- Photodissociation of NO2 Adsorbed on LiF(001)
-
The photochemistry of NO2 physisorbed on single-crystal LiF(001) at 100 K has been studied at λ1 = 248 nm.The adsorbate was examined by polarized FTIR in both the presence and absence of λ1 radiation.In the absence of UV irradiation the adlayer is composed of dimeric (NO2)2.In the presence of UV, FTIR shows that some N2O3 is formed.Photodissociations(PDIS) giving both NO(g) and molecular NO2(g) were the predominant mechanisms as determined by time-of-flight mass spectrometry (TOF-MS) and resonantly enhanced multiphoton ioniziation (REMPI).The main objective of this work was the characterization of the photoproduct, NO, internal state distribution by 1 + 1 REMPI.Vibrational levels from v = 0 to 9 were probed with rotational resolution using a tunable laser, λ2.The rotational distributions for each vibrational level could be described by one Boltzmann temperature.The spin-orbit states of NO(g) were equally populated in all vibrational levels.The lambda doublet states, Π(A') and Π(A ), were equally populated.The principal observation was that the vibrational distribution in NO(g) was inverted and bimodal with a peak in v = 0 and a second substantial peak in v = 3-4, qualitatively resembling but qualitatively different from that for photolysis of NO2(g).Time delays between the two lasers were used to probe the translational energy of the NO(g) photofragment in specified states of internal excitation.The transational energy distributions were invariant over all vibrational levels, except v = 0 for which much slower fragments were observed.This complete determination of the energy distribution in the degrees of freedom of the NO(g) from photodissociation of adsorbate has implications for the identity of the photolyzing species and the dynamics of photodissociation.Two mechanisms for photoformation of NO2(g) were found: one at low coverages and one at higher coverages, the former giving peak translational energies ca. 1.2 kcal/mol and the latter 0.4 kcal/mol.
- Dixon-Warren, St. J.,Jackson, R. C.,Polanyi, J. C.,Rieley, H.,Shapter, J. G.,Weiss, H.
-
-
Read Online
- Photochemical NO release from nitrosyl RuII complexes with C-bound imidazoles
-
The series of nitrosyl complexes trans-[Ru(NH3)4L(NO)]Cl3, L = caffeine, theophylline, imidazole and benzoimidazole in position trans to NO were prepared and their photochemical properties studied. All complexes showed nit
- Holanda, Alda K.M.,da Silva, Francisco O.N.,Sousa, Jackson R.,Diógenes, Izaura C.N.,Carvalho, Idalina M.M.,Moreira, ícaro S.,Clarke, Michael J.,Lopes, Luiz G.F.
-
-
Read Online
- A laser flash photolysis study of nitrous acid in the aqueous phase
-
The OH quantum yield from the photolysis of nitrous acid in the aqueous phase by the 355 nm light was measured to be 0.25 ± 0.03. OH radical thus formed reacted readily with HNO2 to produce NO2, which sequentially reacted with HNO2 to form the HNO2-NO 2 adduct. The NO2 + HNO2 reaction was reversible with a forward rate constant of 3.76 × 107 dm 3 mol-1 s-1 and a backward rate constant of 1.06 × 105 s-1. Decay of the HNO2-NO 2 adduct would most likely generate HNO3 and NO at a rate constant of 3.0 × 103 s-1.
- Ouyang, Bin,Dong, Wenbo,Hou, Huiqi
-
-
Read Online
- The rotational energy accommodation of NO formed in the catalytic oxidation of NH3 over Pt(111)
-
Rotational energy distributions of the desorbing NO product from the NH3 + O2 reaction on a Pt(111) single crystal have been measured using the laser-induced fluorescence technique in conjunction with an UHV apparatus.Over the surface temperature range 800-1300 K, the rotational temperature of NO was found to remain virtually constant near 400 K.
- Hsu, D. S. Y.,Squire, D. W.,Lin, M. C.
-
-
Read Online
- Photolysis of the (2-) Ion in Water and Poly(vinyl alcohol) Films: Evidence for Cyano Radical, Cyanide Ion and Nitric Oxide Loss and Redox Pathways
-
Ultraviolet-visible and IR spectroscopy and mass spectrometry have been used to investigate photolysis of the (2-) ion upon irradiation with UV/VIS light in aqueous solutions and in poly(vinyl alcohol) films at 12 and 298 K.Changes in the ν(CN) and ν(NO) bands in the IR and in the d-d and charge-transfer bands in the UV/VIS region were used to monitor the appearance and disappearance of complex ions as a function of photolysis time.Mass spectrometric analysis of the gaseous products released during the irradiation of aqueous solutions revealed NO, HCN, and (CN)2.The combined results showed that the (2-) ion undergoes photoaquation and photoreduction, producing aquacyanoferrate-(III) and -(II) species.The origin of the iron(II) species was shown to be mainly due to the photoreduction of the iron(III) species produced after primary loss of the nitrosyl ligand as molecular NO and not as NO(1+).Subsequent thermal reactions between the iron-(II) and -(III) species led to the formation of mixed-valence compounds, e.g.Prussian blue.A scheme for the photochemical and thermal reactions with CN(.), CN(1-) and NO loss pathways is proposed.The possible implications of the results for the use of (2-) as a vasodilator are discussed.
- Oliveira, Marcelo G. de,Langley, G. John,Rest, Antony J.
-
-
Read Online
- Reduced graphene oxide-gold nanorod composite material stabilized in silicate sol-gel matrix for nitric oxide sensor
-
A facile synthetic method for the preparation of reduced graphene oxide-gold nanorods embedded in an amine functionalized silicate sol-gel matrix (RGO-Au-TPDT NRs) composite in an aqueous medium and its applications towards the electrochemical sensing of nitric oxide (NO) are reported. The electrochemical characteristics of the RGO-Au-TPDT NRs modified electrode are studied by using cyclic voltammetry. The electrocatalysis and amperometric sensing of NO are studied at physiological pH by using the RGO-Au-TPDT NRs modified electrode. The RGO-Au-TPDT NRs modified electrode shows excellent electrocatalytic activity towards the oxidation of NO due to the synergistic catalytic effect of the RGO-Au-TPDT NRs composite material. The amperometric current is increased linearly while increasing the NO concentration in the range between 10 and 140 nM and the lowest detection limit is estimated as 6.5 nM. The GC-RGO-Au-TPDT NRs modified electrode is simple to prepare and shows fast amperometric response towards NO detection. the Partner Organisations 2014.
- Jayabal, Subramaniam,Viswanathan, Perumal,Ramaraj, Ramasamy
-
-
Read Online
- Probing the nature of the K-rotor in unimolecular reactions: Scalar and vector correlations in the photodissociation of NCNO
-
The photodissociation of NCNO at 520 and 532 nm was examined using transient frequency modulation Doppler spectroscopy in order to study vector and scalar correlations in the dissociation. A small correlation between v and J was observed corresponding to Β00(22) bipolar moments ranging from 0.00±0.02 to -0.03±0.02 at 532 nm and 0.00±0.02 to -0.01±0.02 at 520 nm. These were well described by a helicity unrestricted PST formulation at both wavelengths.
- McGivern, W. Sean,North, Simon W.
-
-
Read Online
- Widely differing photochemical behavior in related octahedral {Ru-NO} 6 compounds: Intramolecular redox isomerism of the excited state controlling the photodelivery of NO
-
trans-[(NC)Ru(py)4(μ-CN)Ru(py)4(NO)]3+ (py = pyridine) is a stable species in aqueous solution. It displays an intense absorption in the visible region of the spectrum (λmax = 518 nm; εmax = 6100 M-1 cm-1), which turns this compound into a promising agent for the photodelivery of NO. The quantum yield for the photodelivery process resulting from irradiation with 455 nm visible light was found experimentally to be (0.06 ± 0.01)×10 -3 mol einstein-1, almost 3 orders of magnitude smaller than that in the closely related cis-[RuL(NH3)4(μ-pz) Ru(bpy)2(NO)]5+ species (L = NH3 or pyridine, pz = pyrazine, bpy = 2,2′-bipyridine; φNO = 0.02-0.04 mol einstein-1 depending on L) and also much smaller than the one in the mononuclear compound trans-[ClRu(py)4(NO)]2+ (φNO = (1.63 ± 0.04)×10-3 mol einstein-1). DFT computations provide an electronic structure picture of the photoactive excited states that helps to understand this apparently abnormal behavior.
- De Candia, Ariel G.,Marcolongo, Juan P.,Etchenique, Roberto,Slep, Leonardo D.
-
-
Read Online
- Catalytic reduction of N2O and NO2 with methane over sol-gel palladium-based catalysts
-
Pd/TiO2 and Gd-doped Pd/TiO2 prepared through a 'one-pot' sol-gel method are shown to be active for the reduction of both N2O and NO2 using CH4 as a reducing agent under excess O2 conditions. In previous studies these catalysts were shown to effectively reduce NO with CH4, however activity was strongly dependant on the oxidation state of Pd. Through the electropositive nature of Gd, Pd was maintained in metallic state under higher oxygen concentrations compared to the Gd-free catalysts. Characterization through XPS and in situ DRIFTS studies indicate that in the reduction of NO2, even under excess oxygen, a significant portion of the surface Pd is maintained in the active metallic state.
- Oktar, Nuray,Mitome, Junko,Holmgreen, Erik M.,Ozkan, Umit S.
-
-
Read Online
- [Fe2(μ-SR)2(NO)4]0 complexes with R being phenolyl with different substituents in the meta-position: Synthesis, structure, and NO release
-
Single crystals of new binuclear tetranitrosyl iron complexes ([Fe2(SR)2(NO)4]) have been synthesized, with R being m-aminophenyl (1) and m-hydroxyphenyl (2). The structure, physical–chemical properties, and NO release of
- Kozub, Galina I.,Sanina, Nataliya A.,Emel'yanova, Nina S.,Utenishev, Andrey N.,Kondrat'eva, Tat'yana A.,Khrustalev, Vladimir N.,Ovanesyan, Nikolay S.,Kupchinskaya, Nadezhda E.,Aldoshin, Sergey M.
-
-
Read Online
- Investigation of a novel trinuclear μ-oxo ruthenium complex as a potential nitric oxide releaser for biological purposes
-
The chemical properties of the trinuclear ruthenium complex [Ru3O(CH3COO)6(3-pic)2(NO)]PF6 (1, were 3-pic = 3-picoline or 3-methylpyridine), its photochemical behavior and its ability as a vasorelaxing agent are reported in this work. It was shown that the unpaired electrons of NO and of the metal center [Ru3O]+ are tightly coupled, promoting an intermediate NMR profile between the oxidized (paramagnetic) and reduced (diamagnetic) [Ru3O]1+/0 species. From IR measurements, it was suggested that in trinuclear complexes, unlike other ruthenium compounds, the interaction of those unpaired electrons overcomes the effect of peripheral ligands and NO-backbonding on the ν(NO) frequency, which shows no dependence on the pKa values of pyridinic ligands. The photoinduced NO release was investigated by light irradiation at 337, 447, 532 and 660 nm in phosphate buffer solution (pH 7.4), leading to the generation of gaseous NO0 and the solvated species [Ru3O(CH3COO)6(3-pic)2(H2O)]+ (2). Through amperometric and quimioluminescence measurements, the amount of NO(g) released were determined, showing dependence on the wavelength of irradiation. The ability of compound 1 as a vasorelaxing agent was also addressed. It was shown that, under ambient luminosity, compound 1 promotes 89% of relaxation in pre-contracted rat aorta. Molecular modeling of the novel nitrosyl, as well as characterization of the complexes [Ru3O(CH3COO)6(3-pic)2(L)]n, L = H2O, n = +1 (2), L = 3-pic, n = +1 (3), L = CO, n = 0 (4), are also reported.
- Cacita, Natacha,Possato, Bruna,Da Silva, Camila F.N.,Paulo, Michele,Formiga, André Luiz Barbosa,Bendhack, Lusiane M.,Nikolaou, Sofia
-
-
Read Online
- State-resolved photofragmentation of [ClNO]n van der Waals clusters in a supersonic jet
-
The effects of the ultraviolet laser irradiation of [ClNO]2, weakly bound clusters, formed in a supersonic jet, are analyzed by considering three processes: the photofragmentation of bare ClNO, the Cl+ClNO reaction, and NO relaxation within the cluster. The photofragmentation of jet-cooled ClNO at 355 nm produces NO (υ″ = 1) with a kinetic energy of 2240 cm-1, a spin-orbit preference of F1/F2 = 1.2, and Λ-doublet state preferences of Π(A″)/Π±(A″) = 2.0 and 4.0 for the F1 and F2 manifolds, respectively. The NO distribution of rotational states was parametrized using a Gaussian function centered at N = 34, with a fwhm of 17. On the other hand, the Cl+ClNO reaction, studied at a collision energy of 2780 cm-1, gives NO(υ″ = 1) described by a Boltzmann rotational distribution with Trot = 950±100 K. The relative population of the NO spin-orbit states is F1/F2 = 2.5, with a Λ-doublet state preference of Π(A″)/Π(A′) = 1.2 and Etrans(NO) of 578 cm-1. It is found that 57% of available energy is disposed as Eint(Cl2). As a result of the irradiation of the [ClNO]n, clusters at 355 nm are observed: Boltzmann ensembles of NO(υ″ = 1) and NO(υ″ = 0) molecules described by Trot of 310±30 and 170±25 K, respectively, with no spin-orbit or Λ-doublet state preferences, overlapped with a Gaussian distribution already assigned to the NO photofragment. The relative contribution of the NO(υ″ = 1) photofragment to the spectra is drastically reduced upon increasing the backing pressure, as it undergoes translational and rotational relaxation within the clusters. Our high-resolution studies provide evidence that suggests that the reaction takes place within the [ClNO]n clusters.
- Conde, Carlos,Maul, Christof,Quinones, Edwin
-
-
Read Online
- Photodissociation of Dimethylnitramine at 248 nm
-
The production of OH A2Σ+, OH X2Πi, NO2 A2B2, NO21 X2A1, and NO X2Π following dimethylnitramine (DMNA) photolysis at 248 nm has been investigated by using laser-induced fluorescence and emission spectroscopies.NO2 A2B2, NO2 X2A1, and OH X2Πi are formed via monophotonic, unimolecular pathways.The quantum yields for NO2 X2A1 and OH X2Πi production are estimated to be 0.15 and 0.004, respectively.The unimolecular production of NO X2Π (ν''=0) was not observed, implying its quantum yield is 2Σ+ is formed via a two- photon, unimolecular process.These results are compared with previous studies investigating the thermal and photochemical decomposition of DMNA.
- McQuaid, Michael J.,Miziolek, Andrzej W.,Sausa, Rosario C.,Merrow, Clifton N.
-
-
Read Online
- Photolysis of the C2H4-HONO complex in low temperature matrices: Formation of 2-nitrosoethanol
-
Photochemistry of C2H4?HONO complexes in argon matrices has been investigated using λ > 340 nm radiation of a medium pressure mercury arc. IR spectra were recorded after various periods of photolysis. The photolysis reaction was found to lead to formation of 2-nitrosoethanol that was identified for the first time. Three groups of bands showing different behavior during photolysis process and after matrix annealing were assigned to three different conformers of 2-nitrosoethanol molecule. The experimental data are supported by ab initio calculations.
- Olbert-Majkuta, Adriana,Mielke, Zofia,Tokhadze, Konstantin G.
-
-
Read Online
- Laser Photolysis Studies of Nitric Oxide Adducts of Cobalt(II) Porphyrins. Photoinduced Denitrosylation at the Temperature Range 160-300 K
-
Laser photolysis studies reveal that nitric oxide cobalt(II) porphyrins in 2-methyltetrahydrofuran solutions undergo facile photolytic dissociation to yield nitric oxide and cobalt(II) porphyrin.The quantum yields for the photodissociation of nitric oxide
- Hoshino, Mikio,Arai, Shigeyoshi,Yamaji, Minoru,Hama, Yoshimasa
-
-
Read Online
- Absolute Rate Constants for the Reactions of HCO with O2 and NO from 298 to 503 K
-
The absolute rate constants for the reactions HCO + O2 ---> HO2 + CO and HCO + NO ---> HNO + CO have been determined by using a flah photolysis-laser resonance absorption technique.The values obtained at 298 K are in units of cm3molecule-1s-1: kO2=(5.6+/-0.6)E-12 and kNO=(12.3+/-1.2)E-12.Negative temperature coefficients have been found between 298 and 503 K for both reactions: kO2=5.5E-11 * T-0.4+/-0.3 and kNO=1.2E-10 * T-0.4+/-0.3.Both formaldehyde and acetaldehyde were used as sources of formyl radicals.The total pressure was varied with no noticeable effect on the rate constants.Critical evaluation and recommendation are made in view of the previous results for use in atmospheric modeling.
- Veyret, B.,Lesclaux, R.
-
-
Read Online
- High-Temperature Photochemistry Kinetics Study of the Reaction H + NO2 -> OH + NO from 296 to 760 K
-
Rate coefficients for the H + NO2 -> OH + NO reaction have been measured by using the high-temperature photochemistry (HTP) technique.H atoms are generated by flash photolysis of CH4, and their relative concentration is monitored by time-resolved resonance-fluorescence detection.The data are well-fitted by the empirical expression k(T) = 2.2 * 10-10 exp(-182 K/T) cm3 molecule-1 s-1 for the 296-760 K temperature range.The precision of the data is 7percent, and the accuracy is estimated to be 21percent, where both figures represent 2? statistical confidence intervals.Comparison of the ratio of the experimental reaction cross sections, at the temperature extremes, to the theoretical ratio supports a zero energy barrier.The potential stabilization channel leading to HONO is discussed.
- Ko, Taeho,Fontijn, Arthur
-
-
Read Online
- Production of reactive oxygen and nitrogen species by light irradiation of a nitrosyl phthalocyanine ruthenium complex as a strategy for cancer treatment
-
Production of reactive oxygen species has been used in clinical therapy for cancer treatment in a technique known as Photodynamic Therapy (PDT). The success of this therapy depends on oxygen concentration since hypoxia limits the formation of reactive oxygen species with consequent clinical failure of PDT. Herein, a possible synergistic effect between singlet oxygen and nitric oxide (NO) is examined since this scenario may display increased tumoricidal activity. To this end, the trinuclear species [Ru(pc)(pz)2{Ru(bpy) 2(NO)}2](PF6)6(I) (pc = phthalocyanine; pz = pyrazine; bpy = bipyridine) was synthesized to be a combined NO and singlet oxygen photogenerator. Photobiological assays using (I) at 4 × 10-6 M in the B16F10 cell line result in the decrease of cell viability to 21.78 ± 0.29% of normal under light irradiation at 660 nm. However, in the dark and at the same concentration of compound (I), viability was 91.82 ± 0.37% of normal. The potential application of a system like (I) in clinical therapy against cancer may be as an upgrade to normal photodynamic therapy.
- Heinrich, Tassiele A.,Tedesco, Antonio Claudio,Fukuto, Jon M.,Da Silva, Roberto Santana
-
-
Read Online
- Two-photon spectroscopy of the low lying Rydberg states of NO. I. The 3p and 3d complexes
-
The rotational structure and polarization dependence of two-photon spectra of aligned ensembles of open shell diatomics is investigated in terms of the spherical tensor components of the two-photon absorption operator. The formalism allows the straightforward incorporation of state interactions and perturbations. It is applied to the two-photon spectroscopy of NO, in particular to the excitation of the Rydberg states derived from the 3p and 3d complexes. All states investigated show a nearly quadratic power dependence indicating the saturation of the ionization step. Transitions dominated by a zeroth rank tensor component (e.g., C 2Π-X 2Π or H 2Σ, H′ 2Π-X 2Π) are insensitive to a possible angular momentum alignment in the ensemble. These transitions are ideally suited to determine degeneracy averaged observables, e.g., collision cross sections in a molecular beam scattering experiment or product velocity anisotropies in a single color photodissociation experiment. Rotational alignment data must be determined using two-photon transitions which are carried by a second rank tensor component (e.g., D 2Σ-X 2Π or F 2Δ-X 2Π).
- Meyer, Henning
-
-
Read Online
- Nitric Oxide Reacts Very Fast with Hydrogen Sulfide, Alcohols, and Thiols to Produce HNO: Revised Rate Constants
-
The chemical reactivity of NO and its role in several biological processes seem well established. Despite this, the chemical reduction of ?NO toward HNO has been historically discarded, mainly because of the negative reduction potential of NO. However, this value and its implications are nowadays under revision. The last reported redox potential, E′(NO,H+/HNO), at micromolar and picomolar concentrations of ?NO and HNO, respectively, is between -0.3 and 0 V at pH 7.4. This potential implies that the one-electron-reduction process for NO is feasible under biological conditions and could be promoted by well-known biological reductants with reduction potentials of around -0.3 to -0.5 V. Moreover, the biologically compatible chemical reduction of ?NO (nonenzymatic), like direct routes to HNO by alkylamines, aromatic and pseudoaromatic alcohols, thiols, and hydrogen sulfide, has been extensively explored by our group during the past decade. The aim of this work is to use a kinetic modeling approach to analyze electrochemical HNO measurements and to report for the first-time direct reaction rate constants between ?NO and moderate reducing agents, producing HNO. These values are between 5 and 30 times higher than the previously reported keff values. On the other hand, we also showed that reaction through successive attack by two NO molecules to biologically compatible compounds could produce HNO. After over 3 decades of intense research, the ?NO chemistry is still there, ready to be discovered.
- Neuman, Nicolas I.,Venancio, Mateus F.,Rocha, Willian R.,Bikiel, Damian E.,Suárez, Sebastián A.,Doctorovich, Fabio
-
-
Read Online
- The electronic spectrum of NOCl: Photofragment spectroscopy, vector correlations, and ab initio calculations
-
The electronic absorption spectrum of NOCl in the region 620-180 nm is assigned by using vector properties of the NO photofragment and the results of ab initio calculations at the CI level.In assigning the electronic spectrum, we take into account the rec
- Bai, Y. Y.,Ogai, A.,Qian, C. X. W.,Iwata, L.,Segal, G. A.,Reisler, H.
-
-
Read Online
- Kinetic Study of the Equilibrium HO2 + NO OH + NO2 and the Thermochemistry of HO2
-
Rate constants for the reactions HO2 + NO -> NO2 (kF) and OH + NO2 -> HO2 + NO (kR) have been measured at high temperatures by using laser magnetic resonance ddtection of HO2 and OH reactants in a flow tube reactor.The results are kF(T) = (3.51 +/- 0.35) * 10-12 exp cm3 molecule-1 s-1 for 232 R(T) = (3.03 +/- 0.60) * 10-11 exp cm3 molecule-1 s-1 for 452 = 2.5 +/- 0.6 kcal mol-1.Other measurements of this quantity and the thermochemistry of HO2 are discussed.
- Howard, Carleton J.
-
-
Read Online
- Comparative studies of the N2O/H2, N2O/CO, H2/O2 and CO/O2 reactions on supported gold catalysts: Effect of the addition of various oxides
-
The reduction of N2O with H2 and CO was studied on Au/TiO2, Au/Al2O3, Au/MIOx/MIIOx/Al 2O3, and Au/MOx/Al2O3 (MI, MII, M + Li, Rb, Mg, Co, Mn, Ce, La, Ti). All the catalyst exhibited a high catalytic activity even at low temperatures. The highest conversion was reached over Au/TiO2-reductive pretreatment at 75°-175°C. The Al2O3-supported preoxidized catalysts exhibited a better performance than the TiO2-supported preoxidized catalysts for the H2 + O2 reaction. For the H2 + N2O reaction, the differences in behavior of the TiO2 and Al2O3-supported catalysts were relatively small. Over Au-based catalysts, experiments of N2O in the absence of any reducing gas in the system did not reveal any decomposition products. A significant synergistic effects was also found for multi-component catalysts containing both an alkali metal oxide and a TMO, in this case CoOx. However, the enhancement in activity was not as big as in the case of ceria and an alkali metal oxide.
- Gluhoi,Dekkers,Nieuwenhuys
-
-
Read Online
- Reactivity of the iron porphyrin Fe(TPP)(NO) with excess no. Formation of Fe(TPP)(NO (NO2) occurs via reaction with trace NO2
-
Fe(TPP)(NO) (TPP = tetraphenylporphyrinato dianion) does not react observably with excess NO in organic solvents at ambient pressure and temperature; however, adventitious NO2 rapidly leads to the nitrosyl nitro product Fe(TPP)(NO)(NO2/su
- Lorkovic, Ivan M.,Ford, Peter C.
-
-
Read Online
- Synthesis, characterization and photochemical properties of some ruthenium nitrosyl complexes
-
Synthesis of new nitrosyl complexes [RuCl3(CNPy) 2(NO)] (1), [RuCl3(AMPy)2(NO)] (2), [RuCl 3(CPI)2(NO)] (3), [RuCl3(NOPI)2(NO)] (4), and [RuCl3(HPI)2/
- Kumar, Amit,Pandey, Rampal,Gupta, Rakesh Kumar,Ghosh, Kaushik,Pandey, Daya Shankar
-
-
Read Online
- Microwave optical double resonance of HNO: Rotational spectrum in 1A'' (100)
-
Rotational transitions in the 1 A'' (100) state of HNO were observed using the technique of microwave optical double resonance.The HNO molecule was produced in a fast flow system by the reaction of discharged oxygen with a mixture of propylene and NO.Eighteen rotational lines observed in the frequency regions of 8 to 157 GHz and rf were analyzed to give rotational constants and centrifugal disortion constants.Perturbations were found in the K -type doubling frequencies of K-1 = 1 and 2.
- Takagi, Kojiro,Saito, Shuji,Kakimoto, Masao,Hirota, Eizi
-
-
Read Online
- Photodissociation of an alkyl nitrite at a liquid surface: Flight-time distributions of NO and HNO
-
The photochemistry at a gas-liquid interface was investigated by time-of-flight quadrupole mass spectroscopy. A liquid film of dodecyl dinitrite (ONO(CH2)12ONO), dissolved in squalane (C30H62), was irradiated with low-fluence laser pulses at 275 and 355 nm. The translational temperature of most NO and all HNO desorbate is in equilibrium with the liquid. A quantitative simulation requires that diffusion and radical reactions in the liquid are included. Ejection of hyperthermal NO (Ttrans=500-2200 K) was also observed. The results are compared to those of alkyl nitrite monomers, clusters and solid films.
- Furlan, Alan
-
-
Read Online
- Selective Catalytic Reduction of Nitric Oxide with Ammonia on MFI-Type Ferrisilicate
-
The catalytic properties of framework Fe(3+) in MFI-type H-ferrisilicate for the selective reduction of nitric oxide with ammonia in the presence of oxygen have been investigated and compared with those of Fe-exchanged ZSM-5, iron oxide supported on silicalite and HZSM-5.H-ferrisilicate exhibited a high activity and selectivity for the reduction of nitric oxide into nitrogen.A side reaction, i.e. the oxidation of ammonia with oxygen into nitrogen, occured only above 773 K.The activity and selectivity of Fe-exchanged ZSM-5 for the reduction of nitric oxide were comparable to those of H-ferrisilicate, while iron oxide supported on silicalite catalysed the oxidation of ammonia with oxygen into nitric oxide preferentially under the same reaction conditions.The catalytic activity of HZSM-5 for this reaction was much lower than that of H-ferrisilicate.Therefore, the framework Fe(3+) ions in H-ferrisilicate are the active sites for the selective catalytic reduction of nitric oxide.
- Uddin, Md. Azhar,Komatsu, Takayuki,Yashima, Tatsuaki
-
-
Read Online
- Rotational temperature dependences of gas phase ion-molecule reactions
-
A technique for measuring the rotational temperature dependences of gas phase ion-molecule rate constants is presented.The technique involves measuring the kinetic energy dependences of the rate constants at several temperatures in a variable temperature selected ion flow drift tube.For a monatomic ion, comparing the rate constants at the same center of mass kinetic energy at different temperatures yields the dependence of the rate constant on the internal temperature of the reactant neutral.For neutrals in which the vibrational modes are inactive at the temperatures of the experiment, the internal energy dependence is the rotational temperature dependence.Two examples are presented here, one in which rotational energy significantly influences the rate constants, approximately T-0.5, and one in which it does not.Implications for past drift tube experiments are discussed.
- Viggiano, A. A.,Morris, Robert A.,Paulson, John F.
-
-
Read Online
- Kinetics of SH with NO2, O3, O2, and H2O2
-
A low pressure (1-8 torr of He) discharge flow reactor with (a) LIF detection of SH using a high repetition rate (20 kHz) metal atom laser to circumvent severe predissociation of the A2Σ+ state and (b) resonance fluorescence detection of OH has been used to examine the kinetics of the title reactions at 298 K: SH + NO2 -> HSO + NO, k1=(3.0+/-0.8)x10-11 cm3s-1; SH + O3 -> HSO + O2,k2 = (3.2+/- 1.0)x10-12cm3s-1;SH + O2 -> SO + OH,k3 -17 cm3s-1;SH + H2O2 -> H2S + HO2,k4a;SH + H2O2 -> HSOH + OH,k4b;SH + H2O2 -> HSO + H2O,k4c. k4=k4a+k4b+k4c-15 cm3s-1.Regeneration of SH in reaction 2 by HSO + O3 is observed and is used to infer a rate constant for HSO + O3 -> products of (1.0+/-0.4)x10-13cm3s-1.Absence of OH production in that reaction implies that the primary products are SH + 2O2.Isotope experiments with H2S replaced by D2S substantiate that conclusion and yield a reaction rate constant for DSO + O3 -> SD + 2O2 of 9x10-14 cm3s-1.Brief discussions of SH reactivity compared with OH and Br are offered, as well as a summary of the atmospheric chemistry of SH.
- Friedl, Randall R.,Brune, William H.,Anderson, James G.
-
-
Read Online
- High-Temperature Kinetics of Si + N2O
-
In the present study the very fast high-temperature thermal decomposition of silane was used as a Si atom source to initiate its reactions with N2O.The experiments were performed behind reflected shock waves in SiH4/N2O/Ar systems by applying Atomic Resonance Absorption Spectroscopy (ARAS) for detecting Si and N atoms.Initial mixtures of 0.5 - 50 ppm SiH4 and 25 - 200 ppm N2O were used to perform experiments in the temperature range 1780 K /3), was determined by fitting calulated to measured profiles.From energetical reasons reaction R3 can proceed via two exothermic product channels: Si + N2O ->/3a) and Si + N2O ->/3b).To separate both possible channels, N atoms were measured, which are to be expected from secondary reactions including the products of the channel (R3a).Again by computer fittings rate coefficients for k3a were obtained, which can be summarized by the following Arrhenius expression: k3a = 5.0 x 1014 exp(-8100 K/T) cm3 mol-1 s-1 (+/- 50 percent).From the results of both, Si and N atom measuremetns, a mean value for the remaining rate coefficient k3b = 8.0 x 1013 cm3 mol-1 s-1 (+/- 50 percent) was obtained.Detailed computer simulations based on a proposed reaction mechanism revealed estimates of further rate coefficients.
- Mick, Hans Juergen,Roth, Paul
-
-
Read Online
- Photochemical and pharmacological aspects of nitric oxide release from some nitrosyl ruthenium complexes entrapped in sol-gel and silicone matrices
-
The entrapped [Ru(terpy)(L)NO](PF6)3, where terpy = 2,2′:6′,2″-terpyridine and L = 2,2′-bipyridine (bpy) and 3,4-diiminebenzoic acid (NH · NHq) complexes into sol-gel processed polysiloxane and silicone matrices, shows NO release characteristics when submitted to light irradiation at 355 and 532 nm, as judged by NO measurement using a NO-sensor electrode. The pharmacological properties of doped matrix showed vasodilator characteristics by visible light irradiation, which is of great interest because the target delivery system can avoid the occurrence of side effects possibly by the aquo ruthenium species. All matrices obtained showed to be amorphous materials. The scanning electron micrographs of the matrices showed irregularly shaped particles, with a broad size of 1000 μm for both matrices and homogeneous distribution.
- de Lima, Renata Galv?o,Sauaia, Marilia Gama,Ferezin, Camila,Pepe, Iuri Muniz,José, Nádia Mamede,Bendhack, Lusiane M.,da Rocha, Zênis Novais,da Silva, Roberto Santana
-
-
Read Online
- Unimolecular decomposition of NO3: The NO+O2 threshold regime
-
The unimolecular decomposition of expansion-cooled NO3 has been investigated in the threshold regime of the NO+O2 channel. Photoexcitation in the region 16 780-17 090 cm-1 (596-585 nm) prepares ensembles of molecular eigenstates, each of which is a mixture of the B 2E′ bright state and lower electronic states. The X 2A′2 ground state is believed to be the probable terminus of 2E′ radiationless decay, though participation of A 2E″ is also possible. For these photon energies, unimolecular decomposition occurs exclusively via the NO+O2 channel, and NO yield spectra and state distributions have been obtained. The yield spectra are independent of the rotational state monitored, as expected for a large reverse barrier. The state distributions are insensitive to the photolysis photon energy and can be rationalized in terms of dynamical bias. The NO yield goes to zero rapidly above the O+NO2 threshold (17 090±20 cm-1). Because of tunneling, the NO+O2 channel does not have a precise threshold; the value 16 780 cm-1 is the smallest photon energy that yielded signals under the present conditions. Very small decomposition rates were obtained via time-domain measurements in which reactive quenching of long-lived NO3 fluorescence was observed. The rates varied from 1×104 at 16780 cm-1 to 6×107 s-1 at 16 880 cm-1, and their collision free nature was confirmed experimentally. These data were fitted by using a one-dimensional tunneling model for motion along the reaction coordinate combined with the threshold Rice-Ramsperger-Kassel-Marcus (RRKM) rate. The top of the NO+O2 barrier is estimated to lie at 16 900 ± 15 cm-1. Translational energy measurements of specific NO (X 2∏Ω,v,J) levels showed that O2 is highly excited, with a population inversion extending to energies above the a 1Δg threshold, in agreement with previous work. It is possible that the main O2 product is X 3∑g-, though some participation of a 1Δg cannot be ruled out. Within the experimental uncertainty, b 1∑g+ is not produced.
- Mikhaylichenko,Riehn,Valachovic,Sanov,Wittig
-
-
Read Online
- O-Atom Yields from Microwave Discharges in N2O/Ar Mixtures
-
We have studied the products of Ar/N2O microwave discharges to determine their fitness as sources of atomic oxygen in discharge-flow reactors.For N2O feed rates below 10 to 20 μmol s-1, the discharge converts about 75percent of the N2O to atomic oxygen and, in addition, prduces small quantities of atomic nitrogen, generally less than 10percent of the O-atom product.At higher N2O feed rates the O-atom production efficiency decreases, and some nitric oxide accompanies the O atoms out of the discharge.At intermediate N2O feed rates, only atomic oxygen is observed, and neither N nor NO leaves the discharge.The exact point at which this occurs is a function of the discharge power and the Ar/N2O mixing ratio.Adding molecular nitrogen to the discharge eliminates any NO product, but at the penalty of a slightly reduced O-atom production efficiency.Atomic oxygen flows in excess of 20 μmol s-1 are produced at pressures near 1 torr and dicharge powers of only 30 W.In kinetic modeling of the discharge chemistry, we can account for the experimental observations only if the electron-impact dissociation of the N2O in the discharge proceeds through a spin-forbidden channel to produce O(3P).In addition, the model indicates that about 10-20percent of the N2O dissociations resuts from collisions between metastable argon atoms in the discharge and N2O.
- Piper, Lawrence G.,Rawlins, Wilson T.
-
-
Read Online
- Improving NO2 sensitivity by adding WO3 during processing of NiO sensing-electrode of mixed-potential-type zirconia-based sensor
-
A planar N O2 sensor was fabricated by using an yttria-stabilized zirconia plate and NiO-based sensing electrode (SE). The improvement in sensing characteristic of mixed-potential-type planar N O2 sensor was examined by the addition of various metal oxides to NiO-SE. Among the metal-oxide additives tested, W O3 was found to give a significant enhancement in N O2 sensitivity. In addition, this enhancement was maximum when the initial W O3 content in the NiO-based paste before sintering was 10 wt %. The sensitivity (Δ electromotive force) to 50 ppm N O2 was as high as about 70 mV for the sensor using the 10 wt % W O3 -added NiO-SE at 800°C under the wet condition (containing 5 vol % H2 O). The sensitivity of this sensor was still 8 mV even down to 1 ppm N O2 at 800°C. The N O2 sensitivity was found to be invariant to different concentrations of H2 O and C O2 in the examined range of 5-15 and 5-20 vol %, respectively. It is speculated that the modification of morphology of the NiO-SE layer by the addition of W O3 is the main contributing factor for the improved N O2 sensitivity of the sensor.
- Miura, Norio,Wang, Jian,Elumalai, Perumal,Ueda, Taro,Terada, Daisuke,Hasei, Masaharu
-
-
Read Online
- DIODE LASER KINETIC STUDIES OD RADICAL REACTIONS. 1. REACTION OF CF3 RADICALS WITH NO2
-
The reaction of CF3 radicals with NO2 has been studied over the pressure range 4-20 Torr at 300 K.CF3 radicals were produced by infrared multiphoton dissociation of CF3I.The subsequent decay of the radicals was monitored by using time-resolved diode laser
- Sugawara, Ko-ichi,Nakanaga, Taisuke,Takeo, Harutoshi,Matsumura, Chi
-
-
Read Online
- Nonlocal thermodynamic equilibrium effects of vibrationally excited NO
-
The vibrational distribution of NO(X 2?) from the reaction O(3P) + NO2(X 2A1) -> NO(X 2?,v'') + O2 was studied at room temperature in a fast-flow system.Oxygen atoms were produced via the microwave-discharge dissociation of molecular oxygen with argon as the carrier gas.The reaction time between the NO2 molecules and the oxygen atoms was kept at ca. 3 ms to minimize vibrational energy quenching.NO(X) radicals were detected via laser-induced fluorescence of the A 2Σ+ 2? electronic transition.The relative vibrational population ratio of NO inthe ground electronic state was determined to be 87.4 +/- 2.6percent and 12.6 +/- 2.7percent in the v'' = 0 and v'' = 1 levels, respectively.No higher vibrational states were observed.The NO vibrational population ratio measured in this study correlates well with the earlier obervation of high vibrational excitation in O2.
- Moralejo, C.,Cody, R. J.,Allen, J. E.
-
-
Read Online
- Ceria Nanoparticles as an Unexpected Catalyst to Generate Nitric Oxide from S-Nitrosoglutathione
-
Ceria nanoparticles (NPs) are widely reported to scavenge nitric oxide (NO) radicals. This study reveals evidence that an opposite effect of ceria NPs exists, that is, to induce NO generation. Herein, S-nitrosoglutathione (GSNO), one of the most biologically abundant NO donors, is catalytically decomposed by ceria NPs to produce NO. Ceria NPs maintain a high NO release recovery rate and retain their crystalline structure for at least 4 weeks. Importantly, the mechanism of this newly discovered NO generation capability of ceria NPs from GSNO is deciphered to be attributed to the oxidation of Ce3+ to Ce4+ on their surface, which is supported by X-ray photoelectron spectroscopy and density functional theory analysis. The prospective therapeutic effect of NO-generating ceria NPs is evaluated by the suppression of cancer cells, displaying a significant reduction of 93% in cell viability. Overall, this report is, to the authors’ knowledge, the first study to identify the capability of ceria NPs to induce NO generation from GSNO, which overturns the conventional concept of them acting solely as a NO-scavenging agent. This study will deepen our knowledge about the therapeutic effects of ceria NPs and open a new route toward the NO-generating systems for biomedical applications.
- Chandrawati, Rona,Gao, Yuan,Kumar, Priyank,Luo, Zijie,Yang, Tao,Zhou, Yingzhu
-
-
- Two-dimensional cluster catalysts with superior thermal stability and catalytic activity for AP
-
The preparation of catalysts with small particle size, large specific surface area and high atomic utilization has always been the focus of research in the field of catalysis. As for energetic materials, catalysts are always used to improve the thermal decomposition performance of ammonium perchlorate (AP) as it has significant effect on the power of engine. In this work, a two-dimensional metal clusters catalyst has been successfully prepared by solvothermal and heat treatment to improve thermal decomposition performance of AP. In detail, the transition metal ions were supported on the graphene oxide (GO) surface by organic ligands linking, followed by heat treatment to obtain two-dimensional rGO based metal clusters catalyst. The morphology and structure of the catalysts at different temperatures and their effect on AP decomposition were studied, the results show that catalyst at 300 °C has a particle size of 20 nm and uniformly distributed on rGO. The catalyst promotes the high temperature decomposition of AP by 73.7 °C with improved stability, and increases the heat release from 652.73 J/g to 1392.11 J/g. This may be attributed to good conductivity of GO and the strong gain-loss electron ability of the metal clusters. The presence of GO increased the active sites for cluster catalysis, additional, the metal clusters have a positive synergistic effect with GO. Thus, the thermal decomposition performance of AP was enhanced meanwhile thermal stability can also be improved.
- Guo, Yanli,Liang, Taixin,Liu, Wei,Song, Ruidong,Wang, Chao,Xiao, Fei,Zhang, Jiangbo
-
-
- Nitric oxide generation study of unsymmetrical β-diketiminato copper(ii) nitrite complexes
-
β-Diketiminato copper(ii) L1CuCl-L4CuCl and their nitrite complexes L1Cu(O2N) and L2Cu(O2N) have been synthesized and characterized. X-ray analysis of the L1CuCl-L4CuCl complexes clearly reveals their mononuclear structure with a four-coordinated Cu(ii) center bound by one chloride and three nitrogen atoms of unsymmetrical β-diketiminato ligands. Cyclic voltametric analysis of the Cu(ii) complexes shows that the length of the pyridyl arm controls the Cu(ii)/Cu(i) redox process. DFT and EPR results confirm that the geometry of the Cu(ii) complexes is also controlled by the length of the chelating pyridyl arm. The oxygen atom transfer nitrite reduction of the Cu(ii) nitrite complexes leads to the formation of copper(i)-PPh3 and OPPh3 which were confirmed by 1H and 31P NMR. The length of the pyridyl arm of the copper(ii) nitrite complexes governs the NO-releasing ability. These findings illustrate the important bioinspired behaviour and NO generation from nitrite via oxygen atom transfer of the unsymmetrical β-diketiminato copper(ii) complexes as compared to symmetrical β-diketiminato copper(ii) complexes.
- Chand, Kuldeep,Chu, Yu-Cheng,Hsu, Sodio C. N.,Kao, Chai-Lin,Lin, Ya-Fan,Tsai, Ming-Li,Wang, Tzai-Wei
-
supporting information
p. 3485 - 3496
(2022/03/14)
-
- Reactions of water-soluble binuclear tetranitrosyl iron complexes of the μ-S structural type with adenosine triphosphoric acid: Kinetics and reaction mechanism
-
The reactions of adenosine triphosphoric acid (ATP) with water-soluble binuclear tetranitrosyl iron complexes of the μ-S structural type with functional sulfur-containing ligands (thiosulfate (1) cysteamine (2), and penicillamine (3)) afford products of close structures. The hydrolysis products of the complexes (1–3) in aqueous aerobic solutions are studied by amperometry and mass electrospectrometry. The kinetic regularities of the reactions of the complexes (1–3) with ATP are studied by the spectrofluorimetric method. A generalized kinetic model describing the experimental data of three reactions is proposed for the process. From the qualitative point of view, the reactions of ATP with the studied complexes occur similarly in spite of the difference in the ligands. The rates of particular steps of the process depend on the nature of the ligands. The values determined for the kinetic parameters quantitatively characterize the influence of the ligand nature in complexes 1–3 on the reactivity toward ATP and increase in the order: cysteamine penicillamine thiosulfate.
- Konyukhova, Alina S.,Psikha, Boris L.,Sanina, Natalia A.,Saratovskikh, Elena A.,Sulimenkov, Ilya V.
-
-
- Structural and Photodynamic Studies on Nitrosylruthenium-Complexed Serum Albumin as a Delivery System for Controlled Nitric Oxide Release
-
How to deliver nitric oxide (NO) to a physiological target and control its release quantitatively is a key issue for biomedical applications. Here, a water-soluble nitrosylruthenium complex, [(CH3)4N][RuCl3(5cqn)(NO)] (H5cqn = 5-chloro-8-quinoline), was synthesized, and its structure was confirmed with 1H NMR and X-ray crystal diffraction. Photoinduced NO release was investigated with time-resolved Fourier transform infrared and electron paramagnetic resonance (EPR) spectroscopies. The binding constant of the [RuCl3(5cqn)(NO)]- complex with human serum albumin (HSA) was determined by fluorescence spectroscopy, and the binding mode was identified by X-ray crystallography of the HSA and Ru-NO complex adduct. The crystal structure reveals that two molecules of the Ru-NO complex are located in the subdomain IB, which is one of the major drug binding regions of HSA. The chemical structures of the Ru complexes were [RuCl3(5cqn)(NO)]- and [RuCl3(Glycerin)NO]-, in which the electron densities for all ligands to Ru are unambiguously identified. EPR spin-trapping data showed that photoirradiation triggered NO radical generation from the HSA complex adduct. Moreover, the near-infrared image of exogenous NO from the nitrosylruthenium complex in living cells was observed using a NO-selective fluorescent probe. This study provides a strategy to design an appropriate delivery system to transport NO and metallodrugs in vivo for potential applications.
- Xie, Leilei,Bai, Hehe,Song, Luna,Liu, Chenyang,Gong, Wenjun,Wang, Wenming,Zhao, Xuan,Takemoto, Chie,Wang, Hongfei
-
p. 8826 - 8837
(2021/06/27)
-
- Two-Photon Absorption Properties in “Push-Pull” Ruthenium Nitrosyl Complexes with various Fluorenylterpyridine-Based Ligands
-
Using the compound [RuII(FT)(bipy)(NO)](PF6)3 (FT is the electron-rich 4’-(2-fluorenyl)-2,2’:6’,2’’-terpyridine ligand and bipy is 2–2’bipyridine) as a reference, two new compounds are presented in which carbon-carbon double and triple bonds are inserted between the fluorenyl substituent and the terpyridine to provide an extended conjugation path. The electronic properties of the three complexes are compared experimentally by UV-visible spectroscopy and computationally by means of the density functional theory. All of them exhibit a capability for NO release under irradiation on their low-energy transition located in the 400–500 nm range, with a quantum yield around 0.01. Their two-photon absorption (TPA) cross sections are investigated by the Z-scan technique at λ=800 nm. While the reference compound exhibits a cross-section equal to 108 GM, the introduction of double and triple bonds leads to increased cross-sections equal to 131 GM and 150 GM, respectively. These values are discussed in reference to the two-level model in use for “push-pull” dipolar TPA chromophores.
- Bukhanko, Valerii,León-Rojas, Andrés Felipe,Lacroix, Pascal G.,Tassé, Marine,Ramos-Ortiz, Gabriel,Barba-Barba, Rodrigo M.,Farfán, Norberto,Santillan, Rosa,Malfant, Isabelle
-
p. 1670 - 1684
(2021/05/03)
-
- Investigation of kinetic parameters for ammonium perchlorate thermal decomposition in presence of gCN/CuO by TG-MS analysis and kinetic compensation correction
-
The desire to develop a benign burn rate modifier for propellants has accentuated polymeric carbon nitride (gCN) as a potential candidate for the thermal decomposition of ammonium perchlorate (AP). Here, we have synthesized composites of leaf-shaped CuO and gCN via a facile sonochemical approach. From DSC analysis, the addition of gCNCuO1 reduced the decomposition temperature of AP by 59°C and increased the heat release by ~ 1.4 times that of pure AP. The kinetics of AP decomposition was well investigated via in-situ TG-MS technique. From evolved gas analysis evolution of NO, Cl, HCl, N2O/CO2, NO2 and Cl2 fragments were detected. The quantitative interpretation of kinetic parameters for AP decomposition was done using Coats-Redfern method and the normalization of E values were carried out by applying Kinetic Compensation Correction (KCC). After normalization, E values were decreased by 17 ?kJ/mol and 18 ?kJ/mol for the first and second stages respectively.
- Jos, Jisna,Mani, Gladiya,Mathew, Suresh,Radhakrishnan Nair, P.
-
-
- Mechanism of O-Atom Transfer from Nitrite: Nitric Oxide Release at Copper(II)
-
Nitric oxide (NO) is a key signaling molecule in health and disease. While nitrite acts as a reservoir of NO activity, mechanisms for NO release require further understanding. A series of electronically varied β-diketiminatocopper(II) nitrite complexes [CuII](κ2-O2N) react with a range of electronically tuned triarylphosphines PArZ3 that release NO with the formation of O═PArZ3. Second-order rate constants are largest for electron-poor copper(II) nitrite and electron-rich phosphine pairs. Computational analysis reveals a transition-state structure energetically matched with experimentally determined activation barriers. The production of NO follows a pathway that involves nitrite isomerization at CuII from κ2-O2N to κ1-NO2 followed by O-atom transfer (OAT) to form O═PArZ3 and [CuI]-NO that releases NO upon PArZ3 binding at CuI to form [CuI]-PArZ3. These findings illustrate important mechanistic considerations involved in NO formation from nitrite via OAT.
- Stauffer, Molly,Sakhaei, Zeinab,Greene, Christine,Ghosh, Pokhraj,Bertke, Jeffery A.,Warren, Timothy H.
-
supporting information
p. 15968 - 15974
(2021/07/26)
-
- Synthesis, structure, and PDE inhibiting activity of the anionic DNIC with 5-(3-pyridyl)-4H-1,2,4-triazole-3-thiolyl, the nitric oxide donor
-
A new inhibitor of phosphodiesterase (PDE), i.e., nitric oxide (NO) donor, a water soluble DNIC Na[Fe(C7H5N4S)2(NO)2]?2·.5H2O (1), has been synthesized. The structure of the new complex, its physical–chemical properties in the solid state and in solutions have been studied experimentally (X-ray analysis, IR, UV–Vis, Mossbauer spectroscopy, mass-spectrometry, and amperometry) and theoretically (quantum-chemical modeling by DFT method).
- Aldoshin, Sergey M.,Dorovatovskii, Pavel V.,Emel'yanova, Nina S.,Isaeva, Yuliya A.,Kotel'nikov, Alexandr I.,Ovanesyan, Nickolai S.,Pokidova, Olesya V.,Sanina, Natalia A.,Sulimenkov, Il'ya V.,Tat'yanenko, Liliya V.,Utenyshev, Andrey N.
-
-
- Biochemical Characterization, Phytotoxic Effect and Antimicrobial Activity against Some Phytopathogens of New Gemifloxacin Schiff Base Metal Complexes
-
String of Fe(III), Cu(II), Zn(II) and Zr(IV) complexes were synthesized with tetradentateamino Schiff base ligand derived by condensation of ethylene diamine with gemifloxacin. The novel Schiff base (4E,4′E)-4,4′-(ethane-1,2-diyldiazanylylidene)bis{7-[(4Z
- Mohamed, Amira A.,Elshafie, Hazem S.,Sadeek, Sadeek A.,Camele, Ippolito
-
-
- Red-Light-Mediated Photoredox Catalysis Enables Self-Reporting Nitric Oxide Release for Efficient Antibacterial Treatment
-
Nitric oxide (NO) serves as a key regulator of many physiological processes and as a potent therapeutic agent. The local delivery of NO is important to achieve target therapeutic outcomes due to the toxicity of NO at high concentrations. Although light stimulus represents a non-invasive tool with spatiotemporal precision to mediate NO release, many photoresponsive NO-releasing molecules can only respond to ultraviolet (UV) or near-UV visible light with low penetration and high phototoxicity. We report that coumarin-based NO donors with maximal absorbances at 328 nm can be activated under (deep) red-light (630 or 700 nm) irradiation in the presence of palladium(II) tetraphenyltetrabenzoporphyrin, enabling stoichiometric and self-reporting NO release with a photolysis quantum yield of 8 % via photoredox catalysis. This NO-releasing platform with ciprofloxacin loading can eradicate Pseudomonas aeruginosa biofilm in vitro and treat cutaneous abscesses in vivo.
- Hu, Jinming,Liu, Shiyong,Shen, Ruan,Shen, Zhiqiang,Xiao, Shiyan,Zheng, Shaoqiu
-
supporting information
p. 20452 - 20460
(2021/08/09)
-
- Catalytic patch with redox Cr/CeO2 nanozyme of noninvasive intervention for brain trauma
-
Traumatic brain injury (TBI) is a sudden injury to the brain, accompanied by the production of large amounts of reactive oxygen and nitrogen species (RONS) and acute neuroinflammation responses. Although traditional pharmacotherapy can effectively decrease the immune response of neuron cells via scavenging free radicals, it always involves in short reaction time as well as rigorous clinical trial. Therefore, a noninvasive topical treatment method that effectively eliminates free radicals still needs further investigation. Methods: In this study, a type of catalytic patch based on nanozymes with the excellent multienzyme-like activity is designed for noninvasive treatment of TBI. The enzyme-like activity, free radical scavenging ability and therapeutic efficacy of the designed catalytic patch were assessed in vitro and in vivo. The structural composition was characterized by the X-ray diffraction, X-ray photoelectron spectroscopy and high-resolution transmission electron microscopy technology. Results: Herein, the prepared Cr-doped CeO2 (Cr/CeO2) nanozyme increases the reduced Ce3+ states, resulting in its enzyme-like activity 3-5 times higher than undoped CeO2. Furthermore, Cr/CeO2 nanozyme can improve the survival rate of LPS induced neuron cells via decreasing excessive RONS. The in vivo experiments show the Cr/CeO2 nanozyme can promote wound healing and reduce neuroinflammation of mice following brain trauma. The catalytic patch based on nanozyme provides a noninvasive topical treatment route for TBI as well as other traumas diseases. Conclusions: The catalytic patch based on nanozyme provides a noninvasive topical treatment route for TBI as well as other traumas diseases.
- Zhang, Shaofang,Liu, Ying,Sun, Si,Wang, Junying,Li, Qifeng,Yan, Ruijuan,Gao, Yalong,Liu, Haile,Liu, Shuangjie,Hao, Wenting,Dai, Haitao,Liu, Changlong,Sun, Yuanming,Long, Wei,Mu, Xiaoyu,Zhang, Xiao-Dong
-
p. 2806 - 2821
(2021/02/03)
-
- Thionitrite and Perthionitrite in NO Signaling at Zinc
-
NO and H2S serve as signaling molecules in biology with intertwined reactivity. HSNO and HSSNO with their conjugate bases ?SNO and ?SSNO form in the reaction of H2S with NO as well as S-nitrosothiols (RSNO) and nitrite (NO2?) that serve as NO reservoirs. While HSNO and HSSNO are elusive, their conjugate bases form isolable zinc complexes Ph,MeTpZn(SNO) and Ph,MeTpZn(SSNO) supported by tris(pyrazolyl)borate ligands. Reaction of Na(15-C-5)SSNO with Ph,MeTpZn(ClO4) provides Ph,MeTpZn(SSNO) that undergoes S-atom removal by PEt3 to give Ph,MeTpZn(SNO) and S=PEt3. Unexpectedly stable at room temperature, these Zn-SNO and Zn-SSNO complexes release NO upon heating. Ph,MeTpZn(SNO) and Ph,MeTpZn(SSNO) quickly react with acidic thiols such as C6F5SH to form N2O and NO, respectively. Increasing the thiol basicity in p-substituted aromatic thiols 4?XArSH in the reaction with Ph,MeTpZn(SNO) turns on competing S-nitrosation to form Ph,MeTpZn-SH and RSNO, the latter a known precursor for NO.
- Bertke, Jeffery A.,Hosseininasab, Valiallah,Warren, Timothy H.
-
supporting information
p. 21184 - 21188
(2021/08/25)
-
- Electrochemical Nitric Oxide Reduction on Metal Surfaces
-
Electrocatalytic denitrification is a promising technology for removing NOx species (NO3?, NO2? and NO). For NOx electroreduction (NOxRR), there is a desire for understanding the catalytic parameters that control the product distribution. Here, we elucidate selectivity and activity of catalyst for NOxRR. At low potential we classify metals by the binding of *NO versus *H. Analogous to classifying CO2 reduction by *CO vs. *H, Cu is able to bind *NO while not binding *H giving rise to a selective NH3 formation. Besides being selective, Cu is active for the reaction found by an activity-volcano. For metals that does not bind NO the reaction stops at NO, similar to CO2-to-CO. At potential above 0.3 V vs. RHE, we speculate a low barrier for N coupling with NO causing N2O formation. The work provides a clear strategy for selectivity and aims to inspire future research on NOxRR.
- Bagger, Alexander,Rossmeisl, Jan,Wan, Hao
-
supporting information
p. 21966 - 21972
(2021/09/02)
-
- An Integrated View of Nitrogen Oxyanion Deoxygenation in Solution Chemistry and Electrospray Ion Production
-
There has been an increasing interest in chemistry involving nitrogen oxyanions, largely due to the environmental hazards associated with increased concentrations of these anions leading to eutrophication and aquatic dead zones . Herein, we report the synthesis and characterization of a suite of MNOx complexes (M = Co, Zn: x = 2, 3). Reductive deoxygenation of cobalt bis(nitrite) complexes with bis(boryl)pyrazine is faster for cobalt than previously reported nickel, and pendant O-bound nitrito ligand is still readily deoxygenated, despite potential implication of an isonitrosyl primary product. Deoxygenation of zinc oxyanion complexes is also facile, despite zinc being unable to stabilize a nitrosyl ligand, with liberation of nitric oxide and nitrous oxide, indicating N-N bond formation. X-ray photoelectron spectroscopy is effective for discriminating the types of nitrogen in these molecules. ESI mass spectrometry of a suite of M(NOx)y (x = 2, 3 and y = 1, 2) shows that the primary form of ionization is loss of an oxyanion ligand, which can be alleviated via the addition of tetrabutylammonium (TBA) as a nonintuitive cation pair for the neutral oxyanion complexes. We have shown these complexes to be subject to deoxygenation, and there is evidence for nitrogen oxyanion reduction in several cases in the ESI plume. The attractive force between cation and neutral is explored experimentally and computationally and attributed to hydrogen bonding of the nitrogen oxyanion ligands with ammonium α-CH2 protons. One example of ESI-induced reductive dimerization is mimicked by bulk solution synthesis, and that product is characterized by X-ray diffraction to contain two Co(NO)2+ groups linked by a highly conjugated diazapolyene.
- Beagan, Daniel M.,Cabelof, Alyssa C.,Pepin, Robert,Pink, Maren,Carta, Veronica,Caulton, Kenneth G.
-
supporting information
p. 17241 - 17248
(2021/11/17)
-
- Chemical and photochemical behavior of ruthenium nitrosyl complexes with terpyridine ligands in aqueous media
-
The synthesis and behavior in water of a set of various cis(Cl,Cl)-[R-tpyRuCl2(NO)](PF6) and trans(Cl,Cl)-[R-tpyRuCl2(NO)](PF6) (R = fluorenyl, phenyl, thiophenyl; tpy = 2,2′:6′,2′′-terpyridine) complexes are presented. In any case, one chlorido ligand is substituted by a hydroxo ligand and the final species arises as a single trans(NO,OH) isomer, whatever the nature of the starting cis/trans(Cl,Cl) complexes. Six X-ray crystal structures are presented for cis(Cl,Cl)-[thiophenyl-tpyRuCl2(NO)](PF6) (cis-3a), trans(Cl,Cl)-[thiophenyl-tpyRuCl2(NO)](PF6) (trans-3a), trans(NO,OH)-[phenyl-tpyRu(Cl)(OH)(NO)](PF6) (4a), trans(NO,OH)-[thiophenyl-tpyRu(Cl)(OH)(NO)](PF6) (4b), trans(NO,OEt)-[phenyl-tpyRu(Cl)(OEt)(NO)](PF6) (5a), and trans(NO,OH)-[phenyl-tpyRu(Cl)(OEt)(NO)](PF6) (5b) compounds. The different cis/trans(Cl,Cl) complexes exhibit an intense low-lying transition in the λ = 330-390 nm range, which appears to be slightly blue-shifted after Cl → OH substitution. In water, both cis/trans(Cl,Cl) isomers are converted to a single trans(NO,OH) isomer in which one chlorido- is replaced by one hydroxo-ligand, which avoids tedious separation workout. The water stable trans(NO,OH)-species all release NO with quantum yields of 0.010 to 0.075 under irradiation at 365 nm. The properties are discussed with computational analysis performed within the framework of Density Functional Theory.
- Labra-Vázquez, Pablo,Bocé, Mathilde,Tassé, Marine,Mallet-Ladeira, Sonia,Lacroix, Pascal G.,Farfán, Norberto,Malfant, Isabelle
-
p. 3138 - 3154
(2020/03/19)
-
- Sequential Cleavage of Lignin Systems by Nitrogen Monoxide and Hydrazine
-
The cleavage of representative lignin systems has been achieved in a metal-free two-step sequence first employing nitrogen monoxide for oxidation followed by hydrazine for reductive C?O bond scission. In combining nitrogen monoxide and lignin, the newly developed valorization strategy shows the particular feature of starting from two waste materials, and it further exploits the attractive conditions of a Wolff-Kishner reduction for C?O bond cleavage for the first time. (Figure presented.).
- Altmann, Lisa-Marie,Heinrich, Markus R.,Hofmann, Dagmar,Hofmann, Laura Elena,Prusko, Lea
-
supporting information
(2020/03/27)
-
- The role of porphyrin peripheral substituents in determining the reactivities of ferrous nitrosyl species
-
Ferrous nitrosyl {FeNO}7 species is an intermediate common to the catalytic cycles of Cd1NiR and CcNiR, two heme-based nitrite reductases (NiR), and its reactivity varies dramatically in these enzymes. The former reduces NO2- to NO in the denitrification pathway while the latter reduces NO2- to NH4+ in a dissimilatory nitrite reduction. With very similar electron transfer partners and heme based active sites, the origin of this difference in reactivity has remained unexplained. Differences in the structure of the heme d1 (Cd1NiR), which bears electron-withdrawing groups and has saturated pyrroles, relative to heme c (CcNiR) are often invoked to explain these reactivities. A series of iron porphyrinoids, designed to model the electron-withdrawing peripheral substitution as well as the saturation present in heme d1 in Cd1NiR, and their NO adducts were synthesized and their properties were investigated. The data clearly show that the presence of electron-withdrawing groups (EWGs) and saturated pyrroles together in a synthetic porphyrinoid (FeDEsC) weakens the Fe-NO bond in {FeNO}7 adducts along with decreasing the bond dissociation free energies (BDFENH) of the {FeHNO}8 species. The EWG raises the E° of the {FeNO}7/8 process, making the electron transfer (ET) facile, but decreases the pKa of {FeNO}8 species, making protonation (PT) difficult, while saturation has the opposite effect. The weakening of the Fe-NO bonding biases the {FeNO}7 species of FeDEsC for NO dissociation, as in Cd1NiR, which is otherwise set-up for a proton-coupled electron transfer (PCET) to form an {FeHNO}8 species eventually leading to its further reduction to NH4+.
- Amanullah, Sk,Dey, Abhishek
-
p. 5909 - 5921
(2020/07/13)
-
- Kinetic studies on the reaction of NO with iron(ii) complexes using low temperature stopped-flow techniques
-
Low temperature stopped-flow techniques were used to investigate the reaction of three different iron(ii) complexes with nitrogen monoxide. The kinetic studies allowed calculation of the activation parameters from the corresponding Eyring plots for all three systems. The reaction of iron(ii) chloride with NO leading to the formation of MNIC (mononitrosyl-iron-complex) and DNIC (dinitrosyl-iron-complex) led to activation parameters of ΔH? = 55.4 ± 0.4 kJ mol-1 and ΔS? = 13 ± 2 J K-1 mol-1 for MNIC and ΔH? = 32 ± 6 kJ mol-1 and ΔS? =-193 ± 21 J K-1 mol-1 for DNIC. Formation of MNIC turned out to be much faster in comparison with DNIC. In contrast, activation parameters for the formation of monoculear [Fe(bztpen)(NO)](OTf)2 (bztpen = N-benzyl-N,N′,N′-tris(2-pyridylmethyl)-ethylenediamine) ΔH? = 17.8 ± 0.8 kJ mol-1 and ΔS? =-181 ± 3 J K-1 mol-1 supported an associative mechanism. Interestingly, [Fe(bztpen)(CH3CN)](OTf)2 does not react with dioxygen at all. Furthermore, activation parameters of ΔH? = 37.7 ± 0.7 kJ mol-1 and ΔS? =-66 ± 3 J K-1 mol-1 were obtained for the reaction of NO with the dinuclear iron(ii) H-HPTB complex (H-HPTB = N,N,N′,N′-tetrakis(2-benzimidazolylmethyl)-2-hydroxy-1,3-diaminopropane), [Fe2(H-HPTB)(Cl)3]. The kinetic data allowed postulation of the mechanisms for all of these reactions.
- Klüfers, Peter,O?berger, Martin,Schindler, Siegfried,Specht, Pascal
-
p. 9480 - 9486
(2020/09/09)
-
- Various Anderson-type polyoxometalate-based metal-organic complexes induced by diverse solvents: Assembly, structures and selective adsorption for organic dyes
-
Six new Anderson-type polyoxometalate (POM)-based metal-organic complexes (MOCs), namely, {HCu(HPCAP)2[CrMo6(OH)6O18]}·2H2O (1), {Zn4(PCAP)2[CrMo6(OH)6O18]2(H2O)12}·4H2O (2), {Zn3(PCAP)2[CrMo6(OH)5O19](H2O)6}·6H2O (3), {Ni3(PCAP)2[NiMo6(OH)5O19](H2O)6}·8H2O (4), {Cu3(PCAP)2[AlMo6(OH)5O19](H2O)6}·6H2O (5), and {Co3(HPCAP)2[AlMo6(OH)6O18](H2O)10}[AlMo6(OH)6O18]·6H2O (6) (HPCAP = 3-(2-pyridinecarboxylic acid amido)pyridine), were constructed from diverse metal ions (CuII/ZnII/NiII/CoII), the HPCAP ligand and various Anderson-type POM anions under hydrothermal and solvothermal conditions and structurally characterized by single-crystal X-ray diffraction, IR spectroscopy, powder X-ray diffraction (PXRD) and thermogravimetric analyses (TGA). Crystal analysis shows that complex 1 has a 3D supramolecular structure based on the CrMo6 anions and the 1D metal-organic ribbon chains [Cu(HPCAP)2] via hydrogen bonds. Complex 2 is a 2D supramolecular layer composed of two kinds of dinuclear metal clusters of [Zn2(CrMo6)2] and [Zn2(PCAP)2]. Complexes 3-5 show similar 3D frameworks. In 3-5, [M1Mo6]3- (M1 = Cr for 3, Ni for 4, and Al for 5) anions are bridged by MII ions (M = Zn for 3, Ni for 4, and Cu for 5) to give a 1D M-M1Mo6 inorganic chain; the adjacent 1D inorganic chains are connected through two directions of [M2(PACP)2] rings to form a 3D framework. It should be noted that in complex 4, the NiMo6 anions are in situ generated from the NiII ion and Mo7O246- anions, which is rarely observed in POM-based MOCs. Complex 6 shows a 1D ladder-like supramolecular double chain, which is composed of 1D Co-AlMo6 inorganic chains, [Co2(HPCAP)2] dual-core rings and discrete AlMo6 polyanions interlinked by hydrogen bonding interactions. These structural diversities show that solvents play key roles in the construction of various architectures. All of the title complexes have excellent adsorption activities for the cationic dyes methylene blue (MB) and gentian violet (GV); in particular, complex 5 is capable of selectively adsorbing MB and GV from the mixtures of MB and MO and GV and MO, respectively. In addition, the electrochemical properties of complexes 1, 4, and 5 are also studied.
- Li, Jia-Hui,Wang, Xiu-Li,Song, Ge,Lin, Hong-Yan,Wang, Xiang,Liu, Guo-Cheng
-
supporting information
p. 1265 - 1275
(2020/02/13)
-
- Selective catalytic oxidation of ammonia over LaMAl11O19-: δ (M = Fe, Cu, Co, and Mn) hexaaluminates catalysts at high temperatures in the Claus process
-
A method for the selective catalytic oxidation of ammonia at high temperature was innovatively proposed to substitute the traditional combustion method to remove the ammonia impurity in the Claus process. In the present work, transition metal (Fe, Cu Co, and Mn)-substituted La-hexaaluminate catalysts were synthesized and investigated for the selective catalytic oxidation of ammonia (NH3-SCO) at high temperature. It was observed that Cu-substituted catalysts could achieve the highest N2 yield at around 520 °C. It was confirmed that the conversion of NH3 was closely related to the reducibility of the prepared catalyst. In particular, it was observed that the molecular O2 could not be dissociatively adsorbed on the prepared catalyst surface. However, both lattice oxygen and gas-phase O2 could participate in NH3-SCO, with gas-phase O2 being the most favorable under the experimental conditions. It was evidenced that the NH3-SCO reaction over the prepared catalysts followed the i-SCR mechanism. Moreover, monodentate nitrates were the main reactive intermediates toward forming N2. Therefore, the development of high-temperature SCO technology and an efficient catalyst are beneficial for the sustainable development of the chemical industry.
- Hao, Zhengping,Jiang, Guoxia,Lin, Caihong,Sun, Yu,Wang, Zhuo,Wei, Zheng,Zhang, Fenglian,Zhang, Xin,Zhang, Yumeng
-
p. 1477 - 1491
(2020/03/23)
-
- Ce regulated surface properties of Mn/SAPO-34 for improved NH3-SCR at low temperature
-
Ce modified MnOx/SAPO-34 was prepared and investigated for low-temperature selective catalytic reduction of NOx with ammonia (NH3-SCR). The 0.3Ce-Mn/SAPO-34 catalyst had nearly 95% NO conversion at 200-350 °C at a space velocity of 10000 h-1. Microporous SAPO-34 as the support provided the catalyst with increased hydrothermal stability. XPS and H2-TPR results proved that the Mn4+ and Oα content increased after incorporation of Ce, this promoted the conversion of NO at low temperature via a 'fast SCR' route. NH3-TPD measurements combined oxidation experiments of NO, NH3 indicated the reduction of both the surface acidity and the amount of acid sites, which effectively decreased the NH3 oxditaion to NO or N2O at elevated temperature and promoted the catalytic selectivity for nitrogen. A redox cycle between manganese oxide and Ce was assumed for the active oxygen transfer and facilitated the catalyst durability.
- Chen, Qizhi,Du, Jun,Liu, Zuohua,Luo, Hang,Tao, Changyuan,Tong, Zhangfa,Yang, Yong
-
p. 40047 - 40054
(2020/11/18)
-
- Zinc Oxide Particles Catalytically Generate Nitric Oxide from Endogenous and Exogenous Prodrugs
-
Nitric oxide (NO) is a potent biological molecule that contributes to a wide spectrum of physiological processes. However, the full potential of NO as a therapeutic agent is significantly complicated by its short half-life and limited diffusion distance in human tissues. Current strategies for NO delivery focus on encapsulation of NO donors into prefabricated scaffolds or an enzyme-prodrug therapy approach. The former is limited by the finite pool of NO donors available, while the latter is challenged by the inherent low stability of natural enzymes. Zinc oxide (ZnO) particles with innate glutathione peroxidase and glycosidase activities, a combination that allows to catalytically decompose both endogenous (S-nitrosoglutathione) and exogenous (β-gal-NONOate) donors to generate NO at physiological conditions are reported. By tuning the concentration of ZnO particles and NO prodrugs, physiologically relevant NO levels are achieved. ZnO preserves its catalytic property for at least 6 months and the activity of ZnO in generating NO from prodrugs in human serum is demonstrated. The ZnO catalytic activity will be beneficial toward generating stable NO release for long-term biomedical applications.
- Yang, Tao,Fruergaard, Anne Sofie,Winther, Anna K.,Zelikin, Alexander N.,Chandrawati, Rona
-
-
- Kinetic regularities of NO donation by binuclear dinitrosyl iron complexes with thiolate ligands based on thiophenol derivatives in the presence of red blood cells
-
The kinetics of nitrogen oxide release by binuclear dinitrosyl iron complexes (B-DNICs) with thiolate ligands based on thiophenol and its several oxy, amino, and nitro derivatives was studied using a suspension of red blood cells simulating the internal medium of a blood vessel. The NO donating ability of the complexes was estimated by the kinetic parameters of first-order equation, which described the formation of intra-erythrocytic methemoglobin. Three typical kinetic profiles of NO donation were distinguished: pseudosaturation donation and donation with prolonged and explosive profiles. In the case of first-type NO donation typical of complexes with thiophenol and its nitro derivatives, the curves display a fast coming to saturation long before the complete release of all NO groups contained in the structure of the starting complex into a solution. Such a type of donation is likely due to the formation of long-lived nitrosyl intermediates in the system. The prolonged type of NO donation shown by the complex with hydroxyphenyl ligand is characterized by virtually constant rate of NO release into a solution without pronounced transition to saturation during experiment (10–12 min). In the case of explosive-type donation characteristic of the complex with aminophenyl ligands, a considerable portion of NO was fast released into a solution within 1–3 min. All complexes under study caused hemolysis of a 0.2% suspension of red blood cells. The complex with aminophenyl ligands exhibited the highest hemolytic activity.
- Kondrat’eva, T. A.,Kozub, G. I.,Neshev, N. I.,Sanina, N. A.,Sokolova, E. M.
-
p. 1987 - 1993
(2020/11/07)
-
- Spotlight on Large Surface Copper Cluster Role of Cu-SAPO-34 Catalyst in Standard NH3-SCR Performances
-
In the present study, the catalytic role and behavior of different copper cluster configurations during NH3 SCR, NO and NH3 oxidation reactions will be studied in detail. For this purpose, two preparation methods were performed. The physico-chemical and surface properties were characterized by different techniques, such as XRD, ICP, N2 ads/des, HR-TEM, XPS, NMR, ex-situ/in-situ DRIFT, NH3 TPD and H2 TPR, in order to evaluate the impact of copper incorporation method on redox active sites, and, as a consequence, to better understand the mechanism of the NH3 SCR reaction.
- Gaillard, Fran?ois,Gil, Sonia,Giroir-Fendler, Anne,Pétaud, Guillaume,Tayakout, Melaz
-
-
- Calcium Dialkylamine Diazeniumdiolates: Synthesis, Stability, and Nitric Oxide Generation
-
The therapeutic application of nitric oxide, an endogenous cellular signaling molecule, has been limited due to the difficulty of developing stable pro-drugs with slow kinetics of NO release. Diazeniumdiolates are valuable NO donors; however, synthetic challenges have hampered their use. O2-alkylation or arylation of diazeniumdiolates form stable pro-drugs which have found application in hypertension, cancer, and as antimicrobial agents. The synthesis of sodium diazeniumdiolates has proven to be challenging due to hazardous reaction conditions (high N2O concentrations, and flammable solvents), which can lead to detonation and suffered from limited scope. We have previously disclosed that synthesis of calcium diazeniumdiolate salts are a safer and more scalable alternative. Herein, we report the expanded scope of calcium diazeniumdiolates from benzylic amines, amides, and sterically bulky amines hitherto inaccessible and a comparison of their reactivity in comparison to sodium diazeniumdiolate.
- Ali, Amjad,Kauser, Nabeelah I.,Lo, Michael Man-Chu,Weisel, Mark,Zhong, Yong-Li
-
p. 4807 - 4812
(2020/05/01)
-
- Three-dimensional nickel foam templated MgCo2O4 nanowires as an efficient catalyst for the thermal decomposition of ammonium perchlorate
-
Spinel–type oxides MgCo2O4 and Co3O4 nanowires (NWs) were successfully prepared using nickel foam (NF) as a template. The catalytic performance of MgCo2O4 NWs on the thermal decomposition of ammonium perchlorate (AP) was investigated by differential scanning calorimetry (DSC) and simultaneous thermogravimetry–mass spectrometry (TG/MS) techniques. In the presence of MgCo2O4 NWs, the process of the high temperature decomposition (HTD) and the low temperature decomposition (LTD) of AP was combined to one with a peak temperature of 277.35 ?°C. Meanwhile, the apparent activation energy decreased from 139.05 to 123.61 ?kJ·mol?1 on the basis of thermal analysis kinetics. This was attributed to the synergistic effect between the metals of this ternary metal oxide and the larger specific surface area of MgCo2O4 NWs. Therefore, MgCo2O4 with nanowires morphology holds a promise to catalyze energetic components.
- Guo, Zhaoqi,Li, Cuicui,Li, Jiachen,Li, Yaoyao,Ma, Haixia,Zhang, Ting
-
-
- Lewis Acid Coordination Redirects S-Nitrosothiol Signaling Output
-
S-Nitrosothiols (RSNOs) serve as air-stable reservoirs for nitric oxide in biology. While copper enzymes promote NO release from RSNOs by serving as Lewis acids for intramolecular electron-transfer, redox-innocent Lewis acids separate these two functions
- Bakhoda, Abolghasem,Bertke, Jeffery A.,Hosseininasab, Valiallah,McQuilken, Alison C.,Timerghazin, Qadir K.,Warren, Timothy H.
-
supporting information
p. 10854 - 10858
(2020/04/27)
-
- Photoactive NO hybrids with pseudo-zero-order release kinetics for antimicrobial applications
-
Bacterial infection is a major threat to the health and life of humans due to the development of drug resistance, which is related to biofilm formation. Nitric oxide (NO) has emerged as an important factor in regulating biofilm formation. In order to harness the potential benefits of NO and develop effective antibacterial agents, we designed and synthesized a new class of NO hybrids in which the active scaffold benzothienoazepine was tagged with a nitroso group and further conjugated with quaternary ammoniums or phosphoniums. The temporal release of NO from these hybrids can be achieved by photoactivation. Interestingly, the NO release follows a pseudo-zero-order kinetics, which is easily determined by measuring the fluorescent benzothienoazepine or NO. Compared to the positive control ciprofloxacin, the NO hybrid with triphenyl phosphonium (TPP) exhibited more effective activity against S. aureus biofilm in darkness. Irradiation of the NO hybrid led to higher inhibition against S. aureus biofilm compared to the parental NO hybrid in darkness or the corresponding NO-released product, indicating the combined effect of NO and the NO-released product. Therefore, this new class of NO hybrids includes very promising antimicrobial agents and this work provides a new way for the design of highly effective antimicrobial agents. This journal is
- Guo, Yuda,Han, Guifang,Hou, Jingli,Liao, Yongfang,Liu, Yangping,Qian, Meng,Song, Yuguang,Wang, Xing,Ye, Zizhen
-
p. 5473 - 5480
(2020/08/03)
-
- One-pot synthesis of Cu/SAPO-34 with hierarchical pore using cupric citrate as a copper source for excellent NH3-SCR of NO performance
-
It is still a serious challenge to develop a simple synthesized method of SAPO-34 sieve modified by Cu with high NH3-SCR performance. The Cu/SAPO-34 samples with hierarchical structure were synthesized for the first time using cupric citrate as copper source by one-pot hydrothermal method which showed excellent NH3-SCR performance for NO removal. Among them, the 0.15Cu/SAPO-34 catalyst with a Cu/Al ratio of 0.15 exhibited the widest temperature operating window (160–500 °C) and better hydrothermal stability. The physicochemical properties of 0.15Cu/SAPO-34 was measured to understand the impacts of the Cu species on the NH3-SCR of NO activity by various characterization methods including XRD, NH3-TPD, N2 adsorption-desorption, XPS, EPR, UV-vis, NH3-oxidation, NMR and in situ DRIFTS. The results reveal that the good activity is assigned to the isolated Cu species located at the site (I) in SAPO-34, and the co-existence of surface Cu2+ and Cu+ species with almost equal amounts. In addition, 0.15Cu/SAPO-34 also possesses suitable acidic sites which are conducive to catalytic activity. The results of in situ DRIFTS suggest that the NH3-SCR reaction follows Eley-Rideal mechanism over 0.15Cu/SAPO-34.
- Wang, Peiqiang,Li, Zhibin,Wang, Xiaotong,Tong, Yongming,Yuan, Fulong,Zhu, Yujun
-
p. 4871 - 4878
(2020/09/07)
-
- Near-IR light-induced photorelease of nitric oxide (NO) on ruthenium nitrosyl complexes: Formation, reactivity, and biological effects
-
Polypyridyl backbone nitrosyl complexes of ruthenium with the molecular framework [RuII(antpy)(bpy)NO+/]n+ [4](PF6)3 (n = 3), [4](PF6)2 (n = 2), where antpy = 4′-(anthracene-9-yl)-2,2′:6′,2′′-terpyridine and bpy = 2,2′-bipyridine, were synthesized via a stepwise synthetic route from the chloro precursor [RuII(antpy)(bpy)(Cl)](PF6) [1](PF6) and [RuII(antpy)(bpy)(CH3CN)](PF6)2 [2](PF6)2 and [RuII(antpy)(bpy)(NO2)](PF6) [3](PF6). After column chromatographic purification, all the synthesized complexes were fully characterized using different spectroscopic and analytical techniques including mass spectroscopy, 1H NMR, FT-IR and UV-vis spectrophotometry. The Ru-NO stretching frequency of [4](PF6)3 was observed at 1941 cm-1, which suggests moderately strong Ru-NO bonding. A massive shift in the νNO frequency occurred at Δν = 329 cm-1 (solid) upon reducing [4](PF6)3 to [4](PF6)2. To understand the molecular integrity of the complexes, the structure of [3](PF6) was successfully determined by X-ray crystallography. The redox properties of [4](PF6)3 were thoroughly investigated together with the other precursor complexes. The rate constants for the first-order photo-release of NO from [4](PF6)3 and [4](PF6)2 were determined to be 8.01 × 10-3 min-1 (t1/2 ～ 86 min) and 3.27 × 10-2 min-1 (t1/2 ～ 21 min), respectively, when exposed to a 200 W Xenon light. Additionally, the photo-cleavage of Ru-NO occurred within ～2 h when [4](PF6)3 was irradiated with an IR light source (>700 nm) at room temperature. The first-order rate constant of 9.4 × 10-3 min-1 (t1/2 ～ 73 min) shows the efficacy of the system and its capability to release NO in the photo-therapeutic window. The released NO triggered by light was trapped by reduced myoglobin, a biologically relevant target protein. The one-electron reduction of [4](PF6)3 to [4](PF6)2 was systematically carried out chemically (hydrazine hydrate), electrochemically and biologically. In the biological reduction, it was found that the reduction is much slower with double-stranded DNA compared to a single-stranded oligonucleotide (CAAGGCCAACCGCGAGAAGATGAC). Moreover, [4](PF6)3 exhibited significant photo-toxicity to the VCaP prostate cancer cell line upon irradiation with a visible light source (IC50 ～ 8.97 μM). This journal is
- Giri, Bishnubasu,Kumbhakar, Sadananda,Maji, Somnath,Misra, Ashish,Muley, Arabinda,Saini, Taruna,Selvan K, Kalai
-
p. 10772 - 10785
(2020/09/02)
-
- Complete denitrification of nitrate and nitrite to N2gas by samarium(ii) iodide
-
The reduction of nitrogen oxides (NxOyn?) to dinitrogen gas by samarium(ii) iodide is reported. The polyoxoanions nitrate (NO3?) and nitrite (NO2?), as well as nitrous oxide (Ns
- Marks, Walker R.,Baumgardner, Douglas F.,Reinheimer, Eric W.,Gilbertson, John D.
-
supporting information
p. 11441 - 11444
(2020/10/12)
-
- A nitrogen fixation strategy to synthesize NO: Via the thermally assisted photocatalytic conversion of air
-
Developing a novel strategy for energy-efficient and clean synthesis of NO from distributed sources is highly desirable. Herein, we present a facile and green method to synthesize NO through the thermal-Assisted photocatalytic oxidation of N2 using simulated air as the reactant in a flow reactor. The TiO2/WO3 heterostructured nanorods were constructed and exhibited good activity for NO photosynthesis assisted by heating in the range of 200-350 °C. The yield rate of NO reached 0.16 mmol g-1 h-1 at 300 °C with a quantum efficiency of 0.31% at 365 nm. 15N isotope labeling experiments proved the origin of NO from N2 oxidation. Experimental and theoretical results revealed that the lattice oxygen in the heterostructures participated in the photooxidation reaction of N2, and the electron transfer from WO3 to TiO2 at the interface of the heterojunction under illumination could facilitate the adsorption of N2 and the formation of NO? intermediates and thus enhanced the photocatalytic N2 oxidation performance. Importantly, the solar-driven oxidation generated NO can be directly used for the synthesis of fine chemicals including nitric acid and β-nitrostyrolene. Our work opens a new avenue for nitrogen fixation via solar-driven N2 oxidation from distributed sources of air. This journal is
- Huang, Yanmei,Liu, Cuibo,Lu, Siyu,Wang, Changhong,Yu, Yifu,Yu, Yu,Zhang, Bin
-
p. 19623 - 19630
(2020/10/13)
-
- Development of a red-light-controllable nitric oxide releaser to control smooth muscle relaxation in vivo
-
We designed and synthesized a novel Si-rhodamine derivative, NORD-1, as a red-light-controllable nitric oxide (NO) releaser, on the basis of photoredox parameter analysis. Red-light-responsive NO release from NORD-1 was confirmed by ESR spin trapping and quantified with an NO electrode and by means of Griess assay. The NO release cross section (ε656 nm·ΦNO) of NORD-1 was calculated to be 3.65 × 102, which is larger than that of a previously reported yellowish-green-light-controllable NO releaser, NO-Rosa5. The photoresponsiveness of NO release from NORD-1 was precise and efficient enough to induce vasodilation ex vivo under Magnus test conditions. Finally, we showed that intracavernous pressure (ICP) could be controlled in rats in vivo with the combination of NORD-1 and a red-light source without increasing systemic blood pressure, which is a serious side effect of usual NO releasers, such as nitroglycerin and isopentyl nitrite. NORD-1 is expected to be a useful chemical tool for NO research, as well as a candidate agent to control the circulatory system.
- Ieda, Naoya,Hotta, Yuji,Yamauchi, Ayaka,Nishikawa, Atsushi,Sasamori, Takahiro,Saitoh, Daisuke,Kawaguchi, Mitsuyasu,Kimura, Kazunori,Nakagawa, Hidehiko
-
p. 2958 - 2965
(2020/11/30)
-
- General Strategy for Integrated Bioorthogonal Prodrugs: Pt(II)-Triggered Depropargylation Enables Controllable Drug Activation in Vivo
-
Bioorthogonal decaging reactions for controllable drug activation within complex biological systems are highly desirable yet extremely challenging. Herein, we find a new class of Pt(II)-triggered bioorthogonal cleavage reactions in which Pt(II) but not Pt(IV) complexes effectively trigger the cleavage of O/N-propargyl in a variety of ranges of caged molecules under biocompatible conditions. Based on these findings, we propose a general strategy for integrated bioorthogonal prodrugs and accordingly design a prodrug 16, in which a Pt(IV) moiety is covalently connected with an O2-propargyl diazeniumdiolate moiety. It is found that 16 can be specifically reduced by cytoplasmic reductants in human ovarian cancer cells to liberate cisplatin, which subsequently stimulates the cleavage of O2-propargyl to release large amounts of NO in situ, thus generating synergistic and potent tumor suppression activity in vivo. Therefore, Pt(II)-triggered depropargylation and the integration concept might provide a general strategy for broad applicability of bioorthogonal cleavage chemistry in vivo.
- Sun, Tao,Lv, Tian,Wu, Jianbing,Zhu, Mingchao,Fei, Yue,Zhu, Jie,Zhang, Yihua,Huang, Zhangjian
-
p. 13899 - 13912
(2020/12/02)
-
- A series of guanidine salts of 3,6-bis-nitroguanyl-1,2,4,5-tetrazine: Green nitrogen-rich gasgenerating agent
-
Nitrogen-rich energetic materials (EMs) have been widely studied because of their high thermal stability, insensitivity, excellent detonation performance and non-toxic characteristics. In particular, these compounds are well applied as gas-generating agents (GGAs). As a nitrogen-rich heterocyclic framework, 1,2,4,5-tetrazine derivatives have shown great potential in the design of GGAs. The guanidine salts of 3,6-bis-nitroguanyl-1,2,4,5-tetrazine (DNGTz), guanidine (G2DNGTz) (1), aminoguanidine (AG2DNGTz) (2), diaminoguanidine (DAG2DNGTz) (3), and triaminoguanidine (TAG2DNGTz) (4) have been synthesized and characterized by elemental analysis and FT-IR. The crystal structures of 1 and 2 were obtained by X-ray single crystal diffraction. Crystal analysis shows that 1 and 2 arrange through zigzagchain- like assembly and face-to-face geometries, which is helpful in decreasing mechanical sensitivity. The thermal stability and thermal decomposition kinetics of these four salts were studied by Differential Scanning Calorimetry (DSC). Furthermore, the thermogravimetry-Fourier transform infrared-mass spectrometry (TG-FTIR-MS) analysis of thermal decomposition products reveals that the main decomposition gaseous products are H2O, N2O, CO2, NO, N2and NH3. Then, the cytotoxicity of the four salts was tested by MTT (3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide) method, and it was found that salts 1 4 show slight cytotoxicity in mouse fibroblasts (L929), at a concentration of 0.125 mg ml-1. The insensitivity, low toxicity, and production of clean gases without solid residue after burning of salt 1 indicate that it can be used as a potential green energetic material for GGAs.
- Cong, Zhang,Daidi, Fan,Haixia, Ma,Xiang, Chen,Yang, Bai,Yongpeng, Hu,Zhaoqi, Guo
-
-
- Thermogravimetric Analysis and Mass Spectrometry Allow for Determination of Chemisorbed Reaction Products on Metal Organic Frameworks
-
Thermogravimetric analysis (TGA) is a technique which can probe chemisorption of substrates onto metal organic frameworks. A TGA method was developed to examine the catalytic oxidation of S-nitrosoglutathione (GSNO) by the MOF H3[(Cu4Cl)3(BTTri)8] (abbr. Cu-BTTri; H3BTTri = 1,3,5-tris(1H-1,2,3-triazol-5-yl)benzene), yielding glutathione disulfide (GSSG) and nitric oxide (NO). Thermal analysis of reduced glutathione (GSH), GSSG, GSNO, and Cu-BTTri revealed thermal resolution of all four analytes through different thermal onset temperatures and weight percent changes. Two reaction systems were probed: an aerobic column flow reaction and an anaerobic solution batch reaction with gas agitation. In both systems, Cu-BTTri was reacted with a 1 mM GSH, GSSG, or GSNO solution, copiously rinsed with distilled-deionized water (dd-H2O), dried (25 °C, 1 Torr), and assessed by TGA. Additionally, stock, effluent or supernatant, and rinse solutions for each glutathione derivative within each reaction system were assessed by mass spectrometry (MS) to inform on chemical transformations promoted by Cu-BTTri as well as relative analyte concentrations. Both reaction systems exhibited chemisorption of glutathione derivatives to the MOF by TGA. Mass spectrometry analyses revealed that in both systems, GSH was oxidized to GSSG, which chemisorbed to the MOF whereas GSSG remained unchanged during chemisorption. For GSNO, chemisorption to the MOF without reaction was observed in the aerobic column setup, whereas conversion to GSSG and subsequent chemisorption was observed in the anaerobic batch setup. These findings suggest that within this reaction system, GSSG is the primary adsorbent of concern with regards to strong binding to Cu-BTTri. Development of similar thermal methods could allow for the probing of MOF reactivity for a wide range of systems, informing on important considerations such as reduced catalytic efficiency from poisoning, recyclability, and loading capacities of contaminants or toxins with MOFs.
- Jones, W. Matthew,Reynolds, Melissa M.,Tapia, Jesus B.,Tuttle, Robert R.
-
p. 3903 - 3911
(2020/05/04)
-
- Coordinative interaction between nitrogen oxides and iron-molybdenum POM Mo72Fe30
-
The process of adsorption of nitrogen monoxide and dioxide by the giant Keplerate nanocluster Mo72Fe30 was studied in detail under ambient conditions and air/argon atmosphere. The obtained Raman and IR spectra showed that the coordination of NOx to the Mo72Fe30 leads to the formation of nitrate ions by sharing the bridged or terminal oxygen in FeO6 polyhedra with the adsorbed NO2 molecules. In accordance with elemental analysis and X-ray photoelectron spectroscopy, the composition of the produced complex was found to be [POM-(NO2)x]·(NO2)y (where x = 6, y = 14 ± 3). The carried out thermal analysis revealed the significant influence of NOx coordination in the release of water molecules and decomposition of the constitutional acetate ligands for Mo72Fe30. Furthermore, the performed measurements of the temperature dependency of the electron paramagnetic resonance spectra for the pure nanocluster and that treated with NO2 allowed us to draw up a conclusion about the delocalization of weak-bonded NO2 molecules in the pores of the Mo72Fe30 crystal at 25 °C. The opposite situation was observed under cryogenic temperatures. The localization of NO2 molecules occurs resulting in the distortion of FeO6 octahedra towards tetrahedral symmetry accompanied with the appearance of the signal at g-factor 4.3. The produced complex compound [POM-(NO2)x]·(NO2)y possesses sufficient NO2 capacity, water solubility and pH-dependant decomposition; these are important properties of a potential NOx donor, which can be hypothetically applied in biomedicine.
- Grzhegorzhevskii, Kirill V.,Tonkushina, Margarita O.,Fokin, Andrei V.,Belova, Ksenia G.,Ostroushko, Alexander A.
-
p. 6984 - 6996
(2019/05/27)
-
- Synthesis, properties, and antibacterial activity of a new nitric oxide donor — a nitrosyl iron complex with 5-phenyl-1H-1,2,4-triazole-3-thiol
-
A new binuclear μ-NSC-type nitrosyl iron complex [Fe2(SR)2(NO)4] (R is 5-phenyl-1H-1,2,4-triazole-3-thiolyl) was synthesized. The composition and structure of the newly synthesized complex were determined by atomic absorption, IR, EPR, and M?ssbauer spectroscopy and SQUID magnetometry. Amperometric analysis showed that the new complex is an effective nitric oxide (NO) donor in a 1% aqueous DMSO solution. The amounts of NO generated by the complex [Fe2(SR)2(NO)4] in aqueous solutions at physiological pH values were determined. The new complex was shown to have higher antibacterial activity against the gram-positive bacteria Micrococcus luteus compared to kanamycin and streptomycin. According to assays, sulfur-containing ligands of the 1,2,4-triazole-3-thiol series are promising for the design of new antibacterial agents containing the {Fe(NO)2} structural moiety.
- Sanina,Mumyatova,Terent′ev,Morgunov,Ovanesyan,Kulikov
-
p. 2225 - 2231
(2020/02/15)
-
- Hydroxylamine Oxidation on Polycrystalline Gold Electrodes in Aqueous Electrolytes: Quantitative On-Line Mass Spectrometry under Forced Convection
-
Herein, a method is presented that allows quantitative determination of faradaic efficiencies for dinitrogen (N2) generation during the electrochemical oxidation of hydroxylamine (NH2OH), (Formula presented.), on a polycrystalline gold Au(poly) disk electrode in aqueous electrolytes over a wide pH range. This tactic involves the use of an impinging jet electrolyte configuration incorporating a gas porous ring connected in turn to a mass spectrometer. The actual amount of N2 generated at the Au(poly) disk was assayed using the oxidation of hydrazine (N2H4) in aqueous phosphate buffer (pH 7). This redox process yields N2 as the only product, allowing a direct correlation to be established between the changes in the partial pressures of N2 and the current flowing through the disk electrode. An analysis of the data collected revealed a strong dependence of (Formula presented.) both on pH and the applied potential. Although values of (Formula presented.) as high as 20 to 30 % were found in acid and neutral media over a narrow potential region, those in alkaline solution were far smaller in the entire potential range examined.
- Pozniak, Boguslaw,Treufeld, Imre,Scherson, Daniel
-
p. 3128 - 3133
(2019/11/03)
-
- Antioxidative Pseudoenzymatic Mechanism of NAD(P)H Coexisting with Oxyhemoglobin for Suppressed Methemoglobin Formation
-
Oxyhemoglobin (HbO2) coexisting with equimolar NADH retards autoxidation and oxidant-induced metHb formation based on the pseudocatalase (CAT) and pseudosuperoxide dismutase (SOD) activities. In this work, we compared the effects of NADH with those of NADPH and estimated the binding site of NAD(P)H to HbO2 to elucidate the antioxidative mechanisms. The results clarified that pseudo-CAT and pseudo-SOD activities of HbO2 coexisting with NADPH were similar to activities obtained with NADH. Prompt MetHb formation (2O2, NO, and NaNO2) was hindered by NADPH. These effects were similar to those of NADH. However, we found that NADPH is thermally unstable compared to NADH and that NADPH cannot sustain antioxidative effects for a long period of autoxidation to metHb such as 24 h. Lineweaver-Burk plots clarified that the Michaelis constants of these pseudoenzymatic activities are in the millimolar range. Addition of inositol hexaphosphate (IHP) and 2,3-diphosphoglycerate (DPG), which are known to bind not only with deoxyHb but also weakly with HbO2, showed competitive inhibition of pseudoenzymatic activities. These results suggest that the binding site of NADH and NADPH on HbO2 is the same as those of IHP and DPG. 31P nuclear magnetic resonance definitively showed 1:1 stoichiometric binding of NADH to HbO2. High-performance liquid chromatography analysis showed that NADH preferentially inhibited autoxidation of α-subunit heme. Docking simulations also predicted that the binding site of relaxed-state HbO2 with NAD(P)H is the same as those with IHP and DPG. Collectively, the pseudoenzymatic activities of HbO2 coexisting with NAD(P)H are induced by the 1:1 stoichiometric binding of NAD(P)H to HbO2.
- Yamada, Magohei,Matsuhira, Takashi,Yamamoto, Keizo,Sakai, Hiromi
-
p. 1400 - 1410
(2019/04/03)
-
- Probing the Reaction Mechanisms Involved in the Decomposition of Solid 1,3,5-Trinitro-1,3,5-triazinane by Energetic Electrons
-
The decomposition mechanisms of 1,3,5-trinitro-1,3,5-triazinane (RDX) have been explored over the past decades, but as of now, a complete picture on these pathways has not yet emerged, as evident from the discrepancies in proposed reaction mechanisms and the critical lack of products and intermediates observed experimentally. This study exploited a surface science machine to investigate the decomposition of solid-phase RDX by energetic electrons at a temperature of 5 K. The products formed during irradiation were monitored online and in situ via infrared and UV-vis spectroscopy, and products subliming in the temperature programmed desorption phase were probed with a reflectron time-of-flight mass spectrometer coupled with soft photoionization at 10.49 eV (ReTOF-MS-PI). Infrared spectroscopy revealed the formation of water (H2O), carbon dioxide (CO2), dinitrogen oxide (N2O), nitrogen monoxide (NO), formaldehyde (H2CO), nitrous acid (HONO), and nitrogen dioxide (NO2). ReTOF-MS-PI identified 38 cyclic and acyclic products arranged into, for example, dinitro, mononitro, mononitroso, nitro-nitroso, and amines species. Among these molecules, 21 products such as N-methylnitrous amide (CH4N2O), 1,3,5-triazinane (C3H9N3), and N-(aminomethyl)methanediamine (C2H9N3) were detected for the first time in laboratory experiments; mechanisms based on the gas phase and condensed phase calculations were exploited to rationalize the formation of the observed products. The present studies reveal a rich, unprecedented chemistry in the condensed phase decomposition of RDX, which is significantly more complex than the unimolecular gas phase decomposition of RDX, thus leading us closer to an understanding of the decomposition chemistry of nitramine-based explosives.
- Singh, Santosh K.,Zhu, Cheng,Vuppuluri, Vasant,Son, Steven F.,Kaiser, Ralf I.
-
p. 9479 - 9497
(2019/11/11)
-
- Nitric oxide (NO) photo-release in a series of ruthenium-nitrosyl complexes: new experimental insights in the search for a comprehensive mechanism
-
A series of four ruthenium(ii) complexes built from the [Ru(terpy)(bipy)(NO)]3+ core (terpy is 2,2′:6′,2′′-terpyridine and bipy is 2,2′-bipyridine) are investigated. They differ by the presence of zero, one, two, or three 4′-(4-methoxyphenyl) (MP) electron donor substituents introduced at different positions on the pyridine fragments to increase the intramolecular charge transfer capabilities towards the strongly withdrawing nitrosyl (NO) ligand. The UV-visible spectra reflect the presence and position of the MP substituents on the complexes. In the case of species containing the 4′-(MP)-terpy ligand, a low-lying transition is identified as arising from 4′-(MP)-terpy to Ru(NO) intramolecular charge transfer, which is further confirmed by TD-DFT analysis. Irradiation performed at λ = 436 nm on this isolated transition for different complexes leads to quantum yields of NO photo-release equal to 0.002 and 0.011, in a ratio of 6 (instead of 1), which allows concluding non-ambiguously that a single electron transition cannot account for the NO release mechanism.
- Roose, Max,Tassé, Marine,Lacroix, Pascal G.,Malfant, Isabelle
-
p. 755 - 767
(2019/01/09)
-
- l-Arginine and nitric oxide synthesis in the cells with inducible NO synthase
-
The effect of citrulline and ammonium chloride on the nitric oxide formation by peritoneal macrophages and liver tissue cells was studied using ESR spectroscopy. In ex vivo models, the incubation of cells capable of expressing inducible NO synthase (iNOS) with interferon-γ resulted in a moderate increase in the amount of hemoglobin–nitric oxide nitrosyl complexes (Heme–NO NCs), whereas incubation with l-citrulline and ammonium chloride increased the amount of Heme–NO NCs by an order of magnitude. It was assumed that a separate cycle of L-arginine and nitric oxide synthesis exists in the peritoneal macrophages and liver cells, with the major participants of the cycle being the inducible NO synthase enzyme (iNOS) and enzymes that synthesize L-arginine from L-citrulline and a nitrogen source. Functioning of this cycle makes immunocompetent cells with iNOS able to produce NO for a long time and in large amounts.
- Kuropteva,Baider,Nagler,Bogatyrenko,Belaia
-
p. 174 - 180
(2019/04/25)
-
- Facile fabrication of porous La doped ZnO granular nanocrystallites and their catalytic evaluation towards thermal decomposition of ammonium perchlorate
-
The present article expresses synthesis, characterization and catalytic activity of pure and La doped ZnO (La-ZnO)towards thermal decomposition of Ammonium Perchlorate (AP). The catalytic materials (La-ZnO)with 0–1.00% of doped La were synthesized by simple co-precipitation method and thoroughly characterized by several spectroscopic techniques like FT-IR, XRD, UV–Visible, PL, SEM-EDS and BET analysis. The XRD pattern of synthesized materials displayed wurtzite ZnO structure. The SEM images of the materials showed granular morphology where gradual increase in particle size and crystallite size was observed to be increased with increase in doped La concentration. The BET surface area of the materials was 28.203 to 15.830 m2/g and exhibited mesoporous nature. In catalytic studies for thermal decomposition of AP, the pure ZnO catalyst offered single stage decomposition of AP along with lowering high-thermal decomposition (HTD)temperature of AP by 105 OC. However, La doped ZnO showed slightly lower activity due to promotion of NO formation in oxidation of ammonia generated on initial decomposition of AP and decrease in BET surface area.
- Jagtap,Kshirsagar,Khire,Pardeshi
-
p. 194 - 204
(2019/05/17)
-
- Copper ion vs copper metal–organic framework catalyzed NO release from bioavailable S-Nitrosoglutathione en route to biomedical applications: Direct 1H NMR monitoring in water allowing identification of the distinct, true reaction stoichiometries and thiol dependencies
-
Copper containing compounds catalyze decomposition of S-Nitrosoglutathione (GSNO) in the presence of glutathione (GSH) yielding glutathione disulfide (GSSG) and nitric oxide (NO). Extended NO generation from an endogenous source is medically desirable to achieve vasodilation, reduction in biofilms on medical devices, and antibacterial activity. Homogeneous and heterogeneous copper species catalyze release of NO from endogenous GSNO. One heterogeneous catalyst used for GSNO decomposition in blood plasma is the metal-organic framework (MOF), H3[(Cu4Cl)3-(BTTri)8, H3BTTri = 1,3,5-tris(1H-1,2,3-triazol-5-yl) benzene] (CuBTTri). Fundamental questions about these systems remain unanswered, despite their use in biomedical applications, in part because no method previously existed for simultaneous tracking of [GSNO], [GSH], and [GSSG] in water. Tracking these reactions in water is a necessary step towards study in biological media (blood is approximately 80% water) where NO release systems must operate. Even the balanced stoichiometry remains unknown for copper-ion and CuBTTri catalyzed GSNO decomposition. Herein, we report a direct 1H NMR method which: simultaneously monitors [GSNO], [GSH], and [GSSG] in water; provides the experimentally determined stoichiometry for copper-ion vs CuBTTri catalyzed GSNO decomposition; reveals that the CuBTTri-catalyzed reaction reaches 10% GSNO decomposition (16 h) without added GSH, yet the copper-ion catalyzed reaction reaches 100% GSNO decomposition (16 h) without added GSH; and shows 100% GSNO decomposition upon addition of stoichiometric GSH to the CuBTTri catalyzed reaction. These observations provide evidence that copper-ion and CuBTTri catalyzed GSNO decomposition in water operate through different reaction mechanisms, the details of which can now be probed by 1H NMR kinetics and other needed studies.
- Tuttle, Robert R.,Rubin, Heather N.,Rithner, Christopher D.,Finke, Richard G.,Reynolds, Melissa M.
-
-
- A fluorescent naphthalenediimide-alkoxyfuroxan photoinduced nitric oxide donor
-
We describe the design and facile synthesis of a fluorescent alkoxyfuroxan naphthalenediimide (NDI) hybrid nitric oxide (NO) donor molecule which releases NO under spatiotemporal control when irradiated with visible light (420600 nm). The hybrid also demonstrates cellular uptake made possible by its fluorescence capability. This research consolidates our recent work into visible light absorbing photosensitised furoxan NO release by addressing the limitations of previous designs. Key points of photoinduced nitric oxide donors are highlighted such as water solubility, NO release, cellular uptake, fluorescence, and longer absorption wavelengths.
- Seymour, Christopher Peter,Nakata, Akito,Tsubaki, Motonari,Hayashi, Masahiko,Matsubara, Ryosuke
-
p. 162 - 169
(2019/01/28)
-
- Reactivity of NO2 with Porous and Conductive Copper Azobispyridine Metallopolymers
-
We report the reactivity of copper azobispyridine (abpy) metallopolymers with nitrogen dioxide (NO2). The porous and conductive [Cu(abpy)]n mixed-valence metallopolymers undergo a redox reaction with NO2, resulting in the disproportionation of NO2 gas. Solid- and gas-phase vibrational spectroscopy and X-ray analysis of the reaction products of the NO2-dosed metallopolymer show evidence of nitrate ions and nitric oxide gas. Exposure to NO2 results in complete loss of porosity and a decrease in the room-temperature conductivity of the metallopolymer by four orders of magnitude with the loss of mixed-valence character. Notably, the porous and conductive [Cu(abpy)]n metallopolymers can be reformed by reducing the Cu-nitrate species.
- Clayman, Naomi E.,Manumpil, Mary Anne,Matson, Benjamin D.,Wang, Shengkai,Slavney, Adam H.,Sarangi, Ritimuka,Karunadasa, Hemamala I.,Waymouth, Robert M.
-
p. 10856 - 10860
(2019/09/09)
-
- Four new dual-functional electro-catalysts formed from small molybdenum clusters and Cu-pyridyl complexes
-
By changing N-heterocyclic ligands in the same Mo7/Cu/N-ligand reaction systems, four new organic-inorganic hybrids based on isopolymolybdates, [Cu2(tpy)2(β-Mo8O26)0.5(γ-Mo8O26)0.5]·0.25H2O (1), [Cu2(tpy)2(H2O)2(β-Mo8O26)] (2), [Cu(bpy)(Mo3O10)]·H2O (3), and [Cu(bpy)(H2O)(β-Mo8O26)0.5]0.5 (4) (tpy = 2,2′:6′,2′′-Terpyridine and bpy = 2,6-bis(pyrazol-1-yl) pyridine), were prepared using hydrothermal methods at different pH values. X-ray structural analysis shows that compound 1 has a 1D {-β-[Mo8O26]-Cu2-γ-[Mo8O26]}n straight chain structure with mixed β-[Mo8O26] and γ-[Mo8O26] polyoxoanions; compound 2 possesses a 3D supramolecular structure based on [Cu(tpy)]2+ motifs and β-[Mo8O26] clusters; and compound 3 has a 1D chain structure built from [Cu(bpy)]2+ and [Mo3O10]2- units. In compound 4, [β-Mo8O26] clusters are linked by [Cu(bpy)]2+ motifs to give rise to a 2D sheet structure including {(β-Mo8O26)4Cu4} 8-membered rings. Cyclic voltammograms of compounds 1-4 display discrepant dual-functional electro-catalytic activities toward the reduction of nitrite and the oxidation of ascorbic acid in acidic solution. Electrocatalytic tests indicate that the [Mo3O10]2--based organic-inorganic hybrid exhibits better electro-catalytic performances than [Mo8O26]4--Type hybrids towards oxidation and reduction.
- Zhou, Wanli,Liu, Ping,Zheng, Yanping,Liu, Xuekun,Zhang, Yong,Yuan, Gang,Peng, Jun
-
supporting information
p. 16350 - 16357
(2019/11/13)
-
