Design, synthesis and biological evaluation of novel indole-benzimidazole hybrids targeting estrogen receptor alpha (ER-α)

Article abstract of DOI:10.1016/j.ejmech.2018.01.051

In the course of efforts to develop novel selective estrogen receptor modulators (SERMs), indole-benzimidazole hybrids were designed and synthesised by fusing the indole nucleus with benzimidazole. All the compounds were first inspected for anti-prolifera

Full text of DOI:10.1016/j.ejmech.2018.01.051

European Journal of Medicinal Chemistry 146 (2018) 206e219
Contents lists available at ScienceDirect
European Journal of Medicinal Chemistry
journal homepage: http://www.elsevier.com/locate/ejmech
Research paper
Design, synthesis and biological evaluation of novel indole-
benzimidazole hybrids targeting estrogen receptor alpha (ER-
a
)
a
b
c
b
a, *
Ramit Singla , Kunj Bihari Gupta , Shishir Upadhyay , Monisha Dhiman , Vikas Jaitak
a
Centre for Pharmaceutical Sciences and Natural Products, Central University of Punjab, Bathinda, India
Centre for Biochemistry and Microbial Sciences, Central University of Punjab, Bathinda, India
Centre for Animal Sciences, Central University of Punjab, Bathinda, India
b
c
a r t i c l e i n f o
a b s t r a c t
Article history:
Received 11 August 2017
Received in revised form
In the course of efforts to develop novel selective estrogen receptor modulators (SERMs), indole-
benzimidazole hybrids were designed and synthesised by fusing the indole nucleus with benzimid-
azole. All the compounds were first inspected for anti-proliferative activity using ER-
breast cancer cell lines and ER- binding assay. From this study, two representative bromo substituted
compounds 5f and 8f were found to be most active and thus were escalated for gene expression studies
for targeting ER- . Cell imaging experiment clearly suggest that compounds were able to cross cell
membrane and accumulate thus causing cytotoxicity. RT-PCR and Western blotting experiments further
supported that both compounds altered the expression of mRNA and receptor protein of ER- , thereby
a responsive T47D
15 January 2018
a
Accepted 16 January 2018
a
Keywords:
Breast cancer
Estrogen receptor alpha
Induced fit
Indole-benzimidazole hybrids
RT-PCR
a
preventing the further transactivation and signalling pathway in T47D cells lines. Structural investigation
from induced fit simulation study suggest that compound 5f and 8f bind in antagonistic conformation
similar to bazedoxifene by extensive hydrogen bonding and Van der Waals forces. All these results
strongly indicate that compound 5f and 8f represents a novel potent ER-a antagonist properties and will
Western blotting
proved promising in the discovery of SERM for the management of breast cancer.
©
2018 Elsevier Masson SAS. All rights reserved.
1
. Introduction
resistance [6]. In the case of BC, this non-genomic signalling can
involve full length receptor or other isoform as well as cross talks
with other growth factor receptor or cytoplasmic kinases such as
Src [7].
Breast cancer (BC) is the most common malignancy and deadly
cancer which occupies second place after lung cancer, in the list of
cancers with the highest mortality rates among women [1]. Hor-
monal therapy is the first line treatment used in the treatment of
estrogen-sensitive BC. As the majority of BC is primarily estrogen-
dependent, and its propensity of incidence is approximately 55%
in pre-menopausal women and 75% in post-menopausal women.
This therapy efficiently blocks the stimulating effect of estrogen in
BC [2]. At least 70% of BC patients are categorized as having estro-
gen receptor (ER) positive cancer because growth of the tumour
Selective Estrogen Receptor Modulators (SERMs) are chemical
entities which reduces the action of estrogen by binding to ER (ER
a
or ER subtypes) in cells [8]. Tamoxifen is a first generation of SERM
b
which significantly reduces the incidence of BC. Although, tamox-
ifen served as a benchmark in the treatment of BC, but its usage was
limited due to stimulatory effects on endometrial cells, increased
the risk of development and progression of endometrial cancer and
resistance [4,9]. Second generation SERM were developed for
reducing the incidence of uterine cancer associated with usage of
tamoxifen have also reported side effects like instigates hot flashes,
intensified risk of blood clots, deep vein thrombosis and pulmonary
embolism. In view of toxicity and adverse effects associated with
these drugs bazedoxifene a third-generation SERM was introduced
for the treatment of BC and osteoporosis [4,10]. Bazedoxifene was
developed combining the essential pharmacophoric features of
raloxifene, by substituting the benzothiophene core of raloxifene by
cells occurs by ER-
ER- dimerizes, binds to estrogen response element (ERE) of DNA,
and undergoes a conformational change in the ligand binding
domain which further facilitates the recruitment of coactivators
a activation [3]. In response to estrogen binding,
a
[
4,5]. In addition to genomic signalling, it is accepted that ER-
a has
non-genomic signalling functions, which correlate with multidrug
*
Corresponding author.
E-mail address: vikas.jaitak@cup.edu.in (V. Jaitak).
indole [11]. Bazedoxifene binds to both ER-a and ER-b, but with a
https://doi.org/10.1016/j.ejmech.2018.01.051
223-5234/© 2018 Elsevier Masson SAS. All rights reserved.
0

R. Singla et al. / European Journal of Medicinal Chemistry 146 (2018) 206e219
207
slightly higher affinity for ER-
inhibitory effect of bazedoxifene is associated with ER-
a
. It has been reported that the
down-
group of benzimidazole moiety acts as hydrogen bond donor in the
receptor cavity of target ER- [28]. Therefore, we proposed that N-
a
a
regulation and cell cycle arrest [4]. Recently, bazedoxifene in
combination with palbociclib have been used for treatment of
metastatic BC at stage IV [12,13].
benzylated indole-benzimidazole hybrids (5) and N-H indole-
benzimidazole hybrids (8), pharmacophore designed on the basis
of structural feature of indole and benzimidazole derivatives may
act as a potential antiproliferative agents targeting BC (Fig. 1).
The N-benzylated indole-benzimidazole hybrids (5a-j) and N-H
indole-benzimidazole hybrids (8) were synthesised by the general
route with high to moderate yields as described in Scheme 1 and
Scheme 2 respectively. The N-position of the starting material ethyl
indole-2-carboxylate (1) was benzylated using benzyl bromide in
the presence of potassium hydroxide using DMSO as polar aprotic
solvent to give ethyl-1-benzyl-1H-indole-2-carboxylate (2). Com-
pound 2 was reduced to (1-benzyl-1H-indol-2-yl)methanol (3) in
One of the main objectives of medicinal chemistry from its very
inception has been the search for new compounds that exhibit
novel physical, chemical and biological properties. Combination of
structural features of two or more functionally active substances
into one molecule may lead to synergism, enhancement or mod-
ulation of the desired characteristics of individual components.
Another tempting feature of this approach is molecular hybrids
which can also address the problem of incidence of drug resistance
[
14]. As single molecule containing more than one pharmacophore,
each with different mode of action, could be beneficial for the
treatment of cancer and can reduce the chances of drug resistance
presence of LiAlH
oxidised to 1-benzyl-1H-indole-2-carbaldehyde (4) by using acti-
vated manganese dioxide in dry CH Cl . For the synthesis of N-
4
under dry THF conditions. Compound 3 was
[
15e17]. Recently isatin-quinazoline hybrids have been synthesized
2
2
and have shown promising antiproliferative activity against liver
HepG2, breast MCF-7, and colon HT-29 cancer cell lines [18].
It has been reported that 2-arylindole derivative are selective
benzylated indole-benzimidazole hybrids (5), the intermolecular
cyclisation of 4 with corresponding diamine in presence of TEA
yielded ten compounds (5a-j). It should be noted that compounds
5a-j hitherto unknown in chemical literature and were purified
using flash chromatography and unambiguously characterised
towards the ER-
and uterus tissues [19]. Further, benzimidazole derivatives have
been developed for targeting ER- by diminishing ERE response in a
a and antagonize the action of oestradiol in BC cells
1
13
a
spectroscopically using H, C- NMR, IR and HRMS.
dose dependent manner [10]. Taking these structural features in
account, in the present study we have designed and synthesised
new synthetic indole-benzimdazole hybrids as putative SERM for
N-H indole-benzimidazole derivatives (8a-k) were synthesised
from starting material ethyl indole-2-carboxylate (1), which was
reduced to (1H-indol-2-yl) methanol (6) in presence of LiAlH
dry THF. Compound 6 was oxidised to 1H-indole-2-carbaldehyde
(7), by using activated manganese dioxide and dry CH Cl . For the
4
and
targeting ER-
HDBC). The synthesised molecules were characterised by NMR, IR
and HRMS. Compounds were analysed for the anticancer activity
using ER- expressing T47D cell lines, ER- binding assay, semi-
a for the management of hormone dependent BC
(
2
2
synthesis of N-H indole-benzimidazole derivatives (8), the inter-
molecular cyclisation of 7 with corresponding diamine in presence
of TEA yielded the target eleven N-H indole-benzimidazole de-
a
a
quantitative RT-PCR, western blotting and confocal microscopy.
Molecular docking was used to identify, the possible binding modes
1
rivatives (8a-k). The synthesised derivatives were analysed by H,
13
of indole-benzimdazole hybrids with ER-
a.
C- NMR, IR and HRMS.
2
. Results and discussion
2.2. Biological evaluation of indole-benzimidazole derivatives
2.1. Design and synthesis of indole-benzimidazole derivatives
HDBC is primarily due to the overexpression of ER- a and
diminishing activity of ER-
which shows dominant expression of ER-
b
. The T47D cell lines is a BC cell line,
(9/1 ratio of ER- /ER-b
Indole based compounds have a tremendous potential for the
a
a
development of chemotherapeutic agents. By the virtue of struc-
tural analysis, it has been found that 1-benzyl-indole-3-carbinol,
which is an analog of indole-3-carbinol (I3C) was found to be
thousand times more potent in comparison to indole-3-carbinol in
suppression of both estrogen dependent and independent BC cell
lines [20]. 2-arylindole derivative have shown one hundred thirty
expression), hence a well-accepted model for HDBC [29,30].
Therefore, T47D cell lines were utilised in the initial screening of
the synthesised molecules for targeting BC. All the twenty one
synthesised N-benzylated indole-benzimidazole derivatives (5)
and N-H indole-benzimidazole derivatives (8) were evaluated for
the antiproliferative activity using MTT assay at 1, 5, 25
centration and bazedoxifene is taken as standard drug.
mM con-
times fold selectivity towards the ER-
a
(human ER-
59 nM) and antagonize the action of estradiol in MCF-7 (IC50
0 nM) cancer cells and uterus tissues [19]. ERA923 is an indole
a/b IC50 2/
2
3
The anti-proliferative activity of most of the compounds was
comparable to bazedoxifene (16.43 ± 0.94 M). 5f, 5g, 8a, 8c and 8f
m
derivative anti-estrogenic compound, equally effective as tamox-
ifen and overcome the resistance associated with tamoxifen, tested
in-vitro and in-vivo [21]. Recent developments on 2-substituted
benzimidazoles have revealed that varied heterocycles at 2-
position yielded potent anticancer agents at various carcinoma
cell lines [22e24]. It has been observed that majority of classical
SERMs approved for targeting BC contains OH or F [25] function-
alisation. In our designed compounds we have applied the concept
of monovalent bioisosteres. In medicinal chemistry, bioisosteres are
chemical substituents or groups with similar physical or chemical
properties which produce broadly similar biological properties to
another chemical compound. In the present hybrids the NH serves
as a monovalent bioisosteres for the OH [26], which serves the
purpose of OH in SERMs for interaction with the essential amino
showed marked anti-proliferative activity as compared to baze-
doxifene. While other derivatives 5b, 5c, 5h, 8b, 8e, 8g and 8h have
shown moderate antiproliferative activity (Table 1, Fig. 2). Com-
pounds have shown dose dependent increase in anti-proliferative
activity (Fig. 2). Upon analysing the structural features, it is
evident that bromo substituted carbocylic D-ring (5f,8f) was found
to be more active as compared to the bromo substituted hetero-
cyclic D-ring (5e, 5i, 8e, 8j). For evaluating the cytotoxicity of the
compound on the normal cell lines, all the compounds were
screened on human PBMCs (Peripheral Blood Mononuclear Cells)
using MTT assay, the results indicated that all the compounds were
showing non-significant cytotoxicity even at higher concentration
of 100
have ER-
were screened for determining their binding affinity towards ER-
ER- competitor assay kit (Polar Screen ER- Competitor Assay Kit,
Green, Life Technology) was used to determine the binding affinity.
mM. The prerequisite requirement of SERM compound is to
a
binding affinity, therefore all the synthesised compounds
acids residues present in the active site of ER-
a
. The striking feature
a.
of the derivatives having potential anticancer activity is aromatic
substitution at 2-position of benzimidazole [27] and free amino
a
a

208
R. Singla et al. / European Journal of Medicinal Chemistry 146 (2018) 206e219
Fig. 1. Designing strategy of N-benzylated indole-benzimidazole hybrids (5) and N-H indole-benzimidazole hybrids (8).
ꢀ
Scheme 1. Reagent and conditions (a) Benzyl bromide, KOH, DMSO, 1.5 h (b) LiAlH
absolute ethanol, reflux 12 h.
4
, dry THF, 0 C, 30 min (c) activated MnO
2
, dry CH
2
Cl
2
, r.t., 5 h (d) corresponding diamine,
ꢀ
Scheme 2. Reagent and conditions (a) LiAlH
4
, dry THF, 0 C, 30 min (b), activated MnO
2
, dry CH
2
Cl
2
, r.t., 5 h (c) corresponding diamine, absolute ethanol, reflux 12 h.

R. Singla et al. / European Journal of Medicinal Chemistry 146 (2018) 206e219
209
Table 1
Structure and biological evaluation of the synthesised indole-benzimidazole derivatives.
S.No
1
Code
5a
Anti-proliferative activity using T47D cell line, IC50
ND
¼
mM
Binding affinity with ER-
387.37 ± 13.12
a
, IC50 ¼ nM
Structure
2
3
5b
5c
21.8 ± 1.86
33.13 ± 5.37
21.45 ± 0.60
259.16 ± 26.42
4
5
5d
5e
ND
ND
ND
300.43 ± 10.40
6
5f
15.48 ± 0.10
73.61 ± 3.25
7
8
5g
5h
13.44 ± 0.04
22.5 ± 2.12
ND
76.73 ± 6.35
9
5i
5j
ND
ND
539.18 ± 34.79
10
ND
1
1
1
2
8a
8b
8.9 ± 0.57
191.69 ± 14.99
24.8 ± 0.66
ND
1
1
1
3
4
5
8c
8d
8e
6.2 ± 0.88
ND
ND
46.88 ± 0.95
21.03 ± 0.03
ND
16
8f
4.99 ± 0.60
80.36 ± 7.02
(
continued on next page)

210
R. Singla et al. / European Journal of Medicinal Chemistry 146 (2018) 206e219
Table 1 (continued )
S.No Code
Anti-proliferative activity using T47D cell line, IC50
¼
m
M
Binding affinity with ER-
a
, IC50 ¼ nM
Structure
17
8g
23.42 ± 0.07
ND
18
8h
20.47 ± 1.32
201.81 ± 5.19
1
2
9
0
8i
8j
21.16 ± 1.59
24.4 ± 0.84
ND
ND
21
8k
ND
ND
ND: Not determined as IC50 > 25 mM on T47D cell line and binding affinity IC50 > 1000 nM.
Fig. 2. MTT assay results showing potent and dose dependent anti-proliferative activity of synthesised compounds in comparison to bazedoxifene (positive control) on T47D cell
line for 48 h.
The assay is based on the phenomenon that if the compound under
investigation does not have affinity for the ER- , then it will not be
able to displace the Fluormone™ ES2 (fluorochrome tagged oes-
tradiol) from the ER- -Fluormone™ ES2 complex, thereby resulting
in a high fluorescence. On the contrary, if the compound has a
strong binding affinity for ER- , then it will displace the Fluo-
rmone™ ES2 ligand from ER- and resulting in a low fluorescence.
This change in the fluorescence provides the relative affinity for ER-
. Bazedoxifene (31.71 ± 1.41 nM) was also included as standard in
the study.
From the competitive binding assay, compounds 5f, 5h and 8f
were found to be most potent binding affinity with IC50 value
3.61 ± 3.25, 76.73 ± 6.35 and 80.36 ± 7.02 nM respectively. Com-
Upon comparing the results from anti-proliferative assay and
ER- binding assay, some compounds (5g, 8a, 8c) were showing
impressive anti-proliferative activity but a weak ER- binding af-
finity. These compounds may be acting via alternate mechanism
but not by targeting ER- . Similarly, compound 5b, 5h and 8d were
having a stronger binding affinity but were having weak anti-
proliferative activity. Compounds 5f and 8f were selected for
further studies as these compounds were showing both impressive
antiproliferative activity as well as binding affinity towards the ER-
a
a
a
a
a
a
a
a
a. Compounds 5f and 8f were escalated for confocal laser scanning
microscopy (CLSM), quantitative RT-PCR and Western blotting for
gene expression studies, from the group of N-benzylated indole-
benzimidazole derivatives and N-H indole-benzimidazole
derivatives.
7
pounds 8a, 8h, 5c, 5e, 5a and 5i were having a moderate binding
affinity with having IC50 191.69 ± 14.99, 201.81 ± 5.19,
It has been known that, ER-a is distributed in cytoplasm as well
2
5
59.16 ± 26.42,
300.43 ± 10.40,
387.37 ± 13.12
and
as nucleus [31]. In order to identify the distribution of the com-
pounds 5f and 8f in T47D cell lines CLSM was performed. The
compounds 5f and 8f have blue emission, so it was possible to
detect the compound in T47D cells without tagging with an addi-
tional fluorochrome. The DAPI excitation-emission channel was
used for evaluating its tendency to accumulate in T47D cell. The
confocal images indicated selective targeting of cytosol and plasma
membrane by the compounds 5f and 8f after 24 h incubation at 15
39.18 ± 34.79 nM respectively (Table 1). Remaining nine com-
pounds were having IC50 greater than 1000 nM. Upon comparative
analysis of the anti-proliferative activity and ER- binding affinity, it
was found that, N-benzylation overall improves the activity and is
important for ER- binding. Upon comparing 5e and 5f, it was
evident that if D-ring is heterocyclic in nature, then there will be
reduction in the activity. Additionally, bromo substituted com-
pounds (5f, 8f) are more active as compared to unsubstituted de-
rivatives (5c, 8c).
a
a
and 5
mM respectively. Both the compounds were able to cross the
cellular bio-membrane, but not able to enter the nucleus region of

R. Singla et al. / European Journal of Medicinal Chemistry 146 (2018) 206e219
211
Fig. 3. CLSM analysis of T47D cells after treating the cells with compound 5f and 8f for 24 h and untreated cells as a control (Scale bar, 10 mM).
cancer cell thereby preventing any possible interaction at tran-
scription level (Fig. 3). Thus, the confocal images undoubtedly
confirm that the compounds are able to interact with the proteins
present in the cytosol and plasma membrane. Thereby, obtained
results of cell imaging, support our concept of anti-cancer activity
completely inhibited in the cells treated with bazedoxifene, 5f and
8f T47D cell lines as compared to the control (untreated) cells. Thus,
it can be concluded that compounds 5f and 8f decreases the
expression of ER-a at the transcription level effectively similar to
the standard bazedoxifene, thereby downregulating the signalling
and transactivation pathways.
by targeting cytoplasmic and membrane bound ER-a by the syn-
thesized compounds.
ER-
signalling, SRC3/AIB1, and mTOR pathway in non-genomic path-
ways, thereby inhibition of the ER- protein can lead to enhanced
a mediated metastasis has been associated with chemokine
There is elevated levels of mRNA for ER-
If the drug molecules is active and have affinity for ER-
corresponds to decreased expression in mRNA levels of ER-
a
in BC progression [32].
which will
. Since,
a
a
a
management of BC [7]. Therefore, the semi-quantitative RT-PCR
the compounds 5f and 8f have shown anti-proliferative activity and
effective binding energy and were effectively able to target the
cytoplasmic and membrane proteins of the T47D cell line. We
results were confirmed for evaluating the effect of compounds 5f
and 8f on ER-a protein using Western blot analysis. The results
obtained in Western blot can be correlated with the mRNA
expression results obtained after semi-quantitative RT-PCR. The
Western blot image and the densitometry analysis (Fig. 5) shows
examined the effect of 5f and 8f on the abundance of mRNA of ER-
a
in human T47D cell lines. The mRNA level of ER- was determined
a
by semi-quantitative RT-PCR using specific primers chosen from
human DNA sequences and amplified in simpliAmp thermal cycler
that high levels of ER-
line. In contrast, expression of ER-
a
protein was present in the untreated cells
protein was reduced by 57.42%
a
(
Applied biosystem). The agarose gel image and the densitometric
and 27.5% in the T47D cells treated with compound 5f and 8f
respectively (Fig. 5). This signifies that, compound 5f and 8f not
analysis (Fig. 4) imply that the expression of the mRNA of ER- was
a
Fig. 4. mRNA expression profile of endogenous ER-
5, 15 and 5 M of bazedoxifene, 5f and 8f respectively for 48h. Data was normalised with GAPDH as an internal control, the results shown here are the representatives of three
different experiments.
a in the T47D cells line after treatment with bazedoxifene and synthesized compounds 5f and 8f. The cells were incubated with
1
m

212
R. Singla et al. / European Journal of Medicinal Chemistry 146 (2018) 206e219
Fig. 5. Western blot analysis of endogenous ER-
a
protein in the T47D cells after treatment with bazedoxifene, 5f and 8f. The cells line was incubated with 15, 15 and 5 mM of
bazedoxifene, 5f and 8f respectively for 48h. Data was normalised with b-actin as internal control, the results shown here are the representatives of three different experiments.
only downregulate the mRNA, but also reduces the protein levels of
ER- . Thus, synthesised compounds 5f and 8f exerts its anticancer
activity in T47D cells ER- and downregulating the expression of
mRNA and protein of ER-
Using the available X-ray crystallographic structure 4XI3, for
validation reasons co-crystalized bazedoxifene was also redocked
in their native protein structure (Fig. 6b). The superimposition of
the docked conformation and experimental structure of bazedox-
ifene shows that the docking model recapitulates the orientation of
the native ligand in the active site, and the consistent interactions
with the key amino acids of the binding cavity are formed with a
a
a
a.
2.3. Structural investigation
The architecture of ER-
independent transactivation domain, AF-1 (1e184),
a
includes N-terminal hormone-
highly
a
conserved DNA-binding, ERE (185e250), a hinge region (251e310)
which separates the DNA-binding domain from the ligand-binding
domain (LBD), a LBD that contains the hormone binding pocket
(
311e551), and a second transactivation domain AF2 (311e595) in
the C-terminus that is activated in response to ligand binding
Fig. 6a).
Molecular modelling study were carried out in an attempt to
understand the molecular basis of interaction of compounds 5f and
f with ER- . As the rigid docking protocol possesses some pros and
(
8
a
cons as it does not take account of the protein flexibility which has a
significant impact on the binding modes and the docking protocol.
Induced fit docking protocol is a ground-breaking protocol which
includes protein flexibility and at the same time reducing the
computational time without compromising with the accuracy in
the prediction of favourable binding mode and conformation of
ligand at the receptor site [33].
Fig. 7. Superposition of the docked structure of bazedoxifene (blue) with recrystallised
experimental pose of bazedoxifene (orange) in 4XI3 with 0.02 Å rmsd. (For interpre-
tation of the references to color in this figure legend, the reader is referred to the Web
version of this article.)
Fig. 6. (a) Crystal structure of ER-a with mesh representing the ligand binding domain, blue mesh represents hydrophilic region, green represent hydrophobic region, red positively
charged region, dark blue represents negatively charged region, (b) bazedoxifene docked at the receptor site. (For interpretation of the references to color in this figure legend, the
reader is referred to the Web version of this article.)

R. Singla et al. / European Journal of Medicinal Chemistry 146 (2018) 206e219
213
Fig. 8. (a) Superposition of bazedoxifene (blue) with compound 5f (orange) at receptor site (b) ligand interaction diagram of compound 5f (c) Superposition of bazedoxifene (blue)
with compound 8f (orange) at receptor site (d) ligand interaction diagram of compound 8f. (For interpretation of the references to color in this figure legend, the reader is referred
to the Web version of this article.)
ligand root mean square deviation of 0.02 Å compared with the
crystal structure (Fig. 7).
Upon analysing the induced fit simulation, compound 5f (Fig. 8a
and b) and 8f (Fig. 8c,d) have Van der Waals interaction with Met
346 by NH group (Fig. 8b). Hence, our rationally developed new
indole-benzimidazole derivatives can serve as a contemporary
potential lead in the developing SERMs.
It has been reported that the direct stimulation and cross talk of
3
43, Thr 347, Leu 349, Ala 350, Glu 353, Leu 354, Met 357 Trp 383,
Leu 384, Glu 385, Leu 387, Met 388, Leu 391, Arg 394, Leu 402, Phe
04, Met 421, Ile 424, Phe 425, Leu 428, Met 517, Ser 518, Gly 521,
Met 522, His 524, Leu 525, Met 528, Cys 530, Lys 531Val 534, Pro
35, Ser 536, Leu 539 Leu 540 and extensive H-bond integration
ER-a with other growth factors is an important mediator in BC
proliferation. In our present investigation the rationally developed
lead compounds 5f and 8f, exerts antiproliferation effect on T47D
4
cells line by reducing the expression of ER-
This indicates that the functional integrity of the ER-
by the treatment and it is a known fact that the ER- is in a dynamic
equilibrium in plasma membrane, cytoplasm and nucleoplasm, and
therefore ER- localised throughout these compartments is sought
to be affected. This distortion of the active conformation of ER-
a
at and mRNA level.
5
a
is disrupted
with Asp 351, Leu 346, Asn 532, Val 533 present at the receptor site.
Bazedoxifene, have also shown similar interaction with the amino
acids at the receptor site (Fig. 6b). Thus, from the induced fit
a
a
docking reveals that, compound 5f and 8f binds to ER-
a
in an
a
antagonistic orientation similar to bazedoxifene and have tendency
to form hydrophobic and hydrogen bond interaction lining the
binding cavity (Fig. 8a and c). It can be concluded that both the
compounds bind in antagonistic orientation similar with baze-
doxifene. It has been observed that, during the induced fit docking,
a number of residue adopt different conformations as compared to
leads to restricted genomic as well as the non-genomic down sig-
nalling pathways involved in the BC progression. Moreover, by the
initial SAR studies and docking analysis it can be inferenced that
bulky side chain as in compounds 5d, 5g and 8g leads to decreased
in the activity which may be attributed due to stearic hindrance at
the active site as indicated by the docking score (XP Lipophilic
EvdW score in Supplementary Table 1). Presence of heterocyclic D-
ring leads to the reduction in the activity (comparing 5e, 5f, 8e and
the experimental crystallographic structure of ER-
ligand binding domain is composed of the helix 6e16 and coil 4e17
311e551 aa) and most significant conformational change is found
a, code 4XI3. The
(
8f), which may be due to the decreased
presence of heteroatom in D-ring as compared to the benzene in D-
ring. These reduced -electron cloud leads to reduced hydrophobic
p-electron cloud due to
in coil 16 from helix 7,9 and 11. Further, in the recent reports the
interaction with amino acid Leu 346 present in the helix 12 of the
p
ER-
a
is found to be critical for the antagonistic activity [25], and
interaction at the receptor site (XP Lipophilic EvdW score in
Supplementary Table 1). The difference of the bromine atom in the
compound 5f is also exhibiting hydrogen bond interaction with Leu

214
R. Singla et al. / European Journal of Medicinal Chemistry 146 (2018) 206e219
compound 5c, 5f, 8c, 8f serve as a basis for the differential anti-
proliferative and ER- binding affinity. Herein, bromine serve as
effective bioisostere for CF [26]. Fluorine group present in fulves-
trant occupies a “lipophilic hole” in the ER protein (XP Lipophilic
EvdW score in Supplementary Table 1). The replaced fluorine group
with the bromine, will not only tend to retain the metabolic sta-
bility but also improved the occupancy of lipophilic site present in
the receptor.
to the stirring mixture. After the completion of the reaction (1.5 h)
as monitored by TLC the reaction mixture was cooled to 0 C.
ꢀ
a
3
Product was extracted with ethyl acetate, the organic layer was
washed using brine solution (40 mL). The combined organic layer
was dried over anhydrous sodium sulfate, filtered, concentrated
and was purified by isocratic flash column chromatography (pe-
troleum ether: ethyl acetate ¼ 9: 1, v/v) on silica gel (200e400) to
get pure compound 2 with 95% yield.
For the synthesis of 3, lithium aluminium hydride (2 mmol) was
ꢀ
3
. Conclusion
stirred in dry THF at 0 C. Then 2 (1 mmol) was dissolved in THF and
added drop wise to the solution of lithium aluminium hydride at
0 C. Then, the mixture was slowly warmed to room temperature
ꢀ
In summary, we described the chemical synthesis and in vitro
biological evaluation of novel indole-benzimidazole derivatives
designed to inhibit ER- and to act as SERMs. The N-benzylated
till the completion (0.5 h) of reaction as monitored by TLC. It was
then cooled to 0 C, 10% aqueous sodium hydroxide (20 mL) and
ꢀ
a
indole-benzimidazole derivatives (5) and N-H indole-
benzimidazole derivatives (8), were tested on estrogen-sensitive
40 mL of water was added successively. Then reaction mixture was
allowed to stir for 0.5 h, filtered through celite and washed with dry
ethyl acetate, dried over anhydrous sodium sulfate, concentrated
and purified by isocratic flash column chromatography (petroleum
ether: ethyl acetate ¼ 8: 2, v/v) on silica gel (200e400) to get pure
compound 3 with 98% yield.
BC T47D cells and ER-a binding assay to screen the compounds
bearing significant antiproliferative activity as well as high ER-
a
binding affinity. From the initial biological evaluation, it was
evident that bromo substituted compounds (5f, 8f) were most
active compounds and thereby escalated for gene expression
studies. Cell imaging results indicated that the cytotoxicity of
compounds 5f and 8f was attributed by targeting cytoplasmic and
For the synthesis of 4, compound 3 (1 mmol) was dissolved in
dry CH Cl (25 mL) was stirred briefly. Activated manganese diox-
2 2
ide (7.3 mmol) was added, stirred at room temperature for 4 h.
Another portion of activated manganese dioxide (5.9 mmol) was
added and stirred at room temperature for 0.5 h. After completion
of the reaction, as monitored by TLC, the reaction mixture was
filtered through Celite and washed with ethyl acetate, concentrated
and purified by isocratic flash chromatography (petroleum ether:
ethyl acetate 9.5: 0.5, v/v) on silica gel (200e400) to afford pure
compound 4 with 70% yield.
membrane bound ER-
Western blotting it was found that compounds 5f and 8f were able
to decrease the mRNA and protein expression of the target ER-
thereby decreasing the ER- activity. Results from the molecular
a. From the semi-quantitative RT-PCR and
a
,
a
simulation that, compounds 5f and 8f form extensive hydrophobic
and hydrogen bond interaction surrounding the binding cavity.
Both the compounds interact with the similar amino acids neigh-
boring the bazedoxifene hence, binds in the antagonistic confir-
mation similar to bazedoxifene. The result obtained in this study is
promising considering that compound 5f and 8f represents the
example of a indole-benzimidazole derivatives based inhibitor with
core SERM activity. This suggests that these compounds could be
used in future in vivo testing as a potent compound for the treat-
ment of HDBC.
4.1.3. General procedure for the synthesis of compounds 5a-i
Compound 4 (1 mmol) was taken in dissolved in ethanol in the
presence of triethylamine, and appropriate diamine (1 mmol). The
mixture was refluxed with stirring for 12 h and was monitored for
completion using TLC. The reaction was generally completed in
12e15 h. After the completion of the reaction, excess of ethanol was
removed under reduced pressure. The product was extracted using
ethyl acetate and organic layer was washed with distilled water.
The combined organic layer was dried over anhydrous sodium
sulfate, filtered, concentrated and purified by isocratic flash column
chromatography (petroleum ether: ethyl acetate ¼ 9.5: 0.5, v/v) on
silica gel (200e400) to afford pure N-benzylated indole-
benzimidazole derivatives (5a-i) in 55e88% yields. The structures
were confirmed by IR, NMR and HRMS.
4
4
4
. Experimental
.1. Chemistry
.1.1. General information
Starting materials and solvents were purchased from commer-
cial suppliers and used without further purification. Reaction
progress was monitored by TLC using silica gel 60 F254
(
2
0.040e0.063 mm) with detection by UV. Silica gel 60e120 and
00e400 was used for column chromatography and flash chro-
4.1.3.1. 2-(1-Benzyl-1H-indol-2-yl)-4-methyl-1H-benzo[d]imidazole
(5a). Dark brown solid; yield 76%; mp 107e108 C; IR (KBr): 3244,
ꢀ
1
13
matography respectively. H NMR and C NMR spectra were
recorded on a Jeol 400 MHz and Bruker 400 MHz spectrometer
using the residual signal of the deuterated solvent as internal
standard. Splitting patterns are described as singlet (s), doublet (d),
triplet (t) and broad (br); chemical shifts (d) are given in ppm. High-
resolution mass spectra (HRMS) were recorded on an Q-ToF Micro
Waters. Melting points were recorded on Stuart melting point
apparatus (SMP-30) with open glass capillary tube and were un-
corrected. IR spectra of compounds were recorded with KBr on a
Bruker FT-IR spectrophotometer.
3056 (N-H stretch), 2919 (¼C-H stretch), 2850, 1670 (C¼N), 1614
(C¼C), 1495 (N-H bending), 1295 (C-N stretch), 732 (N-H out of
ꢁ
1 1
plane) cm
; H NMR (400 MHz, DMSO) d 9.91 (1H, s), 7.68e7.62
(1H, m), 7.51e7.45 (1H, m), 7.41e7.33 (1H, m), 7.26e7.15 (4H, m),
7.12e7.03 (4H, m), 6.97e6.91 (1H, m), 5.82 (1H, s), 5.60 (2H, s), 1.24
13
(3H, s). C NMR (100 MHz, DMSO)
d 148.68, 139.50, 138.59, 137.89
(2C), 128.40, 128.28 (2C), 128.06, 127.08, 126.98, 126.77, 126.31 (2C),
126.09, 125.81, 124.35, 123.18, 122.12, 111.10, 110.22, 54.35, 17.34.
þ
[MþH]þ 338.1657; found:
HRMS(ESI):m/z calcd for C23
338.1657.
H
20
N
3
4
4
.1.2. General procedure for the synthesis of intermediates 2,3 and
4.1.3.2. 2-(1-Benzyl-1H-indol-2-yl)-4,6-dimethyl-1H-benzo[d]imid-
ꢀ
azole (5b). Pale white solid; yield 68%; mp 155e156 C; IR (KBr):
ꢁ1
Potassium hydroxide (4 mmol) was stirred in dried dimethyl
3394, 3059, 2920, 2857, 1623, 1582, 1495, 1332, 732 cm ; 1H NMR
(400 MHz, DMSO)
sulfoxide (25 mL) for 10 min in a round-bottom flask. Ethyl 1H-
indole-2-carboxylate 1 (1 mmol) was added to the solution and the
mixture was stirred for 0.5 h. Benzyl bromide (1.3 mmol) was added
d
9.88 (1H, br), 7.62e7.60 (1H, d, J ¼ 8 Hz),
7.35e7.32 (1H, m), 7.24e7.20 (1H, m), 7.15e7.11 (5H, m), 7.07e7.05
(2H, m), 6.95 (1H, s), 6.88 (1H, s), 6.09 (2H, s), 2.53 (3H, s), 2.39 (3H,

R. Singla et al. / European Journal of Medicinal Chemistry 146 (2018) 206e219
215
s); 13C NMR (100 MHz, CDCl3)
29.47, 128.64 (2C), 127.53, 127.10, 126.59 (2C), 125.02, 124.94,
d
144.54, 138.87, 138.49, 133.02,
C
26
H
20
N
3
[MþH]þ 374.1657; found: 374.1657.
1
1
23.47, 122.56, 121.21 (2C), 120.58, 110.78, 103.82, 99.99, 48.08,
4.1.3.8. 2-(1-Benzyl-1H-indol-2-yl)-5,6-dichloro-1H-benzo[d]imid-
azole (5h). Bright yellow solid; yield 58%; mp 119e120 C; IR
þ
[MþH]þ 352.1814;
ꢀ
21.65, 16.78. HRMS(ESI):m/z calcd for C24
H
22
N
3
found: 352.1817.
(KBr):3480, 3378, 3060, 2924, 1620, 1597, 1462, 1351, 1126,
ꢁ1
1
1
750 cm
; H NMR (400 MHz, CDCl ) H NMR (400 MHz, CDCl )
3
3
4
.1.3.3. 2-(1-Benzyl-1H-indol-2-yl)-1H-benzo[d]imidazole
(5c).
d
8.48 (1H, s), 7.74e7.72 (1H, d, J ¼ 8 Hz), 7.32e7.29 (2H, m),
ꢀ
Yellow solid; yield 55%; mp 117e118 C; IR (KBr):3474, 3374, 3028,
7.27e7.25 (1H, d, J ¼ 8 Hz), 7.24e7.21 (1H, m), 7.19e7.16 (1H, m), 7.11
ꢁ
1
13
2
925, 2867, 1620, 1599, 1492, 1351, 749 cm ; 1H NMR (400 MHz,
CDCl3)
8.58 (1H, s), 7.72e7.70 (1H, d, J ¼ 8 Hz), 7.32e7.29 (2H, m),
.26e7.24 (2H, m), 7.22e7.20 (1H, m), 7.17e7.14 (1H, m) 7.07e7.05
3H, m), 7.01e6.97 (2H, m), 6.72e6.69 (1H, m), 6.63e6.61 (1H, m),
.01 (2H, s). 13C NMR (100 MHz, CDCl3)
149.22, 142.18, 140.23,
38.85, 137.34, 135.73, 128.77 (2C), 127.58, 127.29, 127.02, 124.97
(1H, s), 7.03e7.01 (3H, m), 6.65 (1H, s), 5.95 (2H, s), 3.56 (1H, br). C
d
3
NMR (100 MHz, CDCl ) d 150.14, 140.49, 138.68, 136.66, 135.08,
130.23 (2C), 128.84 (2C), 127.18, 127.13, 125.68 (2C), 125.53, 122.27,
120.88, 117.94, 113.75 (2C), 110.19, 99.99, 48.37. HRMS(ESI):m/z
calcd for C22
7
(
6
1
þ
[MþH]þ 392.0721; found: 392.0721.
d
H16 Cl
2
N
3
(
4
3
2C), 122.02, 120.66, 118.32, 116.64, 115.27, 112.45, 110.19, 99.99,
4.1.3.9. 2-(1-Benzyl-1H-indol-2-yl)-6-bromo-1,3a-dihydro-[1,2,4]tri-
þ
[MþH]þ 324.1501; found:
8.37. HRMS(ESI):m/z calcd for C22
H
18
N
3
azolo[1,5-a]pyrimidine (5i). Yellow solid; yield 88%; mp
ꢀ
24.1501.
170e172 C; IR (KBr): 3452, 3385, 3031, 2924, 1602, 1553, 1453,
ꢁ1
1
1
352, 1023, 750 cm
; H NMR (400 MHz, CDCl ) d 8.49 (1H, s),
3
4
.1.3.4. (2-(1-benzyl-1H-indol-2-yl)-1H-benzo[d]imidazole-5-
7.92e7.91 (1H, d, J ¼ 4 Hz), 7.75e7.73 (1H, d, J ¼ 8 Hz), 7.33e7.32,
yl)(phenyl)methanone (5d). Yellow solid; yield 84%; mp
(1H, m), 7.30e7.23 (4H, m), 7.20e7.16 (1H, m) 7.13 (1H, s), 7.03e7.01
ꢀ
13
157e158 C; IR (KBr):3472, 3373, 3058, 2925, 1638, 1596, 1568,
(2H, d, J ¼ 8 Hz), 5.95 (2H, s), 4.33 (1H, s), 1.79 (1H, s). C NMR
ꢁ1
1
1
7
(
7
497, 1316, 719 cm
.89e7.87 (3H, d, J ¼ 8 Hz), 7.79e7.78 (1H, d, J ¼ 4 Hz), 7.70e7.58
4H, m), 7.46e7.39 (4H, m), 7.36e7.30 (2H, m), 7.26 (1H, s),
.21e7.19 (2H, d, J ¼ 8 Hz), 6.72e6.70 (1H, d, J ¼ 8 Hz), 6.14 (2H,
;
H NMR (400 MHz, CDCl
3
)
d
8.77 (1H, s),
(100 MHz, DMSO) d 153.25, 151.60, 146.06, 138.62, 134.83, 128.95
(2C), 127.26, 127.16, 125.88, 125.66 (2C), 125.24 (2C), 122.43, 121.04,
þ
114.39, 110.26, 107.54, 48.43. HRMS(ESI):m/z calcd for C20
H17BrN
5
[MþH]þ 406.0667; found: 406.0667.
13
s). C NMR (100 MHz, CDCl3)
38.88, 138.82, 136.49, 135.24, 131.42, 131.37, 129.50 (2C), 128.79
2C), 128.11 (2C), 127.16, 127.01, 126.92, 125.64 (2C), 125.28, 122.18,
d 195.36, 150.35, 146.83, 140.33,
1
(
4.1.3.10. 2-(1-Benzyl-1H-indol-2-yl)-3H-imidazo[4,5-b]pyridine (5j).
ꢀ
Yellow solid; yield 67%; mp 118e119 C; IR (KBr): 3447, 3385, 3149,
ꢁ1 1
120.74, 118.80, 113.40, 113.09, 110.06, 48.33. HRMS(ESI):m/z calcd
2924, 1600, 1519, 1453, 1312, 750 cm ; H NMR (400 MHz, DMSO)
þ
[MþH]þ 428.1763; found: 428.1769.
for C29
22
H N
3
O
d
8.72 (1H, s), 7.82e7.81 (1H, d, J ¼ 8 Hz), 7.70e7.68 (1H, d, J ¼ 8 Hz),
7.44e7.42 (1H, d, J ¼ 8 Hz), 7.31e7.20 (6H, m), 7.14e7.06 (3H, m),
13
4
.1.3.5. 2-(1-benzyl-1H-indol-2yl)-6-bromo-3H-imidazo[4,5,-b]pyri-
6.58e6.55 (1H, m), 6.06 (2H, s). C NMR (100 MHz, DMSO)
ꢀ
dine (5e). Yellow solid; yield 80%; mp 127e128 C; IR (KBr):3450,
d 153.26, 149.24, 144.22, 138.18, 137.04, 133.47, 129.73 (2C), 126.88
ꢁ1
1
3
(
7
(
286, 2924, 2854, 1601, 1461, 1352, 1023, 750 cm
400 MHz, CDCl
8.52e8.50 (1H, d, J ¼ 8 Hz), 7.73e7.71 (1H, m),
.30e7.28 (2H, m), 7.26 (1H, s), 7.25e7.24 (1H, d, J ¼ 4 Hz), 7.22e7.16
2H, m), 7.08e7.07 (1H, m), 7.04e7.03 (2H, m), 6.73 (1H, s), 5.98 (2H,
;
H NMR
(2C), 125.27, 125.24, 124.25 (2C), 123.22, 121.07, 120.24, 118.82,
þ
[MþH]þ
3
)
d
111.16, 108.74, 46.03. HRMS(ESI):m/z calcd for C21
325.1423; found: 325.1423.
H
17
N
4
13
s), 3.57 (1H, br). C NMR (100 MHz, CDCl
3
)
d
149.94, 149.29, 143.38,
4.1.4. General procedure for the synthesis of intermediates 6 and 7
For the synthesis of 6, lithium aluminium hydride (2 mmol) was
138.69, 136.16, 135.38, 129.76, 128.74 (2C), 127.16, 127.01, 125.67
ꢀ
(
2C), 125.15, 120.84, 120.70, 120.57, 119.51, 112.89, 110.12, 48.29.
stirred in dry THF at 0 C. Then 1 (1 mmol) was dissolved in THF and
þ
[MþH]þ 402.0480; found:
HRMS(ESI):m/z calcd for C21
4
H16BrN
4
added drop wise to the solution of lithium aluminium hydride at
ꢀ
02.0480.
0 C. Then, the mixture was slowly warmed to room temperature
till the completion (0.5 h) of reaction as monitored by TLC. It was
ꢀ
4
.1.3.6. 2-(1-Benzyl-1H-indol-2-yl)-5-bromo-1H-benzo[d]imidazole
then cooled to 0 C, 10% aqueous sodium hydroxide (20 mL) and
ꢀ
(5f). Bright yellow solid; yield 67%; mp 121e122 C; IR (KBr):3478,
40 mL of water was added successively. Then reaction mixture was
allowed to stir for 0.5 h, filtered through celite and washed with dry
ethyl acetate, dried over anhydrous sodium sulfate, concentrated
and purified by isocratic flash column chromatography (petroleum
ether: ethyl acetate ¼ 8: 2, v/v) on silica gel (200e400) to get pure
compound 6 with 98% yield.
ꢁ1 1
3
376, 3059, 2924, 1620, 1596, 1414, 1352, 1130, 750 cm ; H NMR
8.52e8.50 (1H, d, J ¼ 8 Hz), 7.73e7.71 (1H, m),
(
3
400 MHz, CDCl ) d
7.32e7.29 (1H, m), 7.26 (1H, s), 7.25e7.24 (1H, m), 7.22e7.20 (1H,
m), 7.19e7.14 (2H, m), 7.11e7.07 (2H, m), 7.06e7.03 (2H, m),
13
6
.84e6.80 (1H, m), 5.98 (2H, s), 3.58 (1H, br). C NMR (100 MHz,
CDCl 150.01, 149.36, 136.23, 135.45, 135.25, 129.83, 128.80 (2C),
27.08, 125.74 (2C), 125.22, 122.12, 120.90, 120.77, 119.57, 117.79,
3
)
d
For the synthesis of 7, compound 6 (1 mmol) was dissolved in
dry CH Cl (25 mL) was stirred briefly. Activated manganese diox-
2 2
1
1
BrN
17.55, 116.33, 110.17, 104.40, 48.36. HRMS(ESI):m/z calcd for C22
H
17
ide (7.3 mmol) was added, stirred at room temperature for 4 h.
Another portion of activated manganese dioxide (5.9 mmol) was
added and stirred at room temperature for 0.5 h. After completion
of the reaction, as monitored by TLC, the reaction mixture was
filtered through Celite and washed with ethyl acetate, concentrated
and purified by isocratic flash chromatography (petroleum ether:
ethyl acetate 9.5: 0.5, v/v) on silica gel (200e400) to afford pure
compound 7 with 70% yield.
þ
þ
3
[MþH] 402.0606; found: 402.0606.
4
.1.3.7. 2-(1-Benzyl-1H-indol-2-yl)-1H-naphtho[2,3-d]imidazole
ꢀ
(5g). Pale yellow solid; yield 76%; mp 169e170 C; IR (KBr): 3477,
ꢁ1
1
3
376, 3051, 2925, 1630, 1598, 1464, 1351, 748 cm
8.79 (1H, s), 7.72e7.70 (1H, d, J ¼ 8 Hz),
.65e7.62 (1H, d, J ¼ 8 Hz), 7.47e7.41 (2H, m) 7.37e7.34 (2H, m),
.29e7.25 (2H, m), 7.13e7.06 (4H, m), 7.05e6.99 (2H, m), 6.90 (1H,
;
H NMR
(
400 MHz, DMSO) d
7
7
13
s), 6.70 (1H, s), 6.10 (2H, s). C NMR (100 MHz, DMSO)
38.52, 138.16, 137.77, 134.95, 128.36 (2C), 128.13 (2C), 127.39,
26.85, 126.76 (2C), 126.16 (2C), 125.74, 121.62 (2C), 121.42, 120.33,
19.31, 113.40, 112.95, 109.90, 99.85, 46.97. HRMS(ESI):m/z calcd for
d
151.02,
4.1.5. General procedure for the synthesis of compounds 8a-k
Compound 7 (1 mmol) was taken in dissolved in ethanol in the
presence of triethylamine, and appropriate diamine (1 mmol). The
mixture was refluxed with stirring for 12 h and was monitored for
1
1
1

216
R. Singla et al. / European Journal of Medicinal Chemistry 146 (2018) 206e219
completion using TLC. The reaction was generally completed in
2e15 h. After the completion of the reaction, excess of ethanol was
4.1.5.6. 5-Bromo-2-(1H-indol-2-yl)-1H-benzo[d]imidazole
(8f).
ꢀ
1
Yellow solid; yield 47%; mp 187e188 C; IR (KBr): 3385, 3060, 2956,
ꢁ
1 1
removed under reduced pressure. The product was extracted using
ethyl acetate and organic layer was washed with distilled water.
The combined organic layer was dried over anhydrous sodium
sulfate, filtered, concentrated and purified by isocratic flash column
chromatography (petroleum ether: ethyl acetate ¼ 9.5: 0.5, v/v) on
silica gel (200e400) to afford pure N-benzylated indole-
benzimidazole derivatives (8a-k) in 47e86% yields. The structures
were confirmed by IR, NMR and HRMS.
2624, 1614, 1572, 1392, 1322, 1148, 749 cm
DMSO) 12.78 (1H, br), 11.72 (1H, s), 7.64e7.52 (2H, m), 7.47e7.39
(1H, m), 7.33e7.26 (1H, m), 7.22e7.20 (1H, m), 7.13e7.06 (1H, m),
; H NMR (400 MHz,
d
13
7.01e6.86 (2H, m). C NMR (100 MHz, DMSO) d 147.34, 137.18 (2C),
136.84, 127.93, 127.70, 125.93,120.74, 120.58, 120.01, 119.65, 119.58,
þ
[MþH]þ
119.08, 111.81, 102.11. HRMS(ESI):m/z calcd for C15
H11BrN
3
312.0136; found: 312.0131.
4
.1.5.7. 2-(1H-indol-2-yl)-1H-naphtho[2,3-d]imidazole
(8g).
4
.1.5.1. 2-(1H-indol-2-yl)-4-methyl-1H-benzo[d]imidazole
(8a).
ꢀ
Yellow solid; yield 70%; mp 187e188 C; IR (KBr):3422, 3050, 2922,
ꢀ
ꢁ1 1
Light yellow solid; yield 58%; mp 167e168 C; IR (KBr):3384, 3055,
2
DMSO)
1628, 1588, 1416, 1276, 749 cm ; H NMR (400 MHz, DMSO)
d
11.62
ꢁ
1 1
918, 2850, 1621, 1569, 1395, 1342, 738 cm
;
H NMR (400 MHz,
(
(
1H, s), 8.68 (1H, s), 7.55 (1H, br), 7.47 (1H, s), 7.41e7.37 (2H, m), 7.28
1H, br), 7.16e7.13 (1H, m), 6.98e6.88 (4H, m), 5.44 (1H, br).
d
12.63 (1H, br), 11.77 (1H, br), 7.61e7.59 (1H, d, J ¼ 8 Hz),
13
C
7
.48e7.46(1H, d, J ¼ 8 Hz), 7.39 (1H, br), 7.25 (1H, br), 7.15e7.01 (3H,
NMR (100 MHz, DMSO)
27.49, 126.67, 125.17 (2C), 124.88, 124.58, 124.17 (2C), 121.43,
d 148.47, 138.37, 137.81, 129.90, 127.72,
13
m), 6.99e6.97 (1H, d, J ¼ 8 Hz), 2.62 (3H, s). C NMR (100 MHz,
1
DMSO) 145.52 (2C),136.87,134.25128.68 (2C),127.81 (2C),122.45,
d
þ
3
121.25,111.70 (2C),109.05, 99.30. HRMS(ESI):m/z calcd for C19
H
14
N
1
21.87, 120.46, 119.47, 111.79 (2C), 101.61, 16.98. HRMS(ESI):m/z
þ
[MþH] 284.1188; found: 284.1188.
þ
14 3
calcd for C16H N
[MþH]þ 248.1188; found: 248.1188.
4
.1.5.8. 2-(1H-indol-2-yl)-1H-perimidine
(8h). Reddish brown
4
.1.5.2. 2-(1H-indol-2-yl)-4,6-dimethyl-1H-benzo[d]imidazole (8b).
ꢀ
solid; yield 71%; mp 162e163 C; IR (KBr): 3384, 3047, 2924, 1600,
ꢀ
Pale yellow solid; yield 69%; mp 134e135 C; IR (KBr): 3385, 3056,
2
DMSO)
ꢁ1 1
1
562, 1481, 1289, 750 cm ; H NMR (400 MHz, DMSO)
s), 9.75(1H, s), 7.41e7.39 (1H, d, J ¼ 8 Hz), 7.32e7.30 (1H d, J ¼ 8 Hz),
.09e7.05 (2H, t, J ¼ 8 Hz), 7.01e6.97 (1H, t, J ¼ 8 Hz), 6.94e6.88
d 11.00 (1H,
ꢁ
1
1
919, 1596, 1572, 1435, 1395, 756 738 cm
;
H NMR (400 MHz,
d
12.54 (1H, br), 11.73 (1H, br), 7.60e7.58 (1H, d, J ¼ 8 Hz),
7
7.48e7.46 (1H, d, J ¼ 8 Hz), 7.15e7.11 (3H, m), 7.04e7.00 (1H, m),
6
d
13
(2H, m), 6.48e6.47 (3H,m) 6.42 (s, 1H). C NMR (100 MHz, DMSO)
13
.82 (1H, s), 2.57 (3H, s), 2.41 (3H, s). C NMR (100 MHz, DMSO)
144.88, 137.04 (2C), 128.88 (2C), 127.83 (2C), 123.61, 122.32,
d
142.21 (2C), 138.72, 136.13, 134.25, 127.06, 126.60 (2C), 121.16 (2C),
119.87, 118.80 (2C), 115.69, 112.74, 111.25, 104.68 (2C), 100.32.
1
20.39, 119.42 (2C), 111.81 (2C), 101.27, 21.29, 16.93. HRMS(ESI):m/z
þ
14 3
H N
[MþH] þ 284.1188; found:
HRMS(ESI):m/z calcd for C19
84.1188.
þ
16 3
calcd for C17H N
[MþH]þ 262.1344; found: 262.1344.
2
4
.1.5.3. 2-(1H-indol-2-yl)-1H-benzo[d]imidazole (8c). Pale yellow
ꢀ
4.1.5.9. 5,6-Dichloro-2-(1H-indol-2-yl)-1H-benzo[d]imidazole (8i).
solid; yield 65%; mp 250e252 C; IR (KBr): 3589, 3435, 3055, 2922,
ꢁ
1
1
Dark green solid; yield 85%; mp; IR (KBr): 3421, 2955, 2917, 1593,
1601, 1572, 1401, 1329, 737 cm ; H NMR (400 MHz, DMSO)
d 11.09
ꢁ1 1
1
556, 1417, 1297, 1122, 739 cm ; H NMR (400 MHz, DMSO) d 11.92
(
1H, br), 10.67 (1H, br), 7.46e7.39 (1H, m), 7.31e7.26 (4H, m),
13
(1H, s), 11.61 (1H, s), 8.67 (2H, s), 7.62e7.60 (1H, d, J ¼ 8 Hz),
7.13e7.10 (3H, m), 5.87 (1H, s). C NMR (100 MHz, DMSO)
d 146.63,
7
6
.44e7.42 (1H, d, J ¼ 8 Hz), 7.24e7.22 (1H, m), 7.06e7.03 (1H, m),
145.88, 142.21, 137.54, 128.11, 124.04, 123.38 (2C), 121.22, 120.69,
13
.88 (1H, s). C NMR (100 MHz, DMSO)
d 148.46, 146.98, 144.63,
120.56, 112.09, 111.79, 111.21, 101.79. HRMS(ESI):m/z calcd for
þ
þ
137.73, 137.34, 136.18, 133.49, 129.25, 127.75, 124.15, 119.51, 117.05,
C
15 12
H N
3
[MþH] 234.1031; found: 234.1031.
þ
1
14.74, 111.53, 108.98. HRMS(ESI):m/z calcd for C15
H10Cl
2
N
3
[MþH]
þ
302.0252; found: 302.0252.
4
.1.5.4. (2-(1H-indol-2-yl)-1H-benzo[d]imidazole-5-yl)(phenyl)
ꢀ
methanone (8d). Yellow solid; yield 85%; mp 199e200 C; IR (KBr):
3
NMR (400 MHz, DMSO) 11.56 (1H, s), 8.66 (1H, s), 7.75e7.74(1H, d,
ꢁ1
1
4.1.5.10. 6-Bromo-2-(1H-indol-2-yl)-1,3a-dihydro-[1,2,4]triazolo[1,5-
433, 3328, 3053, 2922, 1591, 1553, 1503, 1421, 1318, 738 cm ; H
ꢀ
a]pyrimidine (8j). Yellow solid; yield 86%; mp 162e163 C; IR (KBr):
3
d
ꢁ1
480, 3300, 3058, 2921, 1602, 1553, 1448, 1330, 1123, 736 cm 1H
NMR (400 MHz, DMSO) 11.65 (1H, s), 8.74 (1H, s), 7.88 (1H, s), 7.67
1H, s), 7.63e7.61 (1H, d, J ¼ 8 Hz), 7.44e7.42 (1H, d, J ¼ 8 Hz),
7.25e7.21 (1H, t, J ¼ 8 Hz), 7.06e7.02 (1H, t, J ¼ 8 Hz), 6.99 (1H, s),
J ¼ 4 Hz), 7.70e7.68 (2H, d, J ¼ 8 Hz), 7.61e7.59 (1H, d,
d
J ¼ 8 Hz),7.57e7.55 (1H, d, J ¼ 8 Hz), 7.51e7.46 (2H, m), 7.44e7.42
(
(
1H, d, J ¼ 8 Hz) 7.24e7.20 (1H, t, J ¼ 8 Hz), 7.06e7.02 (1H, t,
13
J ¼ 8 Hz), 6.95 (1H, s), 6.79e6.77 (1H, d, J ¼ 8 Hz), 6.31 (1H, s).
C
13
6
.41 (1H, s) C NMR (100 MHz, DMSO)
d 155.05, 149.02, 145.80,
NMR (100 MHz, DMSO)
d 193.91, 149.37, 146.39, 146.34, 138.76,
1
37.84, 136.04, 130.25, 127.73, 124.23, 121.55, 119.60, 111.60, 109.47,
137.62, 136.24, 133.09, 131.11, 130.91 (2C), 128.81, 127.83, 127.76,
þ
þ
105.39. HRMS(ESI):m/z calcd for C13
H10BrN
5
[M] 315.0120; found:
124.29, 124.01, 121.34, 119.44, 117.65, 112.86, 111.43, 108.60.
þ
[MþH]þ 338.1293; found:
315.0120.
HRMS(ESI):m/z calcd for C22H N O
3
16 3
38.1293.
4
.1.5.11. 2-(1H-indol-2-yl)-3H-imidazo[4,5-b]pyridine
(8k).
ꢀ
4
.1.5.5. 6-Bromo-2-(1H-indol-2-yl)-3H-imidazo[4,5-b]pyridine (8e).
Yellow solid; yield 49%; mp 168e169 C; IR (KBr): 3392, 3056, 2955,
2924, 1601, 1526, 1426, 1325, 734 cm ; H NMR (400 MHz, DMSO)
ꢀ
ꢁ1
1
Brown solid; yield 67%; mp 171e172 C; IR (KBr): 3421, 3299, 2924,
2
ꢁ
1 1
854, 1724, 1587, 1419, 1327, 1122, 750 cm
;
H NMR (400 MHz,
d
11.87 (1H, s), 10.87 (1H, s), 8.14e8.12 (1H, d, J ¼ 8 Hz), 7.81e7.79
DMSO)
d
11.66 (1H, s), 9.18 (1H, s), 7.64e7.62 (1H, d, J ¼ 8 Hz), 7.60
(1H, d, J ¼ 8 Hz), 7.77e7.75 (1H, d, J ¼ 8 Hz), 7.67e7.65 (1H, d,
(
1H, s), 7.44e7.42 (1H, d, J ¼ 8 Hz), 7.28e7.25 (1H, m), 7.11e7.10 (1H,
J ¼ 8 Hz), 6.86e6.82 (1H, t, J ¼ 8 Hz), 6.71e6.67 (2H, m), 5.54 (1H, s).
1
3
13
d, J ¼ 4 Hz), 7.08e7.04 (2H, m). C NMR (100 MHz, DMSO)
d
152.41,
C NMR (100 MHz, DMSO) d 154.05, 141.01, 137.79, 136.41, 135.75,
150.01, 139.70, 138.04, 135.89, 135.22, 129.60, 127.83, 124.98 (2C),
132.67, 129.85, 127.84, 123.37, 122.99, 121.99, 119.23, 117.13, 114.05.
Na [MþNa]þ 491.1709; found:
þ
1
C
21.77, 119.74, 111.55, 110.72. HRMS(ESI):m/z calcd for
HRMS(ESI):m/z calcd for C28
491.1709.
20
H N
8
Na [MþNa]þ 334.9908; found: 334.9907.
þ
H
14 9
BrN
4

R. Singla et al. / European Journal of Medicinal Chemistry 146 (2018) 206e219
217
4
4
.2. Biological assay methods
complex solution and 40
m
L of ER green assay buffer with 4% DMSO,
provides maximum polarization value for assay); (2) assay mini-
mum polarization control (40 L of ER/fluromone complex solution
and 40 L of oestradiol (20 mM), provides bottom baseline); (3) free
fluoromone tracer control (40 L Fluoromone tracer and 40 L of ER
.2.1. Culturing and maintaining of cancer cell line
Human BC cell line T47D were procured from National Centre
m
m
for Cell Sciences (NCCS) Pune. T47D cells were grown in the Roswell
Park Memorial Institute-1640 (RPMI-1640) medium supplemented
with 10% heat inactivated (30 min at 56 C) FBS (Fetal Bovine
m
m
green assay buffer with 4% DMSO, provides absolute minimum
polarization value). The polarization values were normalized to
percent inhibition using the following equation.
ꢀ
Serum), 1X penicillin and streptomycin in a tissue culture flask at
ꢀ
37 C in a humidified atmosphere of 5% CO
2
incubator. At 70e80%
confluence the cells were trypsinized using 1X trypsin-EDTA and
sub-cultured in a new sterile tissue culture flask for further
experiments.
I% ¼ (A
0
ꢁA)/(A ꢁA100) ꢂ 100
0
I% ¼ the percent inhibition, A ¼ Absorbance at 0% inhibition,
0
A
100 ¼ Absorbance at 100% inhibition, and A ¼ observed Absor-
4.2.2. Anti-proliferative activity
bance value.
The anti-proliferative activity of the compounds was evaluated
The percent inhibition values are plotted against the concen-
tration of test compounds and analysed by a non-linear regression
curve fitting. The concentration of the test compounds needed to
displace half of the bond ligand equals IC50 of the test compound.
using the MTT assay. It is a colorimetric assay for assessing cell
metabolic activity. Viable cells with active metabolism convert the
MTT into a purple coloured formazan product with an absorbance
maximum near 570 nm. When cells die, they lose the ability to
convert MTT into formazan, thus color formation serves as a useful
and convenient marker of only the viable cells. Human BC cell line
4.2.5. Confocal microscopy
Cell imaging is an important technique for localisation of the
compound inside the cell. As the ER is located on the plasma
membrane, cytosol and nucleoplasm, live cell imaging enables to
track the compound and site of action. Cells were seeded on sterile
4
T47D were seeded in 96 wells plate at cell density 1 ꢂ 10 per well
and after 24 h, cells were treated with different concentration of
synthesized compounds (1, 5, 25 mM) and incubated for 48 h in FBS-
4
free media. MTT solution (final concentration of MTT was 0.5 mg/
glass coverslip at 5 ꢂ 10 cells/ml in a 6 wells plate. After 24 h of
ꢀ
ml) was added followed by incubation for 4 h at 37 C. After 4 h; the
seeding the cells were treated with 15 and 5 mM of 5f and 8f
purple color farmazone crystals were solubilized using 100
m
l of
respectively for 48 h after that cells were washed with 1X PSB. After
that cells were fixed with 2% formaldehyde solution for 10 min in
dark, again cells were washed thrice with 1X PBST. Then cells were
mounted on glass cover by using mounting media. Cells were
visualized and image was captured under an Olympus FV1200
Laser Scanning Microscopes fluorescence confocal microscope, the
captured image was analyzed with Olympus Fluoview software of
Olympus version 4.2a.
acidified DMSO with 0.6% acetic acid and absorbance was measured
at both 570 nm and 620 nm. The absorbance reading is directly
proportional to a number of living cells [34]. The cell viability of
each group was calculated with their respective control.
4.2.3. Human peripheral blood mononuclear cells (PBMCs) culture
and MTT assay
Majority of the chemotherapeutic agents available having a side
effect of inducing apoptosis in the normal cell along with the cancer
cells. Therefore, in order to analyze the side effect of the com-
pounds on the normal cells at higher concentrations, human PBMC
was cultured and MTT assay was performed. Fresh blood was drawn
from healthy individual as per the protocol no. CUPB/cc/14/IEC/
4.2.6. Preparation of total cell lysates
To determine target specificity of the compounds, there is a
need to determine the expression of target proteins. Cell lysates
were prepared from both treated and untreated cells of T47D
Briefly, cells were first rinsed twice gently with ice-cold 1X PBS,
4
483 approved by Institutional Ethics Committee of Central Uni-
then 300e500
150 mM NaCl,1 mM EDTA,1% NP-40, and protease inhibitor cocktail
(1 L per 100 L of lysis buffer)] was added per plate, kept on ice for
mL of modified RIPA buffer [50 mM TrisHCl (pH 7.4),
versity of Punjab, Bathinda. The protocol used was standard oper-
ating procedure, provided by Institutional Ethics Committee of
Central University of Punjab according to guidelines issued by In-
dian Council of Medical Research (ICMR), Govt. of India. PBMC were
isolated from whole blood discarding the RBCs after treatment with
RBC lysis buffer. The PBMCs were counted on the automated cell
counter (Invitrogen). The cells were then suspended in RPMI-1640
media supplemented with 10% fetal bovine serum (FBS), 1 ꢂ anti-
m
m
5 min, and cells were mechanically scraped using plastic cell
scraper and cell suspension was transferred into pre-cooled 1.5 mL
micro centrifuge tube [35]. Following centrifugation, the pellet was
re-suspended in the cell lysis buffer with intermediate vortexing
ꢀ
every 5min for 20 min at 4 C. Then, the mixture was centrifuged at
ꢀ
12,000 g for 20 min at 4 C. The supernatant was collected in pre-
ꢀ
ꢀ
biotic solution and incubated at 37 C in a humidified atmosphere
of 5% CO
9
4
chilled sterile micro centrifuge tubes and stored at ꢁ20 C for
4
2
. Approximately 10 cells were seeded in each well of the
further experiments. The concentration of total protein in this su-
pernatant was estimated by using standard Bradford method with
BSA as standard [36].
6 well plate. MTT assay was performed as described in section
.2.2.
4.2.4. Estrogen receptor competitive binding assay
4.2.7. Western blot analysis
A stock solution of each compound was serially diluted using
50 mg of total protein sample were resolved on 10% denaturation
DMSO, and the 40
assay plate (Grenier, 384-well high volume flat bottom) followed by
adding 40 L human recombinant ER- /fluoromone TM complex
solution. After mixing and allowing at least 2-h incubation at room
temperature with light protection of the reagents. The fluorescence
of each well was measured using the Synergy 2 multi-mode
microplate reader (BioTek) with 535 nm excitation filters and
m
L of each concentration was transferred to the
SDS-PAGE and transferred to a nitrocellulose membrane. Mem-
branes were blocked for 1 h with 5% nonfat dry milk (NFDM) in 1X
PBST. All antibody dilutions were made in 2.5% NFDM-PBST.
m
a
ꢀ
Membranes were incubated (4 C overnight) with primary anti-
bodies of rabbit
a-ER- a (HC-20. Membranes were washed with
PBST, incubated with horseradish peroxidase-conjugated second-
ary antibody (Invitrogen) for 1 h. The image was captured by using
Bio-Rad ChemiDoc™ MP imaging system after applying enhanced
chemiluminescence (Clarity™ Western ECL Substrate of Bio-Rad)
5
90 nm emission filters. Three controls were included in the assay:
(
1) assay maximum polarization control (40 L of ER/fluoromone
m

218
R. Singla et al. / European Journal of Medicinal Chemistry 146 (2018) 206e219
and densitometric analysis was done using Image Lab™ software of
Acknowledgement
Bio-Rad version 5.2.
Authors are grateful to Department of Science and Technology,
New Delhi, India (SB/FT/CS-006/2012) for providing financial
assistance during the course of the work. Ramit Singla acknowledge
CSIR-India for the award of SRF [09/1051 (006)/2016-EMR-1]. Au-
thors acknowledge Mr. Ashish Pandey of CIL in Central University of
Punjab, for outstanding work on CLSM. Authors are also thankful to
the Honourable Vice - Chancellor for providing the necessary fa-
cilities at Central University of Punjab, Bathinda, India.
4
.2.8. Total RNA isolation and cDNA synthesis
Total RNA was isolated from T47D cells from both treated and
®
untreated cells by using TRIzol (Invitrogen), and followed the
manufacturer instructions and finally RNA pellet was resuspended
in nuclease free water. Quality of isolated RNA was checked on
NanoDrop 2000c (Thermo Scientific) followed by denaturing
agarose gel. Traces of DNA contamination was removed by treating
the total isolated RNA with DNA-free™ DNA Removal Kit (Invi-
trogen), and followed the manufacturer instructions. Again, the
quality of DNA free RNA was checked, followed by synthesis of first
strand of cDNA by using the SuperScript™ IV First-Strand Synthesis
System (Invitrogen) as per the instructions by the manufacturer.
Appendix A. Supplementary data
Supplementary data related to this article can be found at
https://doi.org/10.1016/j.ejmech.2018.01.051.
4.2.9. RT-PCR
References
cDNA was used as a template for the PCR reaction with gene-
0
0
0
[1] N.E.I. Guissi, H. Li, Y. Xu, F. Semcheddine, M. Chen, Z. Su, Q. Ping, Mitoxan-
trone- and folate-TPGS2k conjugate hybrid micellar aggregates to circumvent
toxicity and enhance efficiency for breast cancer therapy, Mol. Pharm. 14
specific primer pairs of ER-
a
(5 GTGCCTGGCTAGAGATCCTG 3 , 3
0
GATGTGGGAGAGGATGAGGA 5 ) along with a housekeeping gene
(
1
1
GAPDH) as a loading control. The PCR product was separated on
.2% agarose gel containing ethidium bromide (EtBr) along with
00bp DNA ladder of Invitrogen (Tracklt™ 100 bp DNA ladder). The
(2017) 1082e1094.
ꢀ
[
2] C. Ouellet, R. Maltais, E. Ouellet, X. Barbeau, P. Lagüe, D. Poirier, Discovery of a
sulfamate-based steroid sulfatase inhibitor with intrinsic selective estrogen
receptor modulator properties, Eur. J. Med. Chem. 119 (2016) 169e182.
gel image was taken by using Bio-Rad Gel Doc™ XR system and
densitometric analysis was done using Image Lab™ software of Bio-
Rad version 5.2.
[3] T. Shoda, M. Kato, R. Harada, T. Fujisato, K. Okuhira, Y. Demizu, H. Inoue,
M. Naito, M. Kurihara, Synthesis and evaluation of tamoxifen derivatives with
a long alkyl side chain as selective estrogen receptor down-regulators, Bioorg.
Med. Chem. 23 (2015) 3091e3096.
[
4] J.S. Lewis-Wambi, H. Kim, R. Curpan, R. Grigg, M.A. Sarker, V.C. Jordan, The
selective estrogen receptor modulator bazedoxifene inhibits hormone-
independent breast cancer cell growth and down-regulates estrogen recep-
4.3. Induced fit docking
tor
5] M.J. Duffy, Estrogen receptors: role in breast cancer, Crit. Rev. Clin. Lab. Sci. 43
2006) 325e347.
6] A.W. Welsh, D.R. Lannin, G.S. Young, M.E. Sherman, J.D. Figueroa, N.L. Henry,
L. Ryden, C. Kim, R.R. Love, R. Schiff, Cytoplasmic estrogen receptor in breast
cancer, Clin. Canc. Res. 18 (2012) 118e126.
a and cyclin D1, Mol. Pharmacol. 80 (2011) 610e620.
[
[
The 2D structure of ligands were constructed using the maestro
.6 software and saved in sdf format (standard data format). The 2D
structures were converted to the 3D structure using the Ligprep
module of Maestro 9.6. This module adds hydrogens, eliminates
any discrepancies between bond length and angle. The 3-
(
9
[
7] C.K. Osborne, R. Schiff, Mechanisms of endocrine resistance in breast cancer,
Annu. Rev. Med. 62 (2011) 233e247.
dimensional and X-ray structure coordinates of ER-
a
was ob-
[8] J. Dandriyal, R. Singla, M. Kumar, V. Jaitak, Recent developments of C-4
substituted coumarin derivatives as anticancer agents, Eur. J. Med. Chem. 119
tained from protein data bank with PDB id code 4XI3 (www.rcsb.
org). Protein preparation wizard of maestro 9.6 was used for the
protein preparation. Protein preparation begins with the applica-
tion of Impact molecular mechanics program for correcting the
bond orders, adding missing hydrogens and removing the crystal-
lized waters that are not present in the active site.
(
2016) 141e168.
9] S.J. Han, K. Begum, C.E. Foulds, R.A. Hamilton, S. Bailey, A. Malovannaya,
D. Chan, J. Qin, B.W. O'Malley, The dual estrogen receptor inhibitory effects
[
a
of the tissue-selective estrogen complex for endometrial and breast safety,
Mol. Pharmacol. 89 (2016) 14e26.
[
[
10] F. Payton-Stewart, S.L. Tilghman, L.G. Williams, L.L. Winfield, Benzimidazoles
diminish ERE transcriptional activity and cell growth in breast cancer cells,
Biochem. Biophys. Res. Commun. 450 (2014) 1358e1362.
11] C.P. Miller, M.D. Collini, B.D. Tran, H.A. Harris, Y.P. Kharode, J.T. Marzolf,
R.A. Moran, R.A. Henderson, R.H.W. Bender, R.J. Unwalla, L.M. Greenberger,
J.P. Yardley, M.A. Abou-Gharbia, C.R. Lyttle, B.S. Komm, Design, synthesis, and
preclinical characterization of novel, highly selective indole estrogens, J. Med.
Chem. 44 (2001) 1654e1657.
12] R. Jeselsohn, in: A Study of Palbociclib in Combination with Bazedoxifene in
Hormone Receptor Positive Breast Cancer, ClinicalTrials.gov, Dana-Farber
Cancer Institute, 2017 as downloaded on January 22, 2017 from, https://
clinicaltrials.gov/ct2/show/record/NCT02448771.
13] R. Lindsay, J.C. Gallagher, R. Kagan, J.H. Pickar, G. Constantine, Efficacy of
tissue-selective estrogen complex of bazedoxifene/conjugated estrogens for
osteoporosis prevention in at-risk postmenopausal women, Fertil. Steril. 92
A Truncated Newton Conjugate Gradient (TNCG) minimization
was performed using the OPLS-2005 force field. IFD protocol uti-
lizes a combination of Glide (grid-based ligand docking with en-
ergetics) rigid docking and prime (protein structure prediction). IFD
consisted of three-step procedure for sampling side chain confor-
mations and predicting ligand-residue orientations. In the first
step, side chain conformation is generated, all previously mutated
side chains were back mutated concurrently into a random rotamer
state obtained from the rotamer libraries developed by Xiang and
Honig. In the second step after the conformation generation, each
side chain is minimized successively (<0.001 kcal mol rms
gradient) while all other side chains are remaining fixed. Minimi-
zation of individual side chains was repeated sequentially for all
back mutated residues until convergence was reached. In the third
step, a TNCG minimization performed to resolve steric clashes. The
target substrates obtained after the final step within a 40 kcal/mol
window were redocked into the induced fit structures. GlideXP
[
[
[
(2009) 1045e1052.
14] V.K. Gupta, Y. Bhalla, V. Jaitak, Impact of ABC transporters, glutathione con-
jugates in MDR and their modulation by flavonoids: an overview, Med. Chem.
Res. 23 (2014) 1e15.
[15] B. Meunier, Hybrid molecules with a dual mode of action: dream or reality?
Acc. Chem. Res. 41 (2008) 69e77.
[
[
16] Y.C. Mayur, G.J. Peters, V.V.S. Rajendra Prasad, C. Lemos, N.K. Sathish, Design of
new drug molecules to be used in reversing multidrug resistance in cancer
cells, Curr. Cancer Drug Targets 9 (2009) 298e306.
17] V.R. Solomon, C. Hu, H. Lee, Hybrid pharmacophore design and synthesis of
isatin-benzothiazole analogs for their anti-breast cancer activity, Bioorg. Med.
Chem. 17 (2009) 7585e7592.
[18] M. Fares, W.M. Eldehna, S.M. Abou-Seri, H.A. Abdel-Aziz, M.H. Aly, M.F. Tolba,
Design, synthesis and in vitro antiproliferative activity of novel isatin-
quinazoline hybrids, Arch. Pharmazie 348 (2015) 144e154.
(
Glide Extra precision) with vdW scaling 0.8 was employed for all
docking. 20 poses were requested for the redocking and ranked
based on the GlideXP score. Application of the IFD protocol pro-
duced an individual ensemble for ER-a complexes, which clustered
for each compound under investigation. The cluster for the top
scoring indole alkaloid was analysed.
[
19] J. Sidhu, R. Singla, E. Mayank, V. Jaitak, Indole derivatives as anticancer agents
for breast cancer therapy: a review, Anti Canc. Agents Med. Chem. 16 (2015)

R. Singla et al. / European Journal of Medicinal Chemistry 146 (2018) 206e219
219
1
60e173.
[29] M. Al-Bader, C. Ford, B. Al-Ayadhy, I. Francis, Analysis of estrogen receptor
isoforms and variants in breast cancer cell lines, Exp. Ther. Med. 2 (2011)
537e544.
[
20] T.T.Y. Wang, M.J. Milner, J.A. Milner, Y.S. Kim, Estrogen receptor a as a target
for indole-3-carbinol, J. Nutr. Biochem. 17 (2006) 659e664.
[
21] L.M. Greenberger, T. Annable, K.I. Collins, B.S. Komm, C.R. Lyttle, C.P. Miller,
P.G. Satyaswaroop, Y. Zhang, P. Frost, A new antiestrogen, 2-(4-hydroxy-
phenyl)-3-methyl-1-[4-(2-piperidin-1-yl-ethoxy)-benzyl]-1H-indol-5-ol hy-
drochloride (ERA-923), inhibits the growth of tamoxifen-sensitive and-resis-
tant tumors and is devoid of uterotropic effects in mice and rats, Clin. Canc.
Res. 7 (2001) 3166e3177.
[30] A. Strom, J. Hartman, J.S. Foster, S. Kietz, J. Wimalasena, J.A. Gustafsson, Es-
trogen receptor beta inhibits 17beta-estradiol-stimulated proliferation of the
breast cancer cell line T47D, Proc. Natl. Acad. Sci. U. S.
A 101 (2004)
1566e1571.
[31] Y.Q. Fang, Y.Z. Weng, W.Q. Huang, L. Sun, Localization of the estrogen receptor
alpha and beta-subtype in the nervous system, Hatschek's pit and gonads of
amphioxus, Branchiostoma belcheri, Shi Yan Sheng Wu Xue Bao 36 (2003)
368e374.
[
[
[
22] K. Shah, S. Chhabra, S.K. Shrivastava, P. Mishra, Benzimidazole: a promising
pharmacophore, Med. Chem. Res. 22 (2013) 5077e5104.
23] Y. Bansal, O. Silakari, The therapeutic journey of benzimidazoles: a review,
Bioorg. Med. Chem. 20 (2012) 6208e6236.
24] S. Caron, B.P. Jones, L. Wei, Preparation of substituted benzimidazoles and
imidazopyridines using 2,2,2-trichloroethyl imidates, Synth 44 (2012)
[32] J. Kurebayashi, T. Otsuki, H. Kunisue, K. Tanaka, S. Yamamoto, H. Sonoo,
Expression levels of estrogen receptor-a, estrogen receptor-b, coactivators,
and corepressors in breast cancer, Clin. Canc. Res. 6 (2000) 512e518.
[33] R. Singla, V. Jaitak, Multitargeted molecular docking study of natural-derived
alkaloids on breast cancer pathway components, Curr. Comput. Aided Drug
Des. 13 (2017). E-pub Ahead of Print.
[34] M. Dhiman, M.P. Zago, S. Nunez, A. Amoroso, H. Rementeria, P. Dousset,
F.N. Burgos, N.J. Garg, Cardiac-oxidized antigens are targets of immune
recognition by antibodies and potential molecular determinants in chagas
disease pathogenesis, PLoS One 7 (2012), e28449.
[35] A.K. Mantha, M. Dhiman, G. Taglialatela, R.J. Perez-Polo, S. Mitra, Proteomic
study of amyloid beta (25e35) peptide exposure to neuronal cells: impact on
APE1/Ref-1's proteineprotein interaction, J. Neur. Res. 90 (2012) 1230e1239.
[36] N.J. Kruger, The Bradford method for protein quantitation, in: J.M. Walker
(Ed.), The Protein Protocols Handbook, Humana Press, Totowa, NJ, 2009,
pp. 17e24.
3049e3054.
[
25] H.M. Weir, R.H. Bradbury, M. Lawson, A.A. Rabow, D. Buttar, R.J. Callis,
J.O. Curwen, C. de Almeida, P. Ballard, M. Hulse, AZD9496: an oral estrogen
receptor inhibitor that blocks the growth of ER-positive and ESR1-mutant
breast tumors in preclinical models, Canc. Res. 76 (2016) 3307e3318.
26] W.O. Foye, Foye's Principles of Medicinal Chemistry, Lippincott Williams &
Wilkins, 2008.
[
[
27] X. Fan, J. Qin, Benzimidazole-2-piperazine Heterocyclic Compound as PARP
Inhibitor Useful in Treatment of Various Diseases and its Preparation
CN104230896A, 2014, 42pp.
[
28] X. Yang, L. Wang, C. Li, Y. Zhan, J. Liu, T. Luo, H. Yan, S. Zhang, W. Li, X. Wen,
T. Peng, L. Li, Substance as Tyrosine Kinase Inhibitor and its Preparation
WO2014201587A1, 2014, 33pp.