electrotek, Sheffield, tion of 9 volumes of methanol, were confirmed by HPLC and
UK). All compounds were dissolved in oxygen-free buffer (20 reanalyzed by liquid chromatography-mass spectrometry (LC-
2
9160 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 289•NUMBER 42•OCTOBER 17, 2014

Mechanism of 6-Hydroxy-3-succinoyl-pyridine 3-Monooxygenase
MS) with electrospray ionization (ESI) (1). Negative and posi-
tive ion ESI mass spectra were both obtained to detect HSP,
succinate, and 2,5-DHP.
To confirm the source of the oxygen atom incorporated into
18
succinate, H O was used as a solvent for the His-HspB reac-
2
tion. An assay mixture containing His-HspB dried powder and
1
8
substrates was dissolved in H O and incubated at room FIGURE 3. Biochemical characterization of purified His-HspB. A, SDS-PAGE
2
of purified recombinant His-tagged HspB. M, protein markers (in kDa); 1, His-
HspB. B and C, kinetic studies of His-HspB with varied concentrations of HSP
temperature for 10 min. After termination of the reaction by
adding 9 volumes of methanol, samples were analyzed using
(
using 250 ␮M NADH) and NADH (using 250 ␮M HSP), respectively, with the
LC-ESI-MS.
data fitted to the Michaelis-Menten equation.
Rapid Reaction Experiments—Reactions were carried out in
Ϫ1
5
0 mM Tris-HCl (pH 7.5) buffer at 4 ºC, unless otherwise spec- min . Retention time and absorption spectra were compared
ified. Rapid kinetics measurements were performed with a with standard compounds for each run to identify the sub-
SFM-4000 stopped-flow apparatus (Bio-logic, France) installed strates or products. ESI-MS analysis was performed on an Agi-
in an anaerobic glove box. Temperature was controlled by using lent 6230 time of flight-MS equipped with ESI sources. Samples
a temperature-controlled bath JULABO model F12 (Julabo, were diluted to the appropriate concentrations with methanol,
Seelbach, Germany). Spectral scans were recorded with a TIDIS filtered through a 0.22-␮m membrane filter, and then loaded
S 300K diode array detector (J&M Analytik AG, Germany). The into the mass spectrometer in 40% (v/v) methanol (0.1% formic
Ϫ1
optical path length was 1 cm. Oxygen in the solutions was acid, v/v) and 60% (v/v) deionized water (18 megohm cm
)
Ϫ1
removed by flushing the flow system with an anaerobic buffer (0.05% formic acid, v/v) at a flow rate of 0.2 ml min
.
Ϫ1
solution containing 40 units ml of glucose oxidase, 400 units
Ϫ1
RESULTS
ml of catalase, and 100 mM glucose in 50 mM Tris-HCl (pH
7
.5) buffer. Apparent rate constants (k ) were calculated by
Characterization of Heterologously Expressed His-tagged
obs
fitting the kinetic traces to a sum of two exponentials using the HspB—We previously reported that HspB expression in the
software program Origin 8.0. Changes in flavin absorption were native strain of P. putida S16 is poor (ϳ0.4% (w/w) of total
monitored at 2.2-nm intervals from 200 to 700 nm.
protein) (1), precluding extensive mechanistic studies of the
To study the kinetics of reduction of the enzyme by NADH, a enzyme. Here, the highly expressed His-HspB version of the
solution of oxidized His-HspB in the presence or absence of protein was purified to more than 95% homogeneity from
HSP (or 2,5-DHP or p-nitrophenol (PNP)) with 100 mM glu- E. coli cells in two steps and characterized (Fig. 3A). Apparent
Ϫ1
Ϫ1
Ϫ1
cose, 40 units ml of glucose oxidase, and 400 units ml of HSP K and k values were 173 Ϯ 6.78 ␮M and 7.74 Ϯ 0.12 s
m
cat
catalase was loaded into the stopped-flow instrument. The (Fig. 3B, using 250 ␮M NADH), respectively, for His-HspB.
enzyme complex was mixed (in a 1:1 ratio) with varied concen- Apparent NADH K and k values (Fig. 3C, using 250 ␮M
m
cat
Ϫ1
trations of NADH prepared in anaerobic 50 mM Tris-HCl (pH HSP) were 29.4 Ϯ 2.97 ␮M and 5.49 Ϯ 0.34 s , respectively, for
Ϫ1
7
.5) buffer with 100 mM glucose, 40 units ml of glucose oxi- the tagged enzyme. Purified His-HspB was stored at Ϫ80 ºC as
Ϫ1
dase, and 400 units ml of catalase. All concentrations of sub- a frozen solution or dry powder with no change in activity for at
strates, product, and NADH used for rapid kinetic studies were least 3 months.
at least 7-fold higher than the enzyme concentration to main-
Product Analysis of the Oxidative Cleavage Reaction—The
tain pseudo-first order conditions. All absorbance traces were products of the reaction catalyzed by His-HspB were identified
monitored from 200 to 700 nm.
by comparison to the mass spectra (m/z) of standard com-
To study the oxidative half-reaction, His-HspB with or with- pounds using ESI-MS. SSA, previously identified as a product of
out HSP (or 2,5-DHP or PNP) was anaerobically reduced by 200 the enzymatic reaction (1), exhibits a [M-H]-deprotonated
␮
M NADH or 200 ␮M Na S O and loaded into the stopped- molecule m/z of 101.0246 (Fig. 4C); it is not oxidized to succi-
ϩ
2
2
4
flow equipment. The reduced enzyme complex was mixed with nate by HspB in the presence or absence of HSP and NAD
various concentrations of dioxygen (from 0.3 to 1.5 mM). The (Fig. 4, E and G). In contrast to the earlier interpretations, suc-
dioxygen solutions were prepared by sparging a solution of 50 cinate ([M-H]-deprotonated molecule m/z 117.0194; Fig. 4B)
mM Tris-HCl (pH 7.5) buffer with air or oxygen at 16 ºC. All was identified as the authentic second end product of HSP con-
absorbance traces were monitored from 200 to 700 nm.
version to 2,5-DHP by His-HspB (Fig. 4F), with no SSA
Sequence Analysis of HspB—Sequences of HspB and selected observed in the His-HspB-catalyzed reaction.
other flavin-dependent monooxygenases were aligned using
One oxygen atom is added to each of the two products (2,5-
CLUSTAL W software. A phylogenetic tree was constructed DHP and succinate) in the reaction of His-HspB. The source of
using the neighbor-joining method with a bootstrap of 1,000 the oxygen added to 2,5-DHP comes from gaseous oxygen
using the MEGA 5.0 program.
according to our previous labeling study (1). We extended this
Analytical Methods—Analytical HPLC in this study was per- approach to determine the source of the oxygen atom added to
formed on an Agilent 2100 HPLC instrument (Agilent, Santa succinate. Labeled and non-labeled H O was supplied as the
2
Clara, CA) equipped with an Eclipse XDB-C18 column (5 ␮m, solvent and both negative and positive ion modes of ESI-MS
4
.6 ϫ 250 mm, Keystone Scientific, Bellefonte, PA), diode array analysis were used to monitor label incorporation into HSP,
detection, and a mobile phase consisting of 80% (v/v) 1 mM 2,5-DHP, and succinate. The results confirmed that the oxygen
1
8
sulfuric acid and 20% (v/v) methanol at a flow rate of 0.5 ml introduced into 2,5-DHP was from dioxygen, because no O-
OCTOBER 17, 2014•VOLUME 289•NUMBER 42 JOURNAL OF BIOLOGICAL CHEMISTRY 29161

Mechanism of 6-Hydroxy-3-succinoyl-pyridine 3-Monooxygenase
FIGURE 4. MS analysis of substrates and products identified in the His-HspB-catalyzed reaction. A, reaction of HspB. B and C, succinate and SSA standards
analyzed by negative ionESI-MS. SSAwaspartially oxidized to succinateinthecommerciallyavailableSSA standards. D and E, succinate and SSA standards that
were incubated with NADH and His-HspB in the absence of HSP under aerobic conditions and analyzed as above. F, negative ion ESI-MS of the His-HspB
catalyzed reaction under standard conditions. G, similarly analyzed sample of the His-HspB catalyzed reaction with SSA included. H and I, negative ion ESI-MS
1
6
18
16
18
analysis of His-HspB reaction using H2 O and H2 O, respectively. J and K, positive ion ESI-MS results of the His-HspB reaction in H2 O and H2 O, respectively.
The identities of the symbols are shown below the panels.
labeled 2,5-DHP was observed in the H218O experiment (Fig. 4,
Substrate Specificity—Five substrates known to be used by
J and K), and they showed that all of the succinate produced in other flavin monooxygenases were examined as potential sub-
1
8
18
H
O contained one atom of O (Fig. 4, H and I). For compar- strates of His-HspB: SP (a precursor of HSP, missing only the
2
16
18
ison, samples of HSP dissolved in H O and H O both ring hydroxyl group; located in the nicotine degradation path-
2
2
yielded spectra with m/z 194.046 (Fig. 4, H and I), indicating a way used by strain S16), 2-hydroxypyridine, 2,6-dihydroxypyri-
lack of substitution between the carbonyl of HSP and H O. dine, and 6-hydroxynicotinate (substrates of the pyridine ␤-hy-
2
These results demonstrate the oxygen added to succinate orig- droxylases DHPH and 6HN3M), and PNP (the substrate of
inates from H O rather than from exchange into HSP, indicat- PnpA). These compounds were tested as substrates of His-
2
ing that H O is a substrate in the His-HspB-catalyzed reaction. HspB by using the standard assay conditions for the HspB reac-
2
The results of this labeling experiment lead us to conclude that tion. Of these compounds, His-HspB exhibited trace NADH
the second oxygen atom of molecular oxygen, i.e. the one not consumption activity with PNP (Fig. 5A), but no activity was
added to product, is reduced to H O as in other flavin-depen- detected with other substances (data not shown). PnpA is
2
dent monooxygenase-catalyzed reactions (24–26). H O is known to convert PNP to quinone (Fig. 1B) (18, 29), which is
2
therefore both a substrate and product of His-HspB. In sum- then reduced to the hydroquinone by PnpB or non-enzymati-
mary, His-HspB has one cofactor (FAD), four substrates cally by using NADH (data not shown). Non-enzymatic conver-
ϩ
(
NADH, HSP, oxygen, and H O), and four products (NAD , sion of PNP to hydroquinone by NADH was not observed (Fig.
2
2
,5-DHP, succinate, and H O) (Fig. 4A).
5B). Furthermore, formation of hydroquinone was not detected
2
2
9162 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 289•NUMBER 42•OCTOBER 17, 2014

Mechanism of 6-Hydroxy-3-succinoyl-pyridine 3-Monooxygenase
when using just His-HspB. In contrast, small amounts of PNP
were transformed by the enzyme into hydroquinone in the
additional presence of NADH according to HPLC determina-
tion (Fig. 5B). The amounts of NADH and PNP consumed by
His-HspB differ, indicating that some of the reducing potential
of the NADH may be partitioned to other products. Indeed,
H O determinations (Fig. 5C) revealed that the His-HspB
2
2
reaction with PNP generated more H O than when the
2
2
enzyme was incubated with only NADH. These results suggest
that PNP stimulates peroxide release.
Spectral Properties of Oxidized HspB and Analysis of HSP
Binding—His-HspB exhibits the spectrum expected of a flavo-
protein with absorbance maxima at 375 and 460 nm along with
a shoulder at ϳ485 nm (Fig. 6A). The His-HspB-catalyzed reac-
tion was not accelerated by addition of free FAD to the assay
mixture, indicating that the flavin cofactor is tightly bound to
the protein (30). The addition of 0.1% (w/v) SDS to His-HspB
for 10 min led to shifts in the spectrum that are representative
of free FAD (Fig. 6A). Based on the spectrum, a molar absorp-
Ϫ1
Ϫ1
tion coefficient of 10,170 M cm was estimated for His-
HspB at 460 nm and pH 8.0.
Static titration experiments were performed using 63 ␮M
His-HspB and 0–1,600 ␮M HSP to study the interaction
between the oxidized enzyme and substrate. Substrate addition
led to increases in absorbance at 390 and 450 nm along with
decreases at 499 nm (Fig. 6B). The calculated dissociation con-
stant (K ) of HSP was 480 Ϯ 36.7 ␮M, indicating a weak inter-
D
action between oxidized His-HspB and HSP.
The kinetics of substrate binding to the oxidized protein was
assessed by monitoring the absorbance changes at 441 nm (Fig.
7
A) and data were fitted to a single exponential. The k
obs
derived from the kinetic traces shows a linear dependence on
HSP concentration in the range of 0.2–2 mM, corresponding
with a second-order rate constant for HSP binding to enzyme of
4
Ϫ1 Ϫ1
(
3.21 Ϯ 0.16) ϫ 10
M
s
(Fig. 7B). The intercept of Fig. 7B
Ϫ1
provides an estimate for k of 6 s , so the K can be estimated
off
D
as k /k (ϳ190 ␮M), which is in reasonable agreement with
off on
that measured by static methods.
Reduction of His-HspB by NADH—His-HspB was mixed with
excess NADH or Na S O under anaerobic conditions. The
2
2
4
resulting spectra both revealed complete reduction of the flavin
(
Fig. 6C). After all of the His-HspB-bound FAD (100 ␮M) was
reduced by NADH or Na S O , HSP (200 ␮M) was added anaer-
2
2
4
obically, and after 10 min the reactions were terminated. No
transformation of HSP was detected by HPLC analysis, indicat-
ing that molecular oxygen is required for catalysis after the
enzyme complex is first reduced by NADH.
To examine the kinetics of reduction of the flavin cofactor by
FIGURE 5. Conversion of PNP to hydroquinone by His-HspB and NADH. A, NADH, equivalent volumes of oxidized His-HspB and NADH
enzyme activity (measured as NADH consumption) of His-HspB with different
were mixed anaerobically by using a stopped-flow spectropho-
substrates:a,negativecontrolwithHis-HspBand250␮M NADH;b,His-HspBincu-
bated with 250 ␮M PNP and 250 ␮M NADH; c, His-HspB incubated with 250 ␮M tometer. The absorbance of His-HspB decreased in a range
HSP and 250 ␮M NADH. The initial absorbance of the reaction was set to zero. B,
from 300 to 500 nm, and the reduction reactions were moni-
HPLCwithabsorbancedetection(210nm)ofPNPanditstransformationproduct
byHis-HspB.AsmallamountofPNP(retentiontimeof34.3min)wasconvertedto tored by the absorbance changes at 460 nm, a wavelength that
hydroquinone (retention time of 11.9 min) in this reaction. Dashed line, His-HspB
provides the maximum difference between oxidized and
incubated with 1 mM PNP and 2 mM NADH; solid line, His-HspB plus PNP; dashed
grayline,1mM PNPplus2mM NADH.Thesampleswereincubatedfor20minwith reduced His-HspB (Fig. 8A, inset). The traces obtained for sam-
intermittent aeration before HPLC analysis. C, H O production in His-HspB reac-
2
2
ples prepared under different conditions were best fitted to
tions with different substrates. The reactions (His-HspB with 1 mM NADH and 1.5
mM HSP; His-HspB with 1 mM NADH; His-HspB with 1 mM NADH and 1.5 mM PNP)
were performed for 20 min with intermittent aeration.
two-exponentials. The k for 48.4 ␮M His-HspB mixed with
obs
Ϫ1
20 mM NADH was 1.02 Ϯ 0.08 s (Fig. 8A, line a). The inclu-
OCTOBER 17, 2014•VOLUME 289•NUMBER 42
JOURNAL OF BIOLOGICAL CHEMISTRY 29163

Mechanism of 6-Hydroxy-3-succinoyl-pyridine 3-Monooxygenase
FIGURE 7. Kinetics of HSP binding to oxidized His-HspB. A, the kinetics
associated with the binding of various concentrations (0.2, 0.4, 0.8, 1.2, and 2
mM, after mixing, from right to left) of native substrate, HSP, to oxidized His-
HspB (24.2 ␮M, after mixing) as monitored by stopped-flow spectrophotom-
eter at 441 nm. The His-HspB concentration was calculated according to the
Ϫ1
Ϫ1
molar absorption coefficient, 10,340 M cm , at 460 nm and pH 7.5. B, linear
dependence of the observed first-order rate constants on HSP
concentrations.
and NADH provided no further stimulation (line g, k
of
obs
obs
Ϫ1
1
46 Ϯ 4 s ), and this substrate was less effective at stimulating
reduction when pre-mixed only with NADH (line b, k
of
Ϫ1
2
9.8 Ϯ 1.5 s ), whereas PNP was nearly as effective when
Ϫ1
mixed only with NADH (line c, k of 11.6 Ϯ 0.9 s ). Overall,
obs
HSP is a better enhancer for HspB reduction compared with
PNP, and the flavin reduction rate constant with saturating
concentrations of NADH is stimulated by HSP by ϳ150-fold.
FIGURE 6. Spectral properties of His-HspB. The absorption spectra of His-
HspB (66.4 ␮M) were recorded in 50 mM Tris-HCl buffer (pH 8.0). A, absorption
spectra of native His-HspB (solid line) and sample that was unfolded by incu-
bation with 0.1% SDS for 10 min (dashed line). B, the flavin absorbance differ-
ence spectra of 63 ␮M His-HspB upon titration with HSP (25 ºC in 20 mM Tris-
HCl, pH 8.0) using His-HspB as a reference. Arrows indicate absorbance
changes in the presence of 25, 50, 100, 200, 400, 800, and 1600 ␮M HSP. The
inset shows the absorbance changes at 499 nm at different HSP concentra-
The k of the reduction of free enzyme with NADH and
obs
HSP (Fig. 8A, line b) was lower than that of the reduction of
His-HspB that was premixed with HSP (lines f and g). In addi-
tions for use in calculating the binding affinity. C, spectral properties of oxi- tion, the rate for binding of HSP (1 mM) to His-HspB (with k
obs
dized and reduced His-HspB. Oxidized His-HspB (solid line) was fully reduced
by the addition of 1.5 mM NADH (dotted line) or 1.5 mM Na S O (dashed line).
Ϫ1
of ϳ36.9 s ) is faster than the rate of reduction of free His-
HspB by NADH-HSP. These results suggested that formation
of the His-HspB-HSP complex was required prior to binding of
2
2 4
sion of product 2,5-DHP (2 mM) with enzyme prior to mixing NADH to attain the maximal stimulation of reduction. HspB
with NADH had only a minor influence on the rate of reduction has evolved to prevent the consumption of NADH and oxygen
Ϫ1
(
line d, k of 1.74 Ϯ 0.06 s ); however, a pre-mixture of His- unless HSP is bound to the enzyme.
obs
HspB with 2 mM concentrations of substrates HSP (line f) or
The kinetics of His-HspB flavin reduction by various concen-
PNP (line e) led to marked stimulations of the observed reduc- trations of NADH in the absence of substrate were examined by
tion rate constants by NADH (k of 152 Ϯ 5 and 14.2 Ϯ 0.6 anaerobically monitoring the absorbance changes at 460 nm
obs
Ϫ1
s
, respectively) (Fig. 8A). Including HSP with both enzyme upon mixing (Fig. 8B). The k associated with the major phase
obs
2
9164 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 289•NUMBER 42•OCTOBER 17, 2014

Mechanism of 6-Hydroxy-3-succinoyl-pyridine 3-Monooxygenase
FIGURE 8. Kinetics of the reduction of His-HspB by NADH. All concentra-
tions indicated here are final concentrations after mixing. A, free His-HspB
24.2␮M)wasmixedwithanequalvolumeof10mM NADHalone(a), amixture
of 10 mM NADH and 1 mM HSP (b), or a mixture of 10 mM NADH and 1 mM PNP
c), respectively. His-HspB (24.2 ␮M), premixed with 1 mM 2,5-DHP (d), 1 mM
(
(
PNP (e), or 1 mM HSP (f), was mixed with an equal volume of 10 mM NADH.
His-HspB (24.2 ␮M) that had been pre-mixed with 1 mM HSP was mixed with
an equal volume of a mixture of 10 mM NADH and 1 mM HSP (g). The inset
shows the absorption spectra collected with mixing times ranging from 10
ms to 10 s for the His-HspB reduction reaction (a). B, His-HspB (24.2 ␮M) was
mixed with equal volumes of solutions of NADH at concentrations of 0.3, 0.6,
1
.2, 2.4, 5, and 10 mM (from right to left, respectively) in 50 mM Tris-HCl, pH 7.5,
at 4 ºC and monitored at 460 nm. Data were fitted with two exponentials. The
inset shows that kobs exhibits a hyperbolic dependence on NADH
concentration.
FIGURE 9. Kinetics of the reduction of His-HspB in the presence of HSP by
of reduction, accounting for ϳ95% of the total amplitude, NADH. All concentrations indicated here are final concentrations after mix-
ing. A, solutions containing His-HspB (24.2 ␮M) and HSP (1 mM) were mixed
with equal volumes of solutions of NADH at concentrations of 0.15, 0.6, 1.2,
exhibited a hyperbolic dependence on NADH concentration.
Ϫ1
The limiting value of k was 1.12 Ϯ 0.01 s and the NADH 2.4, 5, and 10 mM (traces from right to left, respectively) under anaerobic
obs
conditions. Data are fitted to two exponentials. The inset shows that kobs of
concentration at half-saturation (i.e. the dissociation constant
the main phase was hyperbolically dependent on NADH concentration. B,
the absorption changes at 700 nm under different conditions, under reac-
NADH
K
) was 0.72 Ϯ 0.03 mM. No evidence was observed for an
d
absorption associated with a charge-transfer (CT) complex, tion conditions with the same letter, were essentially the same as
described in the legend of Fig. 8A, and show the formation and decay of a
typically observed in the 500–700 nm range.
CT complex. C, the absorption spectra collected with mixing times ranging
To investigate the kinetics of flavin reduction for substrate- from 10 to 1,000 ms, showing the observed CT complex with an absorb-
ance in 500–700 nm range.
bound enzyme, solutions of oxidized His-HspB and HSP were
anaerobically mixed with different concentrations of NADH
while monitoring the absorbance changes at 460 nm (Fig. 9A). tively. A CT complex was observed in the reductive half-reac-
The predominantly monophasic reduction phases provided tion of His-HspB in the presence of HSP over the absorbance
observed rate constants showing a hyperbolic dependence on range of 500–700 nm (Fig. 9C). By contrast, no corresponding
NADH concentration. The limiting value of k and the calcu- CT complex was detected without HSP or with product 2,5-
obs
NADH
Ϫ1
lated K
were 156 Ϯ 1 s and 0.17 Ϯ 0.01 mM, respec- DHP or the alternate substrate PNP.
d
OCTOBER 17, 2014•VOLUME 289•NUMBER 42
JOURNAL OF BIOLOGICAL CHEMISTRY 29165

Mechanism of 6-Hydroxy-3-succinoyl-pyridine 3-Monooxygenase
Ϫ1
The kinetics of CT formation (k
ϭ 382 Ϯ 90 s
)
obs-formation
Ϫ1
and decay (k
ϭ 23.3 Ϯ 1.1 s ) were assessed by moni-
obs-decay
toring the absorbance changes at 700 nm for the reduction
reaction of His-HspB by NADH in the presence of HSP (Fig.
9
B). The reduction of the flavin cofactor (characterized by a
major decrease in absorbance at 460 nm) was accompanied
by CT formation (resulting in a small increase at 700 nm)
(
Fig. 9, A and B). This was followed by decay of the CT
complex after 20 ms.
Free H O Does Not Catalyze the His-HspB Reaction—In the
2
2
absence of HSP, the reduced FAD cofactor of His-HspB is rap-
idly reoxidized by air, consistent with the enzyme acting as an
NADH oxidase that generates H O with k of (23.5 Ϯ 1.33) ϫ
2
2
obs
Ϫ4 Ϫ1
1
0
s
(when using 250 ␮M NADH and 17.6 ␮M HspB). To
ϩ
determine whether H O (as the E-FAD-NAD -H O com-
2
2
2
2
plex) can serve as the oxygenating species for transformation of
HSP, an anaerobic assay mixture containing His-HspB (15 ␮M),
ϩ
NAD (0.5 mM), H O (0.5 mM), and HSP (400 ␮M) was incu-
2
2
bated at room temperature. After 10 min, the reaction was ter-
minated under anaerobic conditions. No HSP transformation
was detected by HPLC analysis (data not shown). His-HspB
cannot catalyze the transformation of HSP with exogenous
H O , indicating that the flavin C -(hydro)peroxide interme-
2
2
(4a)
diate is probably the true oxygenating species. No H O was
2
2
detected in the His-HspB-catalyzed reaction when using excess
HSP under aerobic conditions (data not shown), indicating that
HSP likely stabilizes the proposed C -(hydro)peroxyflavin
(
4a)
intermediate and prevents its decomposition to free H O .
2
2
FIGURE 10. Kinetics of the oxidation of reduced His-HspB by dioxygen. All
concentrations indicated here are final concentrations after mixing. A, His-
Kinetics of Oxidation of His-HspB—In the oxidative half-re-
action of flavin-dependent monooxygenases, the reduced HspB(24.2␮M)thathadbeenreducedby100 ␮M NADH(a)or100␮M Na
S O
2 2 4
(
b) was mixed with an equal volume of oxygen-saturated buffer (50 mM Tris-
enzyme reacts with oxygen to form a C -(hydro)peroxyflavin
(
4a)
HCl, pH 7.5) at 4 ºC. A solution of His-HspB (24.2 ␮M) and HSP (1 mM), previ-
species that can persist from a few milliseconds to hours. The ously reduced by 100 ␮M NADH (c) or 100 ␮M Na S O (d), was mixed with an
2
2 4
equal volume of oxygen-saturated buffer. A solution of His-HspB (24.2 ␮M)
and 2,5-DHP (1 mM) that was reduced by 100 ␮M NADH was mixed with an
C
-intermediates have been proposed to react with the sub-
(
4a)
strates, resulting in the formation of products (26). To investi-
equal volume of oxygen-saturated buffer (e). B, solutions of His-HspB contain-
ϩ
gate the oxidative half-reaction of the HspB reaction, 48.4 ␮M ing different concentrations of NAD , reduced by 100 ␮M Na S O , were
2
2 4
mixed with an equal volume of oxygen-saturated buffer. The samples were
monitored at 460 nm.
His-HspB (reduced with 200 ␮M NADH or 200 ␮M Na S O )
2
2
4
was mixed with equal volumes of oxygen-saturated buffers
using a stopped-flow spectrophotometer under anaerobic
conditions. No C -(hydro)peroxyflavin intermediate was vision of substrate HSP during the oxidation of NADH-reduced
(4a)
detected in the absence of HSP (lines a and b of Fig. 10A). All HspB yielded biphasic kinetics (line c, Fig. 10A), whereas the
wavelengths gave similar observed rate constants (data not Na S O -reduced enzyme yielded similar kinetics whether
2
2
4
shown). The results indicated that the putative C -interme- HSP was present or not (compare lines b and d, Fig. 10A).
(
4a)
diate formed too slowly or decayed too rapidly to be detected
The kinetics of oxidation for NADH-reduced His-HspB in
for this condition. Rather, the reduced enzyme samples were the presence of HSP was examined more extensively by analysis
directly transformed to the fully oxidized protein (k of 22.2 Ϯ over the entire spectrum. Within the first milliseconds after
obs
Ϫ1
0
.3 and 23.1 Ϯ 1.0 s , respectively).
mixing, an intermediate appeared with a peak at ϳ400 nm
The effects of various additives on the oxidative half-reaction (Fig. 11, A and B). This species is consistent with the presence
ϩ
were assessed. The presence of varied concentrations of NAD
of a C -(hydro)peroxyflavin that in other flavin-dependent
(
4a)
with Na S O -reduced His-HspB had no effect on the observed monooxygenases generally has an absorbance maximum
2
2
4
rate constant of flavin oxidation (k of 23.1 Ϯ 1.0, 21.0 Ϯ 0.6, between 360 and 410 nm. The C -intermediate was only
obs
(4a)
Ϫ1
ϩ
and 21.4 Ϯ 0.4 s , for 0, 50 ␮M, and 1 mM NAD , respectively, observed in the presence of HSP, and was not detected with
ϩ
Fig. 10B). These results imply that NAD binds very weakly to PNP or 2,5-DHP (data not shown) in the reaction. The results
reduced HspB or likely leaves upon flavin reduction, as noted suggest that HSP stabilizes the C -intermediate. Although
(
4a)
for other group A flavin-dependent monooxygenases (26, 31). PNP stimulates the reduction of HspB, it does not appear to
Similarly, 2,5-DHP has no influence on the rate constant of stabilize the C -intermediate; rather, as shown earlier (Fig. 5)
(
4a)
Ϫ1
His-HspB oxidation (k of 23.3 Ϯ 1.3 s , line e of Fig. 10A) PNP enhances the NADH oxidase activity of HspB.
obs
and no spectral intermediates were observed during the oxida-
The kinetics of His-HspB oxidation with oxygen-saturated
tion reaction in the presence of this product. In contrast, pro- buffer (1.5 mM) in the presence of HSP showed two phases.
2
9166 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 289•NUMBER 42•OCTOBER 17, 2014

Mechanism of 6-Hydroxy-3-succinoyl-pyridine 3-Monooxygenase
FIGURE 11. Time-dependent spectral changes during oxidation of His-HspB in the presence of HSP. All concentrations indicated here are final concen-
trations after mixing. A, absorbance spectra collected with mixing times ranging from 10 ms to 4 s for the oxidation of His-HspB (24.2 ␮M), reduced by 100 ␮M
NADH, containing 1 mM HSP when mixed with an equal volume of oxygen-saturated buffer (50 mM Tris-HCl, pH 7.5). B, (top) formation of the C(4a)-(hydro)per-
oxyflavin as shown by an increase of absorbance at 400 nm. These difference spectra were calculated by subtracting the initial spectrum obtained at 1 ms.
Bottom, consumption of NADH as shown by a decrease of absorbance at 340 nm. These difference spectra were calculated by subtracting the spectrum
obtained at 100 ms. C, kinetics of the formation of the C(4a)-(hydro)peroxyflavin (400 nm), consumption of NADH (340 nm), and oxidation of the His-HspB flavin
(460 nm). The oxidation reaction of His-HspB with oxygen-saturated buffer was performed in the absence (top) or presence (bottom) of HSP. D, a solution of
His-HspB (24.2 ␮M) and HSP (1 mM), reduced by stoichiometric amounts of NADH, was mixed with an equal volume of buffer containing various concentration
of oxygen. The oxidized flavin species were monitored at 400 nm (top) and 460 nm (bottom). The insets show that kobs values of C(4a)-intermediate formation
and the oxidative reaction both exhibit hyperbolic dependence on oxygen concentration.
Phase 1 (10–30 ms) was characterized by an increase in absor- situation led to no absorbance change at 400 and 460 nm; how-
bance at 400 nm (Fig. 11C, bottom), representing the formation ever, a major decrease in absorbance at 340 nm was observed.
of the C -intermediate. Phase 2 (from 50 ms to the end of the On the basis of the intensity of the absorbance at 460 nm during
(4a)
reaction) was characterized by a secondary increase in absorb- this stage, we conclude that these turnover conditions lead to
ance at 460 nm (oxidized flavin) and a decrease in absorbance at ϳ53% His-HspB being in the oxidized form. In the final stage of
3
40 nm (consumption of excess NADH) (Fig. 11C, bottom). In phase 2 (from 600 ms to the end), NADH was exhausted and the
the initial stage of phase 2 (50 ms-150 ms), a small decrease in
C
-intermediate was oxidized to FAD with excess oxygen so
(
4a)
absorbance at 400 nm was observed, accompanying the larger that an increase in a range from 370 to 500 nm was observed.
decrease in absorbance at 340 nm and the increase in absorb- Formation of the C -intermediate and the oxidative reaction
(
4a)
ance at 460 nm. During this phase, the C -intermediate is of His-HspB (reduced with stoichiometric amount of NADH)
(
4a)
proposed to be converted to oxidized His-HspB at a rate that is both exhibited hyperbolic dependences on oxygen concentra-
greater than the reduction of oxidized His-HspB by NADH. In tion when monitored at 460 and 400 nm, respectively, corre-
Ϫ1
the middle stage of phase 2 (150–600 ms), an equilibrium was sponding to limiting values of k of 213 Ϯ 2 and 41.4 Ϯ 2.7 s
,
obs
established between the reduction and oxidative process. This respectively (Fig. 11D). Decay of the C -intermediate was not
(
4a)
OCTOBER 17, 2014•VOLUME 289•NUMBER 42
JOURNAL OF BIOLOGICAL CHEMISTRY 29167

Mechanism of 6-Hydroxy-3-succinoyl-pyridine 3-Monooxygenase
FIGURE 12. Proposed mechanism of the HspB-catalyzed reaction. In the reductive half-reaction, the FAD in HspB is reduced by NADH to form a reduced
enzyme complex. In the first step of the oxidative half-reaction, the reduced flavin reacts with oxygen (red) to form a C(4a)-hydroperoxyflavin possibly with the
intermediacy of a C(4a)-peroxyflavin that becomes protonated. A resonance structure of deprotonated HSP, with selected carbons labeled, having partial
anionic character on C-3 of the pyridine ring reacts with the hydroperoxyflavin to yield intermediate 1. Hydration of the carbonyl group by a hydroxide shown
in blue leads to intermediate 2, which is transformed through a retro-aldol mechanism to generate 2,5-DHP and succinate.
observed from 370 to 460 nm, indicating that k of the flavin reactions is analogous to that used in the conversion of cyclo-
obs
Ϫ1
oxidation (41.4 s ) may represent the rate constant of C
-
hexanone to 6-hydroxyhexanoate by cyclohexanone monooxy-
genase (35), however, the latter reaction also requires a lacto-
nase to hydrolyze the intermediate. For the HspB reaction to
catalyze such a Baeyer-Villiger reaction the carbonyl group of
HSP would undergo nucleophilic attack by a C -peroxyflavin,
(
4a)
intermediate decay.
DISCUSSION
Flavin-dependent monooxygenases introduce a single oxy-
gen atom into their substrates, so these enzymes are ideal for
performing a critical step in the metabolism of pyridine deriv-
atives by activating the heterocycle (26, 32, 33). In the case of
HspB, the HSP-derived intermediate generated by oxygen addi-
tion decomposes by carbon-carbon bond cleavage that leads to
release of 2,5-DHP and the four-carbon product. In this study,
we identified succinate as this second product and showed by
(
4a)
followed by Criegee rearrangement to the ester intermediate
(35). The ester intermediate has not been detected in the reac-
tions using His-HspB, and there is no evidence of esterase activ-
ity associated with this enzyme. Furthermore, this chemistry
does not account for the ability of His-HspB to convert PNP to
the quinone. In the third hypothesis, the C -hydroperoxyfla-
(
4a)
vin reacts with the side chain-substituted carbon of the pyridine
ring (Fig. 12). As described in more detail below, this reaction is
consistent with all of our experimental results.
18
O-isotope labeling experiments that H O serves as the source
2
of the new oxygen atom incorporated into succinate. Here, we
identified an alternative substrate of the enzyme that provides
mechanistic insight and we investigated the reductive and
oxidative half-reactions by transient kinetic analyses to elu-
cidate the kinetic mechanism of HspB, thus providing an
understanding of the mechanism of pyridine-ring ␤-hy-
droxylation monooxygenases.
HspB, like the substrates of two other pyridine ␤-hydroxyla-
tion enzymes (DHPH and 6HN3M), possesses a C-6 hydroxyl
group (Fig. 1A). This observation suggests that the C-6
hydroxyl moiety may participate in the reaction. Indeed, we
showed that SP, an intermediate in the pyridine pathway prior
to the step catalyzed by HspB and lacking the C-6 hydroxyl
group, is not transformed by His-HspB. This result thus points
to the possibility of the hydroxyl group being essential for the
HspB catalytic reaction. Deprotonation of this hydroxyl group
for the three pyridine derivatives leads to quinoid-like com-
pounds with the charge partially delocalized to the carbon
opposite to the hydroxyl moiety. Attack of this nucleophilic
One can envision three possible hydroxylation schemes for
the conversion of HSP to 2,5-DHP and succinate. The first
hypothesis invokes an initial hydrolysis step to produce succi-
nate and 2-hydroxypyridine, with subsequent monooxygen-
ation of the heterocycle. Such a sequence of reactions is analo-
gous to the hydrolysis of 2,6-dihydroxypseudooxynicotine
followed by the flavoenzyme-catalyzed conversion of 2,6-dihy-
droxypyridine to 2,3,6-trihydroxypyridine in one well studied
nicotine pyridine degradation pathway (34). This proposal can
be dismissed because HspB does not convert HSP to the hydrol-
ysis products when incubated with His-HspB anaerobically and
carbon on the C -hydroperoxyflavin would generate the
(4a)
C
-hydroxide (which decays by loss of water to generate the
(4a)
oxidized flavin) and an unstable species (intermediate 1 in Fig.
2) that would favor hydrolysis involving a retro-aldol reaction
1
the enzyme cannot convert 2-hydroxypyridine to 2,5-dihy- due to the resulting rearomatization.
droxypyridine under aerobic conditions. The second hypothe-
Support for the above hypothesis is also provided by studies
sis for the HspB-catalyzed transformation of HSP assumes an with enzymes acting on non-pyridine, homocyclic compounds.
initial Baeyer-Villiger reaction to produce an ester intermedi- For example, PNP can be transformed into quinone by PnpA
ate, followed by hydrolysis to the products. This combination of (Fig. 1B). This transformation likely proceeds by reaction of the
2
9168 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 289•NUMBER 42•OCTOBER 17, 2014

Mechanism of 6-Hydroxy-3-succinoyl-pyridine 3-Monooxygenase
deprotonated substrate with hydroperoxyflavin to yield a qui- activation provides electron density at C-3 (the side chain-sub-
none-like species with the newly introduced hydroxide and the stituted carbon), which then reacts with the C -hydroperoxy-
(
4a)
nitro group on the same carbon; this intermediate decays to the flavin to yield a 3-hydroxy-substituted species (Intermediate 1
quinone with release of NO . Of interest, our HPLC results with in Fig. 12). Subsequent addition of water to the ketone (yield-
2
His-HspB was consistent with the same transformation of PNP ing Intermediate 2) accounts for the incorporation of solvent
to quinone, followed by spontaneous reduction of the quinone into the product succinate, formed by a retro-aldol reaction
to hydroquinone by NADH. Another example of an enzyme (40, 41). Thus, the amino acid sequence and several aspects
using this mechanism is PHB1H, which catalyzes the 1-hy- of its mechanism reveal that HspB belongs to the group A
droxylation of the homocyclic analog of 6-hydroxy-nicotinate. flavin-dependent monooxygenase family, despite having two
This enzyme is proposed to form a hydroperoxyflavin that per- Rossmann-folds.
forms an electrophilic attack on a resonance form of p-hy-
Organic synthesis of pyridine derivatives is commonly
droxybenzoate with partial anionic charge on the carbon to accompanied by the formation of by-products (42). In contrast,
which the carboxylate is attached; the resulting transient qui- the enzymes involved in microbial metabolism usually have
none intermediate undergoes decarboxylation accompanied by high substrate specificity and favor a single product. Bacterial
rearomatization to produce its product (Fig. 1B) (36). Finally, pyridine hydroxylation is ubiquitous in the environment (11);
the reaction catalyzed by 4HPA1M (Fig. 1B) also has been sug- however, biochemical studies of pyridine hydroxylases have
gested to involve formation of a quinoid intermediate in which been limited. This mechanistic study of HspB provides useful
the acetate moiety is located on the same carbon as the newly information that can be applied to the study of other pyridine
introduced oxygen atom; in this case the intermediate decays hydroxylases, thus expanding biotechnology applications in the
with acetyl group migration (37). These examples support the synthesis of pyridine derivatives.
hypothesis that HspB uses the mechanism shown in Fig. 12 and
In conclusion, this study reveals that HspB catalyzes a
is mechanistically similar to other group A flavin-dependent monooxygenation reaction that results in carbon-carbon cleav-
monooxygenases.
age during the transformation of HSP to 2,5-DHP and succi-
Several additional comments are noteworthy regarding the nate. The reaction kinetics elucidated the reaction mechanism
proposed HspB reaction shown in Fig. 12. In the reductive half- of HspB and demonstrated a role for HSP in stimulating the
reaction, the presence of HSP stimulates the rate constant of reductive half-reaction in catalysis. A C -oxygenated reac-
(
4a)
the NADH-catalyzed reduction reaction by ϳ150-fold. Such tion intermediate was directly observed and shown to be
stimulation of the reduction step by bound substrate is com- involved in the hydroxylation reaction. The C -hydroperoxy-
(
4a)
monly found in group A flavin-dependent monooxygenases flavin intermediate reacts with the side chain-substituted car-
(
38) where it serves as a mechanism to minimize the uncoupled bon of the pyridine ring to form a quinone-like intermediate,
reaction (where NADH is consumed as H O is produced) which is converted into the products through a retro-aldol rear-
2
2
when substrate is absent. Following reduction of the flavin, the rangement. Elucidation of the biochemical properties of HspB
ϩ
NAD is released from the protein, as demonstrated by similar not only supplements our understanding of the pyridine
ϩ
reaction kinetics regardless of the NAD concentration (Fig. hydroxylases, but also serves as a model for understanding
1
0B). Finally, a C -(hydro)peroxyflavin intermediate was other enzymes involved in the synthesis of pyridine derivatives.
(4a)
directly detected by transient spectroscopy of the oxidative
half-reaction when using enzyme samples incubated with HSP. Acknowledgment—We thank Luying Xun for helpful discussion
The C -intermediate is unstable and was only detected regarding this manuscript.
(4a)
within the first few milliseconds of the reaction. The absence of
this intermediate for samples lacking HSP suggest the substrate
acts to stabilize the C -intermediate. This intermediate reacts
REFERENCES
(4a)
1
. Tang, H., Yao, Y., Zhang, D., Meng, X., Wang, L., Yu, H., Ma, L., and Xu, P.
2011) A novel NADH-dependent and FAD-containing hydroxylase is
crucial for nicotine degradation by Pseudomonas putida. J. Biol. Chem.
86, 39179–39187
with HSP, resulting in the formation of products and presum-
(
ably the C -hydroxyflavin, which dehydrates to the oxidized
(4a)
flavin.
2
The overall reaction catalyzed by HspB is similar to that of
many other flavin-dependent monooxygenases: the oxidized
enzyme takes up its substrate, NADH binds, hydride transfer
takes place to generate the reduced enzyme complex, and
2
3
4
. Wang, S. N., Liu, Z., Tang, H. Z., Meng, J., and Xu, P. (2007) Character-
ization of environmentally friendly nicotine degradation by Pseudomonas
putida biotype A strain S16. Microbiology 153, 1556–1565
. Yu, H., Tang, H., Wang, L., Yao, Y., Wu, G., and Xu, P. (2011) Complete
genome sequence of the nicotine-degrading Pseudomonas putida strain
S16. J. Bacteriol. 193, 5541–5542
ϩ
NAD is released (26, 39). The reduced enzyme complex then
activates oxygen to form the C -peroxyflavin, which is then
(
4a)
. Tang, H., Wang, L., Wang, W., Yu, H., Zhang, K., Yao, Y., and Xu, P. (2013)
Systematic unraveling of the unsolved pathway of nicotine degradation in
Pseudomonas. PLoS Genet. 9, e1003923
protonated, or it directly forms a C -hydroperoxyflavin. This
(
4a)
species decays to generate hydrogen peroxide in the absence of
substrate (as seen for HspB lacking HSP or in the presence of
the poor substrate PNP). The binding of substrate stabilizes the
5. Peng, Q., Warloe, T., Berg, K., Moan, J., Kongshaug, M., Giercksky, K. E.,
and Nesland, J. M. (1997) 5-Aminolevulinic acid-based photodynamic
therapy: clinical research and future challenges. Cancer 79, 2282–2308
C
-hydroperoxyflavin, thus facilitating further steps in the
(4a)
6
. Bull, J. A., Mousseau, J. J., Pelletier, G., and Charette, A. B. (2012) Synthesis
of pyridine and dihydropyridine derivatives by regio- and stereoselective
addition to N-activated pyridines. Chem. Rev. 112, 2642–2713
enzymatic reaction. In the case of HspB, HSP is likely to be
activated by an active site residue that forms a hydrogen bond
with or deprotonates the C-6-hydroxy group (Fig. 12). This
7. Wu, X. F., Neumann, H., and Beller, M. (2013) Synthesis of heterocycles
OCTOBER 17, 2014•VOLUME 289•NUMBER 42
JOURNAL OF BIOLOGICAL CHEMISTRY 29169

Mechanism of 6-Hydroxy-3-succinoyl-pyridine 3-Monooxygenase
via palladium-catalyzed carbonylations. Chem. Rev. 113, 1–35
. Liu, C., Luo, J., Xu, L., and Huo, Z. (2013) Synthesis of 2-substituted pyri-
dines from pyridine N-oxides. ARKIVOC 1, 154–174
25. Walsh, C. T., and Wencewicz, T. A. (2013) Flavoenzymes: versatile cata-
8
9
lysts in biosynthetic pathways. Nat. Prod. Rep. 30, 175–200
26. van Berkel, W. J., Kamerbeek, N. M., and Fraaije, M. W. (2006) Flavopro-
tein monooxygenases, a diverse class of oxidative biocatalysts. J. Biotech-
nol. 124, 670–689
. Petersen, M., and Kiener, A. (1999) Biocatalysis. Green Chem. 1, 99–106
1
1
1
0. Kaiser, J. P., Feng, Y., and Bollag, J. M. (1996) Microbial metabolism of
pyridine, quinoline, acridine, and their derivatives under aerobic and an- 27. Joosten, V., and van Berkel, W. J. (2007) Flavoenzymes. Curr. Opin. Chem.
aerobic conditions. Microbiol. Rev. 60, 483–498
Biol. 11, 195–202
1. Sun, J. Q., Xu, L., Tang, Y. Q., Chen, F. M., Zhao, J. J., and Wu, X. L. (2014) 28. Wang, S. N., Xu, P., Tang, H. Z., Meng, J., Liu, X. L., and Qing, C. (2005)
Bacterial pyridine hydroxylation is ubiquitous in environment. Appl. Mi-
crobiol. Biotechnol. 98, 455–464
“Green” route to 6-hydroxy-3-succinoyl-pyridine from (S)-nicotine of to-
bacco waste by whole cells of a Pseudomonas sp. Environ. Sci. Technol. 39,
2. Jiménez, J. I., Canales, A., Jiménez-Barbero, J., Ginalski, K., Rychlewski, L.,
García, J. L., and Díaz, E. (2008) Deciphering the genetic determinants for
aerobic nicotinic acid degradation: the nic cluster from Pseudomonas
putida KT2440. Proc. Natl. Acad. Sci. U.S.A. 105, 11329–11334
3. Grether-Beck, S., Igloi, G. L., Pust, S., Schilz, E., Decker, K., and Brandsch,
R. (1994) Structural analysis and molybdenum-dependent expression of
the pAO1-encoded nicotine dehydrogenase genes of Arthrobacter nicoti-
novorans. Mol. Microbiol. 13, 929–936
6
877–6880
2
9. Wei, Q., Liu, H., Zhang, J. J., Wang, S. H., Xiao, Y., and Zhou, N. Y. (2010)
Characterization of a para-nitrophenol catabolic cluster in Pseudomonas
sp. strain NyZ402 and construction of an engineered strain capable of
simultaneously mineralizing both para- and ortho-nitrophenols. Biodeg-
radation 21, 575–584
1
3
0. Kamerbeek, N. M., Moonen, M. J., Van Der Ven, J. G., Van Berkel, W. J.,
Fraaije, M. W., and Janssen, D. B. (2001) 4-Hydroxyacetophenone mo-
nooxygenase from Pseudomonas fluorescens ACB: a novel flavoprotein
catalyzing Baeyer-Villiger oxidation of aromatic compounds. Eur.
J. Biochem. 268, 2547–2557
1
1
4. Hille, R. (2005) Molybdenum-containing hydroxylases. Arch. Biochem.
Biophys. 433, 107–116
5. Nakano, H., Wieser, M., Hurh, B., Kawai, T., Yoshida, T., Yamane, T., and
Nagasawa, T. (1999) Purification, characterization and gene cloning of
3
1. Sucharitakul, J., Tongsook, C., Pakotiprapha, D., van Berkel, W. J., and Chai-
yen, P. (2013)Thereactionkineticsof3-hydroxybenzoate6-hydroxylasefrom
Rhodococcus jostii RHA1 provide an understanding of the para-hydroxyla-
tion enzyme catalytic cycle. J. Biol. Chem. 288, 35210–35221
6
-hydroxynicotinate 3-monooxygenase from Pseudomonas fluorescens
TN5. Eur. J. Biochem. 260, 120–126
1
1
1
6. Treiber, N., and Schulz, G. E. (2008) Structure of 2,6-dihydroxypyridine
3
9
-hydroxylase from a nicotine-degrading pathway. J. Mol. Biol. 379,
3
2. Torres Pazmiño, D. E., Winkler, M., Glieder, A., and Fraaije, M. W. (2010)
Monooxygenases as biocatalysts: classification, mechanistic aspects and
biotechnological applications. J. Biotechnol. 146, 9–24
4–104
7. Huijbers, M. M., Montersino, S., Westphal, A. H., Tischler, D., and van
Berkel, W. J. (2014) Flavin dependent monooxygenases. Arch. Biochem.
Biophys. 544, 2–17
3
3
3
3
3. Fraaije, M. W., and Mattevi, A. (2000) Flavoenzymes: diverse catalysts
with recurrent features. Trends Biochem. Sci. 25, 126–132
8. Zhang, J. J., Liu, H., Xiao, Y., Zhang, X. E., and Zhou, N. Y. (2009) Identi-
fication and characterization of catabolic para-nitrophenol 4-monooxy-
genase and para-benzoquinone reductase from Pseudomonas sp. strain
WBC-3. J. Bacteriol. 191, 2703–2710
4. Brandsch, R. (2006) Microbiology and biochemistry of nicotine degrada-
tion. Appl. Microbiol. Biotechnol. 69, 493–498
5. Leisch, H., Morley, K., and Lau, P. C. (2011) Baeyer-Villiger monooxyge-
nases: more than just green chemistry. Chem. Rev. 111, 4165–4222
6. Eppink, M. H., Boeren, S. A., Vervoort, J., and van Berkel, W. J. (1997)
Purification and properties of 4-hydroxybenzoate 1-hydroxylase (decar-
boxylating), a novel flavin adenine dinucleotide-dependent monooxyge-
nase from Candida parapsilosis CBS604. J. Bacteriol. 179, 6680–6687
7. Hareland, W. A., Crawford, R. L., Chapman, P. J., and Dagley, S. (1975)
Metabolic function and properties of 4-hydroxyphenylacetic acid 1-hy-
droxylase from Pseudomonas acidovorans. J. Bacteriol. 121, 272–285
8. Gadda, G. (2012) Handbook of Flavoproteins (Hille, R., Miller, S., and
Palfey, B., eds) Walter de Gruyter, Berlin
1
9. Shen, W., Liu, W., Zhang, J., Tao, J., Deng, H., Cao, H., and Cui, Z. (2010)
Cloning and characterization of a gene cluster involved in the catabolism
of p-nitrophenol from Pseudomonas putida DLL-E4. Bioresour. Technol.
101, 7516–7522
2
0. Gabriel, D. W., Allen, C., Schell, M., Denny, T. P., Greenberg, J. T., Duan,
Y. P., Flores-Cruz, Z., Huang, Q., Clifford, J. M., Presting, G., González,
E. T., Reddy, J., Elphinstone, J., Swanson, J., Yao, J., Mulholland, V., Liu, L.,
Farmerie, W., Patnaikuni, M., Balogh, B., Norman, D., Alvarez, A., Cas-
tillo, J. A., Jones, J., Saddler, G., Walunas, T., Zhukov, A., and Mikhailova,
N. (2006) Identification of open reading frames unique to a select agent:
Ralstonia solanacearum race 3 biovar 2. Mol. Plant Microbe Interact. 19,
3
3
3
9. Romero, E., Fedkenheuer, M., Chocklett, S. W., Qi, J., Oppenheimer, M.,
and Sobrado, P. (2012) Dual role of NADP(H) in the reaction of a flavin-
dependent N-hydroxylating monooxygenase. Biochim. Biophys. Acta
6
9–79
2
1. Ghisla, S., and Massey, V. (1989) Mechanisms of flavoprotein-catalyzed
reactions. Eur. J. Biochem. 181, 1–17
1824, 850–857
2
2. Beaty, N. B., and Ballou, D. P. (1981) The oxidative half-reaction of liver
microsomal FAD-containing monooxygenase. J. Biol. Chem. 256,
40. Jiang, L., Althoff, E. A., Clemente, F. R., Doyle, L., Röthlisberger, D., Zang-
hellini, A., Gallaher, J. L., Betker, J. L., Tanaka, F., Barbas, C. F., 3rd, Hilvert,
D., Houk, K. N., Stoddard, B. L., and Baker, D. (2008) De novo computa-
tional design of retro-aldol enzymes. Science 319, 1387–1391
4
619–4625
2
2
3. Beaty, N. B., and Ballou, D. P. (1981) The reductive half-reaction of liver
microsomal FAD-containing monooxygenase. J. Biol. Chem. 256, 41. Wan, P., and Muralidharan, S. (1988) Structure and mechanism in the
4
611–4618
photo-retro-aldol type reactions of nitrobenzyl derivatives: Photochemi-
cal heterolytic cleavage of C-C bonds. J. Am. Chem. Soc. 110, 4336–4345
42. Hill, M. D. (2010) Recent strategies for the synthesis of pyridine deriva-
tives. Chemistry 16, 12052–12062
4. Crozier-Reabe, K., and Moran, G. R. (2012) Form follows function: struc-
tural and catalytic variation in the class A flavoprotein monooxygenases.
Int. J. Mol. Sci. 13, 15601–15639
2
9170 JOURNAL OF BIOLOGICAL CHEMISTRY
VOLUME 289•NUMBER 42•OCTOBER 17, 2014