Pharmacological Targeting of Vacuolar H+-ATPase via Subunit V1G Combats Multidrug-Resistant Cancer

Article

Pharmacological Targeting of Vacuolar H⁺-ATPase

via Subunit V1G Combats Multidrug-Resistant

Cancer

Graphical Abstract

Authors

Yuezhou Wang, Lei Zhang,

Yanling Wei, ..., Melissa S. Jurica,

Cyril H. Benes, Xianming Deng

Correspondence

xmdeng@xmu.edu.cn

In Brief

Alternative strategy for treating

multidrug-resistant (MDR) cancer is

needed. Wang et al. show that the natural

product verucopeptin kills MDR cancer

by targeting the ATP6V1G subunit of v-

ATPase, which leads to strong inhibition

of both v-ATPase activity and mTORC1

signaling.

Highlights

d

The natural product verucopeptin exhibits antitumor activity

against MDR cancers

d

Verucopeptin directly targets the v-ATPase ATP6V1G subunit

Verucopeptin kills MDR cancer cells by inhibition of both v-

ATPase and mTORC1

d

Verucopeptin suppresses MDR cancer progression in vivo

Wang et al., 2020, Cell Chemical Biology 27, 1–12

August 20, 2020 ª 2020 Elsevier Ltd.

https://doi.org/10.1016/j.chembiol.2020.06.011

ll

Please cite this article in press as: Wang et al., Pharmacological Targeting of Vacuolar H⁺-ATPase via Subunit V1G Combats Multidrug-Resistant Can-

cer, Cell Chemical Biology (2020), https://doi.org/10.1016/j.chembiol.2020.06.011

ll

Article

Pharmacological Targeting of Vacuolar H⁺-ATPase

via Subunit V1G Combats Multidrug-Resistant Cancer

Yuezhou Wang,^1,2,12Lei Zhang,^1,2,12Yanling Wei,^1,2,12Wei Huang,^1,2,12Li Li,^1,2,12An-an Wu,^3,4Anahita Dastur,⁵

Patricia Greninger,⁵Walter M. Bray,⁶Chen-Song Zhang,^1,2Mengqi Li,^1,2Wenhua Lian,^1,2Zhiyu Hu,^1,2Xiaoyong Wang,⁷

Gang Liu,⁷Luming Yao,^1,2Jih-Hwa Guh,⁸Lanfen Chen,^1,2Hong-Rui Wang,^1,2Dawang Zhou,^1,2Sheng-Cai Lin,^1,2

Qingyan Xu,^1,2Yuemao Shen,⁹Jianming Zhang,¹⁰Melissa S. Jurica,¹¹Cyril H. Benes,⁵and Xianming Deng^1,2,13,

*

¹State Key Laboratory of Cellular Stress Biology, Innovation Center for Cell Signaling Network, School of Life Sciences, Xiamen University,

Xiamen, Fujian 361102, China

²State-province Joint Engineering Laboratory of Targeted Drugs from Natural Products, Xiamen University, Xiamen, Fujian 361102, China

³State Key Laboratory for Physical Chemistry of Solid Surface, College of Chemistry and Chemical Engineering, Xiamen University, Xiamen,

Fujian 361005, China

⁴Fujian Provincial Key Laboratory of Theoretical and Computational Chemistry, Xiamen, Fujian, China

⁵Massachusetts General Hospital Cancer Center, Harvard Medical School, Charlestown, MA 02129, USA

⁶Department of Chemistry and Biochemistry, University of California, Santa Cruz, CA 95064, USA

⁷State Key Laboratory of Molecular Vaccinology and Molecular Diagnostics Center for Molecular Imaging and Translational Medicine, School

of Public Health, Xiamen University, Xiamen 361102, China

⁸School of Pharmacy, National Taiwan University, Taipei, Taiwan

⁹School of Pharmaceutical Sciences, Shandong University, Jinan, Shandong 250012, China

¹⁰National Translational Research Center Ruijin Hospital, Shanghai Jiaotong University School of Medicine, Shanghai 200025 China

¹¹Department of Molecular Cell and Developmental Biology and Center for Molecular Biology of RNA, University of California, Santa Cruz, CA

95064, USA

¹²These authors contributed equally

¹³Lead Contact

*Correspondence: xmdeng@xmu.edu.cn

https://doi.org/10.1016/j.chembiol.2020.06.011

SUMMARY

Multidrug resistance (MDR) in cancer remains a major challenge for the success of chemotherapy. Natural

products have been a rich source for the discovery of drugs against MDR cancers. Here, we applied high-

throughput cytotoxicity screening of an in-house natural product library against MDR SGC7901/VCR cells

and identiﬁed that the cyclodepsipeptide verucopeptin demonstrated notable antitumor potency. Cytolog-

ical proﬁling combined with click chemistry-based proteomics revealed that ATP6V1G directly interacted

with verucopeptin. ATP6V1G, a subunit of the vacuolar H⁺-ATPase (v-ATPase) that has not been previously

targeted, was essential for SGC7901/VCR cell growth. Verucopeptin exhibited strong inhibition of both v-

ATPase activity and mTORC1 signaling, leading to substantial pharmacological efﬁcacy against SGC7901/

VCR cell proliferation and tumor growth in vivo. Our results demonstrate that targeting v-ATPase via its

V1G subunit constitutes a unique approach for modulating v-ATPase and mTORC1 signaling with great po-

tential for the development of therapeutics against MDR cancers.

INTRODUCTION

mechanisms have been reported to be involved in the develop-

ment of MDR to chemotherapy, such as increased drug efﬂux,

Drug resistance causes treatment failure in nearly 90% of pa- decreased drug uptake, and accelerated drug metabolism.

tients with metastatic cancer (Holohan et al., 2013; Longley Overexpression of ATP-binding cassette (ABC) transporters,

and Johnston, 2005; Sharma et al., 2018). Multidrug resistance which pump drugs out of cells through the cell membrane, has

(MDR), which develops when cancer cells become resistant to long been considered a common mechanism of MDR (Rees

multiple antineoplastic drugs with different structures and mech- et al., 2009). Unfortunately, the clinical performance of ABC

anisms during the course of chemotherapeutic treatment, is the transporter-targeted inhibitors seems unsatisfactory (Robey

major barrier for successful therapeutic interventions in cancer et al., 2018). Therefore, alternative strategies and new chemical

(Gillet and Gottesman, 2010; Montazami et al., 2015; Szakacs entities for combating MDR cancers are urgently needed.

et al., 2006). Overcoming MDR has been a high priority for As a result of interaction and evolutionary optimization by their

both clinical oncologists and anticancer drug hunters. Numerous biosynthetic enzymes, natural products have long been

Cell Chemical Biology 27, 1–12, August 20, 2020 ª 2020 Elsevier Ltd.

1

Please cite this article in press as: Wang et al., Pharmacological Targeting of Vacuolar H⁺-ATPase via Subunit V1G Combats Multidrug-Resistant Can-

cer, Cell Chemical Biology (2020), https://doi.org/10.1016/j.chembiol.2020.06.011

ll

Article

considered valuable sources for drug development (Newman RESULTS

and Cragg, 2016; Silver, 2015). Unlike synthetic small molecules,

natural products occupy unique chemical environments by Identiﬁcation of VE as a Promising Agent against MDR

bearing complicated 3D architectures and multiple stereocen- Cancer Cells

ters (Over et al., 2013). A few recent studies have reported appli- In an effort to identify new pharmacological modalities effective

cations of natural products in treating MDR cancers. For against MDR cancer cells, we performed a cellular-based cyto-

example, tetrandrine, a bisbenzylisoquinoline alkaloid identiﬁed toxicity screen using SGC7901/VCR cells, a vincristine-induced

in the Chinese medicinal herb Radix Stephanae tetrandrae, re- MDR gastric cancer cell line. SGC7901/VCR cells show broad

verses MDR in MCF-7/adr cells both in vitro and in xenograft resistance to clinical chemotherapeutic drugs, such as Taxol

models (Kumar and Jaitak, 2019). Rhamnetin, derived from Per- and cisplatin as well as to cytotoxic agents, such as the

sian berries, sensitizes hepatocellular HepG2/ADR cells to sora- HSP90 inhibitor geldanamycin and proteasome inhibitor

fenib via the Notch receptor 1 (Notch1) pathway (Jia et al., 2016). MG132 (Figure 1A). After screening an in-house library of natural

Thus, natural products hold great promise for identifying new products derived from microorganisms, VE (Figure 1B), a com-

mechanisms and chemical entities to combat MDR.

pound isolated from the mangrove rhizosphere bacterium Acti-

The vacuolar H⁺-ATPase (v-ATPase) is an ATP-dependent H⁺nomadura sp. XM-4-3 was identiﬁed to exhibit notable potency

transporter that pumps protons across intracellular and plasma against MDR cells, with a half-maximal inhibitory concentration

membranes through a highly coordinated, multisubunit protein (IC₅₀) value of 1.4 mM (Figure 1A). We then tested another MDR

complex. The ‘‘catalytic hexamer’’ A₃B₃in the V1 sector cata- chronic myelogenous leukemia cell line, K562R. K562R cells

lyzes ATP-driven rotation of the central rotors D and F, which were reported to be induced by doxorubicin and exhibit an

in turn, via the V0d bridge, rotate the c ring that is embedded MDR phenotype with increased expression of ABC transporters

in the lipid bilayer for proton transport (Oot et al., 2017; Roh (Ning et al., 2018). As expected, VE also showed excellent anti-

et al., 2018; Zhao et al., 2015). The three peripheral stalks tumor activity against K562R cells, with an IC₅₀of 388 nM,

(the EG1-3 heterodimer) connect the V0 and V1 sectors via although these cells exhibit resistance to clinical chemothera-

subunits C, H, and a (Arai et al., 2013; Nakanishi et al., 2018). peutic drugs, such as Taxol and vincristine at concentrations

The v-ATPase plays a critical role in pH homeostasis, nutrient of 10 mM (Figure 1C). These data demonstrate the excellent po-

sensing (Zhang et al., 2014, 2016), autophagy (Chung et al., tential activity of VE against multiple MDR cancer cells.

2019), and xenophagy (Xu et al., 2019) in normal cells and, to

VE, which belongs to the family of piperazic acid-containing pyr-

a much greater extent, in tumor cells (Bonam et al., 2019; anylated cyclodepsipeptides (PA-PCDs) (Hale et al., 2010; Oelke

Stransky et al., 2016). Disrupted or impaired lysosomal activity et al., 2011), was isolated for the ﬁrst time in 1993 from Actinomadura

and v-ATPase function activate critical cellular pathways, such verrucosospora Q886-2 and reported to exhibit signiﬁcant thera-

as mechanistic target of rapamycin kinase complex

1

peutic activity with prolongation of the lifespan in mice transplanted

(mTORC1) signaling (Zoncu et al., 2011), thus helping to estab- with B16 melanoma cells (Nishiyama et al., 1993; Sugawara et al.,

lish and maintain the acidic environment for malignant cell pro- 1993). However, the precise mechanism of action of VE remains

gression, remote spread, and chemoresistance (Webb et al., elusive. Substructure searches revealed several previously identi-

2011). Overexpression or activation of the v-ATPase on the ﬁed PA-PCDswithexceptionalantibioticabilities(Figur e S 1). Among

lysosomal surface and tumor cell plasma membrane of tumor these compounds, azinothricin is documented as the most potent

cells can acidify the extracellular environment and lysosomal Gram-positive antibioticeverdiscovered, displayingminimum inhib-

lumen. Many drugs, especially weak bases, are protonated at itory concentration values ranging from 0.001 to 0.016 mg/mL

low pH and thus lose the ability to cross the cellular plasma against 51 different bacterial strains (Maehr et al., 1986). Similarly,

membrane or become trapped in acidic vesicles, a phenome- GE3 exerts a substantial effect on tumor regression in a mouse

non that partially accounts for drug resistance (Simon et al., xenograft model of the currently incurable PSN1 human pancreatic

1994; Stransky et al., 2016; Vukovic and Tannock, 1997). carcinoma (Sakai et al., 1997). Together, the fascinating structure of

Therefore, pharmacological targeting of the v-ATPase may be VE and its impressive bioactivity against MDR cells prompted us to

a promising approach for the development of antitumor thera- investigate its biological application and mechanism of action.

pies, especially therapies for MDR cancers.

Here, we identiﬁed the cyclodepsipeptide verucopeptin (VE) VE Is a Potent Antitumor Agent Both In Vitro and In Vivo

from an in-house natural product library (ꢀ2,000 compounds) To better understand the potential pharmacological efﬁcacy of VE

with nanomolar to low micromolar activity against MDR against human cancers, we proﬁled VE across a large panel of

SGC7901/VCR and K562R cells. Through a combination of im- 1,094 cancer cell lines from the Center for Molecular Therapeutics

age-based cytological proﬁling and chemical proteomics, we (Massachusetts General Hospital Cancer Center, Harvard Medi-

provide what we believe is the ﬁrst evidence that VE is an inhib- cal School) (Table S1) (Garnett et al., 2012). VE showed broad anti-

itor of the peripheral stalk of the v-ATPase. The interaction proliferative activity, with IC₅₀values of less than 100 nM against

between VE and the ATP6V1G subunit leads to substantial inhi- 66% of the cell lines evaluated (Figure 1D). Moreover, VE exhibited

bition of v-ATPase activity and downstream mTORC1 signaling, tissue speciﬁcity; a larger proportion of cell lines of speciﬁc cancer

thereby contributing to its excellent pharmacological efﬁcacy types, such as leukemia, lymphoma, and melanoma, were classi-

against MDR cancer cells in vitro as well as in xenograft models ﬁed in the lower IC₅₀groups, while the higher IC₅₀groups

in vivo. These data demonstrate that VE can be used as a phar- comprised cell lines of other cancer types, such as non-small

macological probe to investigate v-ATPase and mTORC1 cell lung cancer. More importantly, mice treated with VE at a

biology and indicate its therapeutic role in MDR cancers.

low dosage of 1 mg kg^À1twice daily showed signiﬁcant regression

2

Cell Chemical Biology 27, 1–12, August 20, 2020

Please cite this article in press as: Wang et al., Pharmacological Targeting of Vacuolar H⁺-ATPase via Subunit V1G Combats Multidrug-Resistant Can-

cer, Cell Chemical Biology (2020), https://doi.org/10.1016/j.chembiol.2020.06.011

ll

Article

Figure 1. VE Is a Promising Antitumor Agent In Vitro and In Vivo

(A) IC₅₀values of indicated compounds against MDR gastric cancer cell SGC7901/VCR tested by MTS assay. If cell viability was higher than 50% upon the

maximum concentration (30 mM) used in this assay, IC₅₀value was denoted as >30 mM.

(B) Chemical structure of VE.

(C) IC₅₀values of indicated compounds against MDR chronic myelogenous leukemia cell K562R tested by MTS assay.

(D) A total of 1,094 cancer cell lines from a range of cancer types was examined for anti-proliferative activity by VE. Overview of IC₅₀values is shown. The bars

represent the proportion of each type of cancer in the indicated subgroups categorized by IC₅₀values.

(E) Tumor volume of A375 xenograft model. Data are represented as mean SEM, n = 6, p value by Student’s t test. ***p < 0.001.

See also Figure S6.

(Figures 5C and S5B). Moreover, VE efﬁciently attenuated the act as central regulators in these vital cellular processes, respec-

phosphorylation of the mTORC1 downstream substrates p-S6K tively (Saxton and Sabatini, 2017; Stransky et al., 2016). As a

and p-4EBP1. However, cells treated with Eq showed compara- proton pump, the v-ATPase aids the development of drug resis-

ble levels of decreased phosphorylation at 3- to 10-fold higher tance via lysosomal sequestration of hydrophobic weak base

concentrations than cells treated with VE, and Baf A1 showed a chemotherapeutics and acidiﬁcation of the extracellular environ-

negligible effect on the phosphorylation of these substrates (Fig- ment (Stransky et al., 2016). Moreover, the v-ATPase functions in

ures 5D and 5E). The distinctly different inhibitory effects of these crucial cellular signal transduction pathways that promote can-

v-ATPase inhibitors on v-ATPase and mTORC1 suggest that the cer cell survival and progression, particularly the Wnt, Notch,

suppression of mTORC1 signaling is not consistent with the inhi- and mTOR pathways (Stransky et al., 2016). mTORC1 signaling

bition of v-ATPase activity. Pharmacological targeting of the v- is hyperactivated in many types of cancer (Rodrik-Outmezguine

ATPase V1G subunit might be the most efﬁcient approach to et al., 2016) and is reported to participate in the development of

inhibit both v-ATPase activity and mTORC1 signaling.

MDR through multiple mechanisms, such as glycometabolic

adaptation (Zhang et al., 2017). Moreover, aberrations in the

PI3K/Akt/mTOR pathway upregulate the MDR1 gene in MDR

VE Suppresses MDR Cancer Progression In Vivo

Considering the superior activity of VE against MDR cancer cells, breast (Martin et al., 2014) and lung (Aldonza et al., 2015) can-

we ﬁnally investigated the in vivo antitumor activity of VE in a cers. In this study, we showed that VE, an inhibitor of the v-

xenograft mouse model established with SGC7901/VCR cells. ATPase peripheral stalk, exhibited excellent antiproliferative

At a low dose of 1 mg kg^À1twice daily for 7 days, VE substantially activity against MDR cancer cells in vitro and in vivo via substan-

repressed tumor growth (Figures 6A–6C) without signiﬁcant tial inhibition of both v-ATPase activity and mTORC1 signaling.

body weight loss or gross signs of toxicity (Figure S6). Hematox- Our results suggest that inhibition of both mTORC1 and the v-

ylin and eosin staining indicated that VE potently induced cell ATPase by a new v-ATPase inhibitor is an attractive strategy

death (Figure 6D). Furthermore, mTORC1 signaling was abro- for combating cancer, especially MDR cancer, thus killing two

gated by VE, as demonstrated by dephosphorylation of S6K birds with one stone.

and 4EBP1 (Figure 6E). Taken together, these results indicate Although the v-ATPase acts upstream of mTORC1 on the lyso-

that VE exhibits profound antitumor efﬁcacy in vivo against somal surface, the distinctly different outcomes of VE, Eq, and Baf

MDR tumors.

A1 on v-ATPase and mTORC1 inhibition suggest that the suppres-

sion of mTORC1 signaling is not consistent with the inhibition of v-

ATPase activity. These data support the idea that the conforma-

tional rearrangement of the v-ATPase, not the pH gradient across

DISCUSSION

Alterations in the pH gradient and cellular metabolism have been the lysosomal membrane, causes the dissociation of mTORC1

recognized as hallmarks of cancer, and the v-ATPase and mTOR from Rags (Zoncu et al., 2011). This ﬁnding is further supported

Cell Chemical Biology 27, 1–12, August 20, 2020

9

Please cite this article in press as: Wang et al., Pharmacological Targeting of Vacuolar H⁺-ATPase via Subunit V1G Combats Multidrug-Resistant Can-

cer, Cell Chemical Biology (2020), https://doi.org/10.1016/j.chembiol.2020.06.011

ll

Article

d EXPERIMENTAL MODEL AND SUBJECT DETAILS

B Cell Culture

byarecentreportofthev-ATPaseactivatorEN6. Bycovalentlytar-

geting cysteine 277 of ATP6V1A, EN6 not only profoundly stimu-

lates v-ATPase activity but also inhibits mTORC1 signaling and

subsequently induces autophagy (Chung et al., 2019). V1G is a

subunitoftheperipheralstalk,anditsproximitytoRagsmightfacil-

itate allosteric regulation of mTORC1, which explains why VE ex-

hibited the strongest inhibitory effects on mTORC1 among the

tested v-ATPase inhibitors. Moreover, VE exhibited tissue speci-

ﬁcity for cancers, such as leukemia, lymphoma, and melanoma,

in which poor outcomes were associated with high expression

levels of ATP6V1G. These results suggest that pharmacological

targeting of the V-ATPase via the V1G subunit provides a favorable

therapeutic approach for cancers with dysregulated v-ATPase or

mTOR signaling, such as MDR cancers.

B Mice

d METHOD DETAILS

B Fermentation and Extraction

B Large Panel of Cancer Cells Proﬁling for VE

B Cell Viability Assay

B Cytological Proﬁling

B Immunoblotting

B Immunoprecipitation

B Immunoﬂuorescence Staining

B Annexin V-FITC/PI Assay

B Inducing of VE Resistance in U2OS Cells

B Knock down Experiments

B Transient Transfection and Lentivirus Infection

B Chemical Labelling of VE-P and Fluorescence Mi-

croscopy

Natural products with privileged scaffolds hold great promise

for molecular probe design and drug development; however,

elucidation of their molecular targets remains a rate-limiting step

(Farha and Brown, 2016; Pan et al., 2016). Here, we provided a

valid and intuitive approach combining click chemistry-based pro-

teomics with cytological proﬁling to facilitate target identiﬁcation.

We discovered that the natural cyclodepsipeptide VE interacts

with the previously untargeted v-ATPase subunit ATP6V1G at

the leucine 99 and cysteine 104 residues. VE can clearly serve

as a versatile probe for investigating v-ATPase and mTORC1

biology, as well as constitute a lead compound for the develop-

ment of anticancer therapies, especially for MDR cancers.

B Pull-down Assay and LC-MS/MS Analysis

B Characterization of Verucopeptin (VE)

B Synthesis of VE-P, NP and Eq

B Isolation of Light Organelles

B Puriﬁcation of Lysosomes

B Measurement of V-ATPase Activity In Vitro

B In Vivo Assay

B Hematoxylin and Eosin Staining

d QUANTIFICATION AND STATISTICAL ANALYSIS

SIGNIFICANCE

SUPPLEMENTAL INFORMATION

Supplemental Information can be found online at https://doi.org/10.1016/j.

chembiol.2020.06.011.

Multidrug resistance in cancer remains a major obstacle

for successful chemotherapeutic treatment. Although

numerous mechanisms have been shown to be involved in

the development of multidrug resistance, no clinically satis-

factory therapeutic interventions have been reported to

date. Therefore, the search for new strategies and identiﬁca-

tion of new chemical entities for combating multidrug-resis-

tant (MDR) are urgently needed. In this study, we identiﬁed a

natural product, the cyclodepsipeptide verucopeptin, with

notable antitumor potency against MDR cells. A detailed

mechanistic investigation revealed that verucopeptin

strongly inhibited both v-ATPase activity and mTORC1

signaling by targeting ATP6V1G, leading to substantial phar-

macological efﬁcacy against MDR cancer cells in vitro as

well as in a xenograft mouse model in vivo. Our results

demonstrate that targeting the v-ATPase via subunit V1G

provides a unique approach for modulating v-ATPase and

mTORC1 signaling with great potential for the development

of therapeutics against MDR cancers.

ACKNOWLEDGMENTS

We thank Dr. C. Xie and Y. Wu for help with mass spectrometry experiments and

analysis, and H. Huang for help with NMR experiments. K562R cells were given

by Prof. R. Ren in Shanghai Institute of Hematology, Ruijin Hospital, Shanghai

Jiao Tong University School of Medicine, Shanghai, China. This work was sup-

ported by grants from the National Key R&D Program and the National Natural

Science Foundation of China (nos. 2017YFA0504504, 2016YFA0502001,

91853203, U1405223, 81422045, and 81661138005to X.D., 81603131 to L.L.,

21402165 to W.H., and 81903491 to Y.W.), the Fundamental Research Funds

for the Central Universities of China (nos. 20720190101 and 20720200008 to

X.D., 20720170067 to L.L, and 20720190113 to D.Z.), and the Program of Intro-

ducing Talents of Discipline to Universities (111 Project, B06016).

AUTHOR CONTRIBUTIONS

X.D. conceived the project. Y.W., Z.H., Q.X., Y.S., and A.W. performed VE pu-

riﬁcation and structure determination. W.H. conceived and performed chemi-

cal synthesis of VE-P. X.D. and L.L. designed the biology experiments. L.Z., Y.-

L.W., L.Y., C.-S.Z., M.L., W.L., and X.W. performed the biological experiments,

and acquired and analyzed data. W.M.B. and M.S.J. performed cytological

proﬁling and data analysis. A.D., P.G., C.H.B., and J.Z. performed large-scale

CMT proﬁling and data analysis. X.D., L.L., G.L., J.-H.G., L.C., H.-R.W., D.Z.,

S.-C.L., and J.Z. contributed to analysis and interpretation of biological data.

Y.W., L.L., and X.D. co-wrote the paper. All authors read and approved the

ﬁnal manuscript.

STAR+METHODS

Detailed methods are provided in the online version of this paper

and include the following:

d KEY RESOURCES TABLE

d RESOURCE AVAILABILITY

B Lead Contact

DECLARATION OF INTERESTS

B Materials Availability

B Data and Code Availability

The authors declare no conﬂict of interest.

10 Cell Chemical Biology 27, 1–12, August 20, 2020

Please cite this article in press as: Wang et al., Pharmacological Targeting of Vacuolar H⁺-ATPase via Subunit V1G Combats Multidrug-Resistant Can-

cer, Cell Chemical Biology (2020), https://doi.org/10.1016/j.chembiol.2020.06.011

ll

Article

Received: April 1, 2020

Revised: June 3, 2020

Accepted: June 15, 2020

Published: July 9, 2020

Kumar, A., and Jaitak, V. (2019). Natural products as multidrug resistance

modulators in cancer. Eur. J. Med. Chem. 176 , 268–291.

Lawrence, R.E., Fromm, S.A., Fu, Y., Yokom, A.L., Kim, D.J., Thelen, A.M.,

Young, L.N., Lim, C.Y., Samelson, A.J., Hurley, J.H., et al. (2019). Structural

mechanism of a Rag GTPase activation checkpoint by the lysosomal folliculin

complex. Science 366 , 971–977.

REFERENCES

Ley, T.J., Miller, C., Ding, L., Raphael, B.J., Mungall, A.J., Robertson, A.G.,

Hoadley, K., Triche, T.J., Laird, P.W., Baty, J.D., et al. (2013). Genomic and epi-

genomic landscapes of adult de novo acute myeloid leukemia. New Engl. J.

Med. 368 , 2059–2074.

Aldonza, M.B., Hong, J.Y., Bae, S.Y., Song, J., Kim, W.K., Oh, J., Shin, Y., Lee,

S.H., and Lee, S.K. (2015). Suppression of MAPK signaling and reversal of

mTOR-dependent MDR1-associated multidrug resistance by 21alpha-meth-

ylmelianodiol in lung cancer cells. PLoS One 10 , e0127841.

Li, Z.Q., Hao, P.L., Li, L., Tan, C.Y.J., Cheng, X.M., Chen, G.Y.J., Sze, S.K.,

Shen, H.M., and Yao, S.Q. (2013). Design and synthesis of minimalist terminal

alkyne-containing diazirine photo-crosslinkers and their incorporation into ki-

nase inhibitors for cell- and tissue-based proteome proﬁling. Angew. Chem.

Int. Ed. 52 , 8551–8556.

ꢀ

ꢀ ꢁ

ꢀ

ꢁ

Alexa-Stratulat, T., Pesic, M., Gasparovic, A.C., Trougakos, I.P., and Riganti,

C. (2019). What sustains the multidrug resistance phenotype beyond ABC

efﬂux transporters? Looking beyond the tip of the iceberg. Drug Resist.

Updat. 46 , 100643.

Anandapadamanaban, M., Masson, G.R., Perisic, O., Berndt, A., Kaufman, J.,

Johnson, C.M., Santhanam, B., Rogala, K.B., Sabatini, D.M., and Williams,

R.L. (2019). Architecture of human Rag GTPase heterodimers and their com-

plex with mTORC1. Science 366 , 203–210.

Liberman, R., Bond, S., Shainheit, M.G., Stadecker, M.J., and Forgac, M.

(2014). Regulated assembly of vacuolar ATPase is increased during cluster

disruption-induced maturation of dendritic cells through a phosphatidylinositol

3-kinase/mTOR-dependent pathway. J. Biol. Chem. 289 , 1355–1363.

Arai, S., Saijo, S., Suzuki, K., Mizutani, K., Kakinuma, Y., Ishizuka-Katsura, Y.,

Ohsawa, N., Terada, T., Shirouzu, M., Yokoyama, S., et al. (2013). Rotation

mechanism of Enterococcus hirae V-1-ATPase based on asymmetric crystal

structures. Nature 493 , 703–707.

Liu, Q., Wang, J., Kang, S.A., Thoreen, C.C., Hur, W., Ahmed, T., Sabatini,

D.M., and Gray, N.S. (2011). Discovery of 9-(6-aminopyridin-3-yl)-1-(3-(triﬂuor-

omethyl)phenyl)benzo[h][1,6]naphthyridin-2( 1H)-one (Torin2) as a potent, se-

lective, and orally available mammalian target of rapamycin (mTOR) inhibitor

for treatment of cancer. J. Med. Chem. 54 , 1473–1480.

Bar-Peled, L., Schweitzer, L.D., Zoncu, R., and Sabatini, D.M. (2012).

Ragulator is a GEF for the Rag GTPases that signal amino acid levels

tomTORC1. Cell 150 , 1196–1208.

Longley, D.B., and Johnston, P.G. (2005). Molecular mechanisms of drug

resistance. J. Pathol. 205 , 275–292.

Bonam, S.R., Wang, F.J., and Muller, S. (2019). Lysosomes as a therapeutic

Maehr, H., Liu, C.M., Palleroni, N.J., Smallheer, J., Todaro, L., Williams, T.H.,

and Blount, J.F. (1986). Microbial products. 8. Azinothricin, a novel hexadep-

sipeptide antibiotic. J. Antibiot. 39 , 17–25.

target. Nat. Rev. Drug Discov. 18 , 923–948.

Bowman, E.J., Graham, L.A., Stevens, T.H., and Bowman, B.J. (2004). The ba-

ﬁlomycin/concanamycin binding site in subunit c of the V-ATPases from

Neurospora crassa and Saccharomyces cerevisiae . J. Biol. Chem. 279 ,

33131–33138.

Martin, H.L., Smith, L., and Tomlinson, D.C. (2014). Multidrug-resistant breast

cancer: current perspectives. Breast Cancer 6 , 1–13.

Montazami, N., Aghapour, M., Farajnia, S., and Baradaran, B. (2015). New in-

sights into the mechanisms of multidrug resistance in cancers. Cell Mol. Biol.

61 , 70–80.

Chen, Y.C., Backus, K.M., Merkulova, M., Yang, C., Brown, D., Cravatt, B.F.,

and Zhang, C. (2017). Covalent modulators of the vacuolar ATPase. J. Am.

Chem. Soc. 139 , 639–642.

Nakanishi, A., Kishikawa, J.I., Tamakoshi, M., Mitsuoka, K., and Yokoyama, K.

(2018). Cryo EM structure of intact rotary H(+)-ATPase/synthase from Thermus

thermophilus . Nat. Commun. 9 , 89.

Chung, C.Y., Shin, H.R., Berdan, C.A., Ford, B., Ward, C.C., Olzmann, J.A.,

Zoncu, R., and Nomura, D.K. (2019). Covalent targeting of the vacuolar H(+)-

ATPase activates autophagy via mTORC1 inhibition. Nat. Chem. Biol. 15 ,

776–785.

Newman, D.J., and Cragg, G.M. (2016). Natural products as sources of new

drugs from 1981 to 2014. J. Nat. Prod. 79 , 629–661.

Farha, M.A., and Brown, E.D. (2016). Strategies for target identiﬁcation of anti-

Ning, N., Yu, Y., Wu, M., Zhang, R., Zhang, T., Zhu, C., Huang, L., Yun, C.H.,

Benes, C.H., Zhang, J., et al. (2018). A novel microtubule inhibitor overcomes

multidrug resistance in tumors. Cancer Res. 78 , 5949–5957.

microbial natural products. Nat. Prod. Rep. 33 , 668–680.

Gao, J.J., Aksoy, B.A., Dogrusoz, U., Dresdner, G., Gross, B., Sumer, S.O.,

Sun, Y.C., Jacobsen, A., Sinha, R., Larsson, E., et al. (2013). Integrative anal-

ysis of complex cancer genomics and clinical proﬁles using the cBioPortal.

Sci. Signal. 6 , pl1.

Nishiyama, Y., Sugawara, K., Tomita, K., Yamamoto, H., Kamei, H., and Oki, T.

(1993). Verucopeptin, a new antitumor antibiotic active against B16 mela-

noma. 1. Taxonomy, production, isolation, physicochemical properties and

biological-activity. J. Antibiot. 46 , 921–927.

Garnett, M.J., Edelman, E.J., Heidorn, S.J., Greenman, C.D., Dastur, A., Lau,

K.W., Greninger, P., Thompson, I.R., Luo, X., Soares, J., et al. (2012).

Systematic identiﬁcation of genomic markers of drug sensitivity in cancer cells.

Nature 483 , 570–575.

Oelke, A.J., France, D.J., Hofmann, T., Wuitschik, G., and Ley, S.V. (2011).

Piperazic acid-containing natural products: isolation, biological relevance

and total synthesis. Nat. Prod. Rep. 28 , 1445–1471.

Gillet, J.P., and Gottesman, M.M. (2010). Mechanisms of multidrug resistance

Oot, R.A., Couoh-Cardel, S., Sharma, S., Stam, N.J., and Wilkens, S. (2017).

Breaking up and making up: the secret life of the vacuolar H+-ATPase.

Protein Sci. 26 , 896–909.

in cancer. Methods Mol. Biol. 596 , 47–76.

Hale, K.J., Manaviazar, S., and George, J. (2010). Total synthesis of

(+)-A83586C, (+)-kettapeptin and (+)-azinothricin: powerful new inhibitors of

beta-catenin/TCF4-and E2F-mediated gene transcription. Chem. Commun.

46 , 4021–4042.

Over, B., Wetzel, S., Grutter, C., Nakai, Y., Renner, S., Rauh, D., and

Waldmann, H. (2013). Natural-product-derived fragments for fragment-based

ligand discovery. Nat. Chem. 5 , 21–28.

Holohan, C., Van Schaeybroeck, S., Longley, D.B., and Johnston, P.G. (2013).

Pan, S.J., Zhang, H.L., Wang, C.Y., Yao, S.C.L., and Yao, S.Q. (2016). Target

identiﬁcation of natural products and bioactive compounds using afﬁnity-

based probes. Nat. Prod. Rep. 33 , 612–620.

Cancer drug resistance: an evolving paradigm. Nat. Rev. Cancer 13 , 714–726.

Jia, H., Yang, Q., Wang, T., Cao, Y., Jiang, Q.Y., Ma, H.D., Sun, H.W., Hou,

M.X., Yang, Y.P., and Feng, F. (2016). Rhamnetin induces sensitization of he-

patocellular carcinoma cells to a small molecular kinase inhibitor or chemo-

therapeutic agents. Biochim Biophys Acta 1860 , 1417–1430.

Rees, D.C., Johnson, E., and Lewinson, O. (2009). ABC transporters: the po-

wer to change. Nat. Rev. Mol. Cell Biol. 10 , 218–227.

Kim, E., Goraksha-Hicks, P., Li, L., Neufeld, T.P., and Guan, K.L. (2008).

Regulation of TORC1 by Rag GTPases in nutrient response. Nat. Cell. Biol.

10 , 935–945.

Robey, R.W., Pluchino, K.M., Hall, M.D., Fojo, A.T., Bates, S.E., and

Gottesman, M.M. (2018). Revisiting the role of ABC transporters in multi-

drug-resistant cancer. Nat. Rev. Cancer 18 , 452–464.

Cell Chemical Biology 27, 1–12, August 20, 2020 11

Please cite this article in press as: Wang et al., Pharmacological Targeting of Vacuolar H⁺-ATPase via Subunit V1G Combats Multidrug-Resistant Can-

cer, Cell Chemical Biology (2020), https://doi.org/10.1016/j.chembiol.2020.06.011

ll

Article

Rodrik-Outmezguine, V.S., Okaniwa, M., Yao, Z., Novotny, C.J., McWhirter,

C., Banaji, A., Won, H., Wong, W., Berger, M., de Stanchina, E., et al. (2016).

Overcoming mTOR resistance mutations with a new-generation mTOR inhib-

itor. Nature 534 , 272–276.

Sugawara, K., Toda, S., Moriyama, T., Konishi, M., and Oki, T. (1993).

Verucopeptin, a new antitumor antibiotic active against B16 melanoma. 2.

Structure determination. J. Antibiot. 46 , 928–935.

Szakacs, G., Paterson, J.K., Ludwig, J.A., Booth-Genthe, C., and Gottesman,

M.M. (2006). Targeting multidrug resistance in cancer. Nat. Rev. Drug Discov.

5 , 219–234.

Rogala, K.B., Gu, X., Kedir, J.F., Abu-Remaileh, M., Bianchi, L.F., Bottino,

A.M.S., Dueholm, R., Niehaus, A., Overwijn, D., Fils, A.P., et al. (2019).

Structural basis for the docking of mTORC1 on the lysosomal surface.

Science 366 , 468–475.

Trombetta, E.S., Ebersold, M., Garrett, W., Pypaert, M., and Mellman, I. (2003).

Activation of lysosomal function during dendritic cell maturation. Science 299 ,

1400–1403.

Roh, S.H., Stam, N.J., Hryc, C.F., Couoh-Cardel, S., Pintilie, G., Chiu, W., and

Wilkens, S. (2018). The 3.5-A degrees CryoEM structure of nanodisc-reconsti-

tuted yeast vacuolar ATPase V-o proton channel. Mol. Cell 69 , 993–1004.

VanderWeele, D.J., and Rudin, C.M. (2005). Mammalian target of rapamycin

promotes vincristine resistance through multiple mechanisms independent

of maintained glycolytic rate. Mol. Cancer Res. 3 , 635–644.

Sakai, Y., Yoshida, T., Tsujita, T., Ochiai, K., Agatsuma, T., Saitoh, Y., Tanaka,

F., Akiyama, T., Akinaga, S., and Mizukami, T. (1997). GE3, a novel hexadep-

sipeptide antitumor antibiotic, produced by Streptomyces sp. 1. Taxonomy,

production, isolation, physico-chemical properties, and biological activities.

J. Antibiot. 50 , 659–664.

Vukovic, V., and Tannock, I.F. (1997). Inﬂuence of low pH on cytotoxicity of

paclitaxel, mitoxantrone and topotecan. Br. J. Cancer 75 , 1167–1172.

Webb, B.A., Chimenti, M., Jacobson, M.P., and Barber, D.L. (2011).

Dysregulated pH: a perfect storm for cancer progression. Nat. Rev. Cancer

11 , 671–677.

Saxton, R.A., and Sabatini, D.M. (2017). mTOR signaling in growth, meta-

bolism, and disease. Cell 168 , 960–976.

Xu, Y., Zhou, P., Cheng, S., Lu, Q., Nowak, K., Hopp, A.K., Li, L., Shi, X., Zhou,

Z., Gao, W., et al. (2019). A bacterial effector reveals the V-ATPase-ATG16L1

axis that initiates xenophagy. Cell 178 , 552–566.e20.

Schulze, C.J., Bray, W.M., Woerhmann, M.H., Stuart, J., Lokey, R.S., and

Linington, R.G. (2013). Function-ﬁrst" lead discovery: mode of action proﬁling

of natural product libraries using image-based screening. Chem. Biol. 20 ,

285–295.

Yoshimura, A., Nishimura, S., Otsuka, S., Hattori, A., and Kakeya, H. (2015).

Structure elucidation of verucopeptin, a HIF-1 inhibitory polyketide-hexapep-

tide hybrid metabolite from an actinomycete. Org. Lett. 17 , 5364–5367.

Shao, E., and Forgac, M. (2004). Involvement of the nonhomologous region of

subunit A of the yeast V-ATPase in coupling and in vivo dissociation. J. Biol.

Chem. 279 , 48663–48670.

Zhang, C.S., Jiang, B., Li, M.Q., Zhu, M.J., Peng, Y.Y., Zhang, Y.L., Wu, Y.Q.,

Li, T.Y., Liang, Y., Lu, Z.L., et al. (2014). The lysosomal v-ATPase-ragulator

complex is a common activator for AMPK and mTORC1, acting as a switch be-

tween catabolism and anabolism. Cell Metab. 20 , 526–540.

Sharma, A., Lee, M.-G., Shi, H., Won, M., Arambula, J.F., Sessler, J.L., Lee,

J.Y., Chi, S.-G., and Kim, J.S. (2018). Overcoming drug resistance by targeting

cancer bioenergetics with an activatable prodrug. Chem 4 , 2370–2383.

Zhang, C.S., Li, M.Q., Ma, T., Zong, Y., Cui, J.W., Feng, J.W., Wu, Y.Q., Lin,

S.Y., and Lin, S.C. (2016). Metformin activates AMPK through the lysosomal

pathway. Cell Metab. 24 , 521–522.

Shen, K., Rogala, K.B., Chou, H.T., Huang, R.K., Yu, Z., and Sabatini, D.M.

(2019). Cryo-EM structure of the human FLCN-FNIP2-Rag-Ragulator com-

plex. Cell 179 , 1319–1329 e1318.

Zhang, X.Y., Ai, Z.Y., Chen, J., Yi, J., Liu, Z.A., Zhao, H.S., and Wei, H.L. (2017).

Glycometabolic adaptation mediates the insensitivity of drug-resistant K562/

ADM leukaemia cells to adriamycin via the AKT-mTOR/c-Myc signalling

pathway. Mol. Med. Rep. 15 , 1869–1876.

Silver, L.L. (2015). Natural products as a source of drug leads to overcome

drug resistance. Future Microbiol. 10 , 1711–1718.

Simon, S., Roy, D., and Schindler, M. (1994). Intracellular pH and the control of

multidrug-resistance. Proc. Natl. Acad. Sci. U S A 91 , 1128–1132.

Zhao, J.H., Benlekbir, S., and Rubinstein, J.L. (2015). Electron cryomicroscopy

Steinberg, B.E., Huynh, K.K., Brodovitch, A., Jabs, S., Stauber, T., Jentsch,

T.J., and Grinstein, S. (2010). A cation counterﬂux supports lysosomal acidiﬁ-

cation. J. Cell Biol. 189 , 1171–1186.

observation of rotational states in

241–245.

a eukaryotic V-ATPase. Nature 521 ,

Zoncu, R., Bar-Peled, L., Efeyan, A., Wang, S.Y., Sancak, Y., and Sabatini,

D.M. (2011). mTORC1 senses lysosomal amino acids through an inside-out

mechanism that requires the vacuolar H+-ATPase. Science 334 , 678–683.

Stransky, L., Cotter, K., and Forgac, M. (2016). The function of V-ATPases in

cancer. Physiol. Rev. 96 , 1071–1091.

12 Cell Chemical Biology 27, 1–12, August 20, 2020

Please cite this article in press as: Wang et al., Pharmacological Targeting of Vacuolar H⁺-ATPase via Subunit V1G Combats Multidrug-Resistant Can-

cer, Cell Chemical Biology (2020), https://doi.org/10.1016/j.chembiol.2020.06.011

ll

Article

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE

Antibodies

SOURCE

IDENTIFIER

Rabbit anti-phospho-S6K-T389

Rabbit anti-S6K

Cell Signaling Techonology

Santa Cruz Biotechnology

Sigma-aldrich

cat.#9234; RRID: AB_2269803

cat. #2708

Rabbit anti-phospho-4EBP1-T37/46

Rabbit anti-4EBP1

cat.#2855

cat.#9644; RRID: AB_2097841

cat.#9451; RRID: AB_330947

cat.#9455; RRID: AB_330949

cat.#2971; RRID: AB_330970

cat.#2974; RRID: AB_2262884

cat.#2983; RRID: AB_2105622

cat.#3806; RRID: AB_10557237

cat.#2140; RRID: AB_2179961

cat.#6888; RRID: AB_10829226

cat.#14205; RRID: AB_2798424

cat.#11817; RRID: AB_2797735

cat.#2118

Rabbit anti-phospho-4EBP1-S65

Rabbit anti-phospho-4EBP1-T70

Rabbit anti-phospho-mTOR-S2448

Rabbit anti-phospho-mTOR-S2481

Rabbit anti-mTOR

Rabbit anti-phospho-Rictor-T1135

Rabbit anti- Rictor

Rabbit anti-phospho-ULK1-S757

Rabbit anti-phospho-ULK1-S638

Rabbit anti-phospho-Grb10-S476

Rabbit anti-GADPH

Mouse anti-HA

cat.sc-7392

Rabbit anti-ULK1

cat.A7481; RRID: AB_1840703

cat.#SAB1305279

Rabbit anti-ATP6V1G1

Sigma-aldrich

Mouse anti-actin

Sigma-aldrich

cat. A5316

Rat anti-LAMP2

Abcam

cat. ab13524; RRID: AB_2134736

cat.AP124P; RRID: AB_90456

cat.AP132P; RRID: AB_90264

cat. A21206; RRID: AB_2535792

HRP-conjugated goat anti-Mouse IgG

HRP-conjugated goat anti-Rabbit IgG

Millipore

Alexa Fluor 488 donkey anti-rabbit IgG

antibody

Molecular Probes

Alexa Fluor 594 donkey anti-rat IgG

antibody

Molecular Probes

This paper

cat. A21209; RRID: AB_2535795

Bacterial and Virus Strains

Actinomadura sp. XM-4-3

N/A

Chemicals, Peptides, and Recombinant Proteins

Verucopeptin

VE-P

This paper

Li et al., 2013

Chen et al., 2017

LcLabs

Data S1

N/A

NP

Eq

N/A

Baﬂiomycin A1

Torin2

E077512

HY-13002

HY-17371

HY-15142A

HY-13259

MB1297

MB1634

MB1055

HY-B0015

MB5386

MB1164

MCE

Oxaliplatin

Doxorubicin

MG132

MCE

Carboplatin

17-AAG

meilunbio

MCE

Cisplatin

Taxol

Gemcitabine

Mitomycin C

meilunbio

(Continued on next page)

Cell Chemical Biology 27, 1–12.e1–e8, August 20, 2020 e1

Please cite this article in press as: Wang et al., Pharmacological Targeting of Vacuolar H⁺-ATPase via Subunit V1G Combats Multidrug-Resistant Can-

cer, Cell Chemical Biology (2020), https://doi.org/10.1016/j.chembiol.2020.06.011

ll

Article

Continued

REAGENT or RESOURCE

vincristine

SOURCE

MCE

IDENTIFIER

HY-N0488

cat. FD10S

cat. LYSISO1

cat. C9705

cat. L7535

C1046

FITC-dextran

Sigma

Lysosome Isolation Kit

Concanamycin A

LysoSensor Green

Lysotracker Red

ERtracker Red

Sigma

Molecular Probes

Beyotime

Invitrogen

C1041-1

Mitotracker Red

M22425

Experimental Models: Cell Lines

293T(HEK)

Conservation Genetics CAS Shanghai

Cell Bank

GNHu17

A375

Conservation Genetics CAS Shanghai

Cell Bank

SCSP- 533

A375-HA-V1G1(WT)

A375-HA-V1G1(L99S)

A375-HA-V1G1(C104Y)

A375-HA-V1G1(L99SC104Y)

A375-RAG^active

This paper

N/A

U2OS

Conservation Genetics CAS Shanghai

Cell Bank

KCB200962YJ

U2OS-HA-V1G1(WT)

U2OS-HA-V1G1(L99S)

U2OS-HA-V1G1(C104Y)

U2OS-HA-V1G1(L99S C104Y)

U2OS-RAG^active

This paper

N/A

SGC7901/VCR

Conservation Genetics CAS Shanghai

Cell Bank

TCHu 46

K562R

R. Ren’s labrotary in Shanghai Institute of

Hematology, Shanghai, China

N/A

Experimental Models: Organisms

BALB/c nude mice

Beijing Vital River Laboratory Animal

Technology

Oligonucleotides

sgRNA targeting sequence: ATP6V1G1(#1):

5’-cccctgagactgactagcca-3’

http://crispr.mit.edu

This paper

N/A

sgRNA targeting sequence: ATP6V1G1(#2):

5’-cccctgagactgactagcca-3’

shRNA targeting sequence:

ATP6V1G1(#1):5’-TGGCTAGTC

AGTCTCAGGGGA-3’

shRNA targeting sequence:

ATP6V1G1(#2):5’-ACCATCCTC

CAGACATACTTC-3’

This paper

N/A

Recombinant DNA

pcDNA3.3-HA-V1G1(WT)

pcDNA3.3-HA-V1G1 L99S

pcDNA3.3-HA-V1G1 C104Y

pcDNA3.3-HA-V1G1 L99SC104Y

pBOBI-HA-V1G1(WT)

This paper

N/A

pBOBI-HA-V1G1 L99S

pBOBI-HA-V1G1 C104Y

(Continued on next page)

e2 Cell Chemical Biology 27, 1–12.e1–e8, August 20, 2020

Please cite this article in press as: Wang et al., Pharmacological Targeting of Vacuolar H⁺-ATPase via Subunit V1G Combats Multidrug-Resistant Can-

cer, Cell Chemical Biology (2020), https://doi.org/10.1016/j.chembiol.2020.06.011

ll

Article

Continued

REAGENT or RESOURCE

pBOBI-HA-V1G1 L99SC104Y

pBOBI-HA-RagA Q66L

pBOBI-HA-GST-RagB Q99L

pBOBI-HA-RagC S75L

SOURCE

IDENTIFIER

N/A

This paper

N/A

pBOBI-HA-RagD S77L

N/A

Software and Algorithms

This paper

N/A

Prism6

Graphpad software

Mestrelab

https://www.graphpad.com/

MNova 12.0

https://mestrelab.com/download_ﬁle/

mnova-12-0-0/

RESOURCE AVAILABILITY

Lead Contact

Further information and requests for resources and reagents should be directed to and will be fulﬁlled by the lead contact, Xianming

Deng (xmdeng@xmu.edu.cn).

Materials Availability

Plasmids and compounds generated in this study are available upon request to the lead contact.

Data and Code Availability

The data supporting the ﬁndings of this study are available within the article and its supplementary materials.

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Cell Culture

MEFs (male mouse origin), HEK293T (female human origin) , A375 (female human origin), U2OS (female human origin), SGC7901/

VCR (female human origin) cells were cultured in Dulbecco’s modiﬁed eagle medium (DMEM; Gibco, cat.12800), HL-60 (female hu-

man origin) and K562R (female human origin) cells were cultured in Roswell Park Memorial Institute medium (RPMI1640; Gibco, cat.

31800) at 37^ꢁC in a humidiﬁed incubator containing 5% CO₂. All media were supplemented with 10% fetal bovine serum (FBS;

GEMINI, cat.900-108), 100 mg/mL streptomycin and 100 IU/mL penicillin.

Mice

All animal experiments were performed in compliance with the guidelines from the Institutional Animal Care and Use Committee at

Experimental Animal Centre in Xiamen University (XMULAC20190032). BALB/c nude mice in half genders (4-6 weeks) were

purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). All mice were fed a standard chow

diet ad libitum and housed in a Biosafety Level 2 SPF barrier facility at Xiamen university laboratory animal center with standard

controlled temperature, humidity, and light-dark cycle (12 h) conditions with no more than 5 mice per cage under the supervision

of veterinarians. All experiments were performed on balanced cohorts of male and female mice as our preliminary data did not indi-

cate signiﬁcant differences in disease progression or response to treatment between males or females. All mice were numbered and

experiments were conducted in a blinded fashion. Before all treatments, mice were relocated at random from a housing cage to treat-

ment or control cages.

METHOD DETAILS

Fermentation and Extraction

Large amount of VE was obtained from the strain Actinomadura sp. XM-4-3 in our lab. Strain Actionmadura sp. XM-4-3 was isolated

from mangrove rhizosphere soil collected at Xiamen, China. The strain was cultured on YMG medium at 28^ꢁC for 20 days. 20 liters of

fermented agar cakes were diced and extracted with EtOAcÀMeOHÀAcOH (v/v/v, 80/15/5, 3 3 4 L). After removal of solvents under

vacuum, the extract was suspended in EtOAc and washed with water, then the EtOAc fraction was concentrated and resuspended in

MeOH and petroleum ether. The MeOH layer was concentrated to afford the defatted extract. Through a series of chromatographic

methods including medium-pressure liquid chromatography (MPLC), Sephadex LH-20, HPLC XDB C18 to afford VE.

Cell Chemical Biology 27, 1–12.e1–e8, August 20, 2020 e3

Please cite this article in press as: Wang et al., Pharmacological Targeting of Vacuolar H⁺-ATPase via Subunit V1G Combats Multidrug-Resistant Can-

cer, Cell Chemical Biology (2020), https://doi.org/10.1016/j.chembiol.2020.06.011

ll

Article

Large Panel of Cancer Cells Proﬁling for VE

Large panel of cancer cell proﬁling for VE was performed at the Massachusetts General Hospital Cancer Center (Harvard Medical

School) as previously described (Garnett et al., 2012). Brieﬂy, Cells were seeded in 384-well microplates in medium supplemented

with 5% FBS and penicillin/streptavidin. The optimal cell number for each cell line was determined to ensure that each cell line was in

logarithmic phase at the end of the assay. Adherent cell lines were plated 1 day before treatment with a 9-point twofold dilution series

of VE using liquid handling robotics, and incubated for 72 h. Cells were then ﬁxed in 4% formaldehyde for 30 min and stained with

1 mM of the ﬂuorescent nucleic acid stain Syto60 (Invitrogen) for 1 h. Suspension cell lines were treated with VE immediately following

plating, after time line of 72 h, and then stained with 55 mg mL^-1resazurin (Sigma) for 4 h. Quantiﬁcation of ﬂuorescent signal intensity

was performed using a ﬂuorescent plate reader at excitation and emission wavelengths of 630/695nm for Syto60, and 535/595nm for

resazurin. This data is included in Table S1.

Cell Viability Assay

Cells were plated at appropriate density in 96-well plates and allowed to attach overnight. Cells were treated for 48 hours in the pres-

ence of increasing concentrations of compounds, and cell viability was then measured using the MTS assay (Promega, cat. G111A).

20 mL of MTS reaction solution containing 100 mg/mL PES was added to each well. After 1 to 4 h incubation, the absorbance values

were detected by spectrophotometer (Varioskan Flash, Thermo, USA) at 490 nm wavelength. IC₅₀was calculated based on cell

viability dose-response curves by GraphPad Prism6. IC₅₀values were averaged over three independent experiments.

Cytological Proﬁling

Cytological proﬁling was performed at the UC Santa Cruz Chemical Screening Center as previously described (Schulze et al., 2013).

Brieﬂy, HeLa cells cultured in 384-well plates were treated with test compounds in a range from nanomolar to micromolar concen-

tration or with DMSO alone for 20 hours, after which with ﬂuorescent probes targeting actin (phalloidin), tubulin (a-tub), total DNA

(Hoechst), newly synthesized DNA (EdU), and phosphohistone H3 (a-pHH3). The plates were imaged using an ImageXpress Micro

epiﬂuorescent micro-scope (Molecular Devices) with a 103 Nikon objective lens. Four images were obtained per well for each wave-

length in a plate resulting in 4,608 images for the nuclear stain set and 6,144 images for the cytoskeletal stain set. The plates were

analyzed using MetaXpress (Molecular Devices). Measurements were taken using built-in morphometry metrics, the multiwavelength

cell scoring, transﬂuor, and micronuclei modules as described. These measurements were converted to feature scores, clustered

using the Cluster 3.0 software, and analyzed using Java TreeView.

Immunoblotting

After treatment, cells were washed and lysed with lysis buffer (50 mM Tris-HCl, 150 mM NaCl, 1% (v/v) Triton X-100, 5% glycerol,

1 mM phenylmethylsulfonyl ﬂuoride, 5 mg/mL leupeptin, 1 mM sodium orthovanadate and 50 mM sodium ﬂuoride, pH 7.5). Protein

extracts were resolved by SDS-PAGE electrophoresis, blotted with appropriate antibodies and ﬁnally detected by WesternBright

ECL (advansta, cat. K-12045-D50). Images were performed using a ChemiDocTM XRS+ System (Bio-rad).

Immunoprecipitation

Cell lysates were prepared in a lysis buffer (50 mM Tris-HCl, pH 7.4, 150 mM NaCl, 100 mM NaF, 0.5% NP-40, 1 mM phenylmethyl-

sulfonyl ﬂuoride). The lysates were clariﬁed by centrifugation at 13,000 rpm for 30 mins. Then the protein extracts were subjected to

immunoprecipitation using speciﬁc antibodies in combination with protein G-Sepharose for 3 hours. Precipitated immunocomplexes

were washed three times with lysis buffer and then mixed with an equal volume of SDS sample buffer for immunoblotting.

Immunoﬂuorescence Staining

Cells were seeded on coverslips and ﬁxed with 4% (v/v) PFA for 15 min at room temperature after compound treatment. Then sam-

ples were permeabilized with 0.1% Triton X-100 for 5 min. Followed by 5% BSA blocking for 30 min at RT, the primary antibodies (for

mTOR, Cell Signaling Techonology, cat.#2983 diluted 10 mg/ml in PBS; for LAMP2, Abcam, cat.#ab13524, diluted 1:100 in PBS) were

incubated with cells overnight at 4^ꢁC. After washing 3 times with PBS, the cells were incubated for another 3 h at room temperature

with FITC-conjugated Donkey anti-goat IgG (BBI Life Sciences, cat.D110111, diluted 1:100 in PBS) and Alexa-Fluor 594-conjugated

anti-mouse secondary antibody (Molecular Probes, cat.11032, diluted 1:100 in PBS ), then the samples were washed three times with

PBS. All images were collected with a confocal laser scanning microscope Leica TCS SP8.

Annexin V-FITC/PI Assay

Cell death was quantiﬁed using Annexin V-FITC/PI assay according to the manufacturer’s protocol (Annexin V-FITC/PI Apoptosis

Detection Kit; Vazyme, cat. A 211-02). After treatment, cells were harvested and washed twice with cold PBS buffer and then about

1 x 10⁵cells were resuspended with 100 mL binding buffer in 5 mL tube. 5 mL Annexin V-FITC and 5 mL PI staining solution were added

to each tube in the dark and incubated for 10 minutes at room temperature. Then added 400 mL binding buffer to each tube before

detecting. Data were analyzed by a FC500 ﬂow cytometer (Beckman coulter) and FlowJo and were representative of three indepen-

dent experiments

e4 Cell Chemical Biology 27, 1–12.e1–e8, August 20, 2020

Please cite this article in press as: Wang et al., Pharmacological Targeting of Vacuolar H⁺-ATPase via Subunit V1G Combats Multidrug-Resistant Can-

cer, Cell Chemical Biology (2020), https://doi.org/10.1016/j.chembiol.2020.06.011

ll

Article

Inducing of VE Resistance in U2OS Cells

To generate VE resistant in U2OS cells, two 10 cm²plates of parental U2OS cells at 50% conﬂuence(2*10⁶cells/ plate)were treated

with 50 nM VE for 1 month with media change every 1 to 2 days. The growth state and morphology change of cells were observed

every day. Clones that appeared after the selection was then expanded normally at a ﬁnal concentration of 500 nM VE in 6 well plates.

Whole-RNA sequencing of VE resistant U2OS and parental U2OS cells were performed.

Knock down Experiments

The oligonucleotides were cloned into the lentiviral vector Tet –pLKO-puro (Addgene plasmid 21915). The lentiviruses were gener-

ated by transfecting HEK293T cells together with the lentiviral vector and packaging plasmids (pMDL, pVSV-G and pREV). After 48h

culturing, the viral supernatants were ﬁltered with a 0.22um ﬁliter and then were used to transduce A375 and U2OS cells. After drug-

selected with puromycin for 1 week, surviving pools were split to 6 well plates and inducing shRNA expression with 1 ug/mL doxy-

cycline. The oligonucleotides sequences for the Tet–pLKO-puro were as follows:

shRNA-ATP6V1G1#1,5’- TGGCTAGTCAGTCTCAGGGGA -3’; shRNA-ATP6V1G1#2,5’- ACCATCCTCCAGACATACTTC-3’;

shRNA-Control, 5’- CAACAAGATGAAGAGCACCAA -3’.

Transient Transfection and Lentivirus Infection

The target of interest was ﬁrst cloned into the pCDNA3.3 vector for transient transfection or into pBOBI for lentivirus packaging. Total

DNA for each plate was adjusted to the same amount. HEK293T cells were transfected with a ﬁnal concentration of 10 uM PEI and

harvested at 48 h after transfection. The lentivirus was generated by transfecting HEK293T cells together with the lentiviral vector and

packaging plasmids (pMDL, pVSV-G and pREV) using Lipofectamine 3000 in 6 well plates. After culture for 48 h, the viral superna-

tants were ﬁltered with a 0.22 mm ﬁlter and then were used to infect parental cells for 24 h.

Chemical Labelling of VE-P and Fluorescence Microscopy

Cells were treated with 500 nM VE-P or DMSO for 1 hour followed by UV(365 nM )-irradiated for 20 min. Lyso-Tracker Red , Mito-

Trackerꢀ Red CMXRos or ER-Tracker Red was added into the culture medium for 40 min incubation. Cells were then ﬁxed with

4% PFA for 15 min, prior to permeabilization (Triton X-100, 0.1% in PBS, 5 min) and washed three times with 1% BSA/PBS. Samples

were incubated with the click reaction cocktail (1 mM rhodamine-N₃, 1 mM TBTA, 10 mM TCEP, and 10 mM CuSO₄) in the dark at room

temperature for 30 min, then washed three times with PBS and counterstained with DAPI (1 mg/mL). Fluorescence images were ac-

quired and processed using a confocal laser scanning microscope Leica TCS SP8.

Pull-down Assay and LC-MS/MS Analysis

Cellular lysates were supplemented with 200 mL of 5 3 Hepes buffer and adjusted to 1 mL with Milli-Q water. A solution of VE-P was

added, followed by incubation at 4^ꢁC for 2 h. The reaction mixture was then UV (365 nM)-irradiated for 20 min before addition of

biotin-N₃under click conditions (a freshly premixed click chemistry reaction cocktail in PBS contains 0.1 mM biotin-N3, 0.1 mM

TBTA, 1 mM TCEP, and 1 mM CuSO₄). Upon acetone precipitation and resolubilization (in PBS with 1%SDS with brief sonication),

the resuspended sample was incubated with avidin-agarose beads at 4^ꢁC overnight. After centrifugation, the supernatant was

removed and the beads were washed with PBS three times, ﬁnally subjected to LC-MS/MS analysis or immunoblotting.

For LC-MS/MC analysis, U2OS cell lysates were incubated with either VE-P in duplicate or a negative control probe (NP). After click

chemical labeling, the biotinylated protein complexes were then pulled down with streptavidin beads. The beads were boiled and

resolved by SDS-PAGE. After staining of gels with Coomassie blue, excised gel segments were subjected to in-gel trypsin digestion

and dried. Samples were analyzed on a nanoElute (Bruker) coupled to a timsTOF Pro (Bruker) equipped with a CaptiveSpray source.

Peptides were dissolved in 10 ul 0.1% formic acid and were auto-sampled directly onto a homemade C18 column (35 cm 3 75 mm

˚

i.d., 1.9 mm 100 A). Samples were then eluted for 60 mins with linear gradients of 3–35% acetonitrile in 0.1% formic acid at a ﬂow rate

of 300 nL/min. Mass spectra data were acquired with a timsTOF Pro mass spectrometer (Bruker) operated in PASEF mode. The raw

ﬁles were analyzed by Peaks Studio X software against uniprot database. More than two thousands of proteins were identiﬁed in each

group. Among them, 1551 proteins that present in both VE groups but not in NP group were classiﬁed as VE-associated proteins for

further analysis. We identiﬁed 84 lysosomal proteins within VE-associated proteins by gene ontology (GO) cellular component (CC)

analysis and then subjected to further GO molecular function (MF) analysis. The top term of MF was proton-transporting ATPase ac-

tivity, rotational mechanism (GO:0046961) clustering a number of lysosome-speciﬁc v-ATPase subunits which were list in Table S3.

The complete LC-MS/MS data was provided in Table S2.

Characterization of Verucopeptin (VE)

VE, obtained from strain Actinomadura sp. XM-4-3, white amorphous powder; [a]25 D-20.0 (c 0.2, MeOH); ¹H NMR (CDCl₃, 600

MHz): d 0.79 (d, 3H, J = 6.9 Hz, 33-Me), 0.82 (d, 3H, J = 7.5 Hz, 35-Me), 0.86 (t, 3H, J = 6.8 Hz, H37), 0.88 (d, 3H, J = 6.7 Hz,

H18), 0.99 (d, 3H, J = 7.2 Hz, 31-Me), 1.01 (m, 1H, H34), 1.04 (m, 1H, H34), 1.05 (m, 1H, H32), 1.09 (d, 3H, J = 6.7 Hz, H19), 1.13

(m, 1H, H36), 1.23 (m, 1H, H32), 1.24 (m, 1H, H36), 1.39 (m, 1H, H35), 1.42 (s, 3H, 23-Me), 1.47 (m, 1H, H11), 1.52 (m, 1H,

H33),1.61 (m, 1H, H11), 1.67 (s, 3H, 29-Me), 1.77 (m, 1H, H17), 1.84 (m, 1H, H26), 1.87(m, 2H, H25),1.89 (m, 1H, H12), 2.04 (m,

1H, H26), 2.22 (m, 1H, H12), 2.58 (m, 1H, H31), 2.68 (m, 1H, H13), 2.93 (s, 3H, 6-NMe), 3,07 (m, 1H, H27), 3.13 (s, 3H, 2-NMe),

3.14 (m, 1H, H13), 3.30 (s, 3H, 27-OMe), 3.47 (d, 1H, J =17.5 Hz, H2), 3.64 (d, 1H, J = 15.4 Hz, H6), 3.69 (d, 1H, J = 17.0 Hz, H4),

Cell Chemical Biology 27, 1–12.e1–e8, August 20, 2020 e5

Please cite this article in press as: Wang et al., Pharmacological Targeting of Vacuolar H⁺-ATPase via Subunit V1G Combats Multidrug-Resistant Can-

cer, Cell Chemical Biology (2020), https://doi.org/10.1016/j.chembiol.2020.06.011

ll

Article

3.91 (d, 1H, J = 15.5 Hz, H8), 4.12 (d, 1H, J = 9.3 Hz, H28), 4.14 (d, 1H, J = 15.4 Hz, H6), 4.66 (d, 1H, J =17.5 Hz, H2), 4.80 (dd, 1H, J =

2.7, 9.6 Hz, H16), 4.89 (13-NH, 1H), 5.07 (dd, 1H, J =6.6, 17.0 Hz, H4), 5.19 (d, 1H, J =9.5 Hz, H30), 5.29 (d, 1H, J =15.5 Hz, H8), 5.33 (d,

1H, J=7.1 Hz, H10), 6.12 (dd, 1H, J =2.6, 9.5 Hz, H15), 7.36 (4-NH, 1H), 9.14 (8-NOH, 1H). (Data S1);¹³C NMR (CDCl₃, 150 MHz): d 11.5

, 11.5 , 18.4, 18.5, 19.0, 19.2, 21.3 C23-Me, 21.4, 21.4, 23.9, 24.0, 27.2 , 27.7, 29.6, 30.0, 30.4, 31.6, 34.7 C6-NMe, 36.8 C2-NMe, 42.4

C4, 45.0, 46.1, 46.5 C15, 46.9 C13, 48.5 C10, 51.3 C8, 51.8 C2, 52.4 C6, 56.8 C27-OMe, 75.7 C27, 77.6 C23, 79.9 C28, 80.0 C16, 98.4

C24, 130.0 C29, 131.7 C30, 167.0, 167.2, 170.9, 171.3, 171.8, 176.1 C22, 176.2 (Data S1); HRMS (ESI-TOF) m/z: [M+Na]⁺Calcd for

C₄₃H₇₃N₇O₁₃Na 918.5159, found 918.5141 (Data S1).

Synthesis of VE-P, NP and Eq

Reagents for chemical reactions were purchased from Sigma-Aldrich without puriﬁcation unless mentioned otherwise. Reactions

were monitored by thin layer chromatography (TLC) on glass plates coated with silica gel (200-300 mesh, Qingdao Marine Chemical

Plant). Column chromatography was performed with silica gel (200À300 mesh, Qingdao Marine Chemical Plant), reversed-phase

RP-18 (40À63 mm, Merck), and Sephadex LH-20 (Amersham Biosciences). Optical rotations were measured on AUTOPOL IV auto-

matic polarimeter (RUDOLPH Inc). Mass spectra for compound characterization were collected by Waters Acuity SQD LC-MS with

the mode of electron spray ionization (ESI). High resolution mass spectra were obtained on Thermo Fisher scientiﬁc LTQ FTICR-MS.

Compounds were puriﬁed by Agilent high performance liquid chromatograph (HPLC) with an Agilent Eclipse XDB-C18 column (5 mm,

9.43250 mm). NMR spectra were measured on a Bruker Ultrashield Plus-600 (600 MHz) and a Bruker AVANCE III (850MHz) instru-

ment using TMS as the internal standard, and chemical shift were report in d (ppm), multiplicities (s = singlet, d = doublet, t = triplet, q =

quartet, p = pentet, m = multiplet, and br = broad), integration and coupling constants (J in Hz). ¹H and ¹³C chemical shift are relative

to the solvent: d_H7.26 and d_C77.0 for CDCl₃; d_H2.50 and d_C39.5 for DMSO-d₆.

To the solution of verucopeptin (5 mg, 5.58mmol) in DMF (0.2 mL) were added DMAP (2.0 mg, 16.7 mmol), EDC,HCl (3.2 mg,

16.7 mmol) and 3-(3-(but-3-yn-1-yl)-3H-diazirin -3-yl)propanoic acid (0.9 mg, 5.58 mmol) and the mixture were stirred at room tem-

perature for 4 hours in the dark, the residue was puriﬁed by semi-preparative HPLC in mobile phase (acetonitrile:H₂O= 85:15) con-

taining 0.02% Triﬂuoroacetic acid to give compound VE-P (1.0 mg, 17.2%).

VE-P, white amorphous powder, ¹H NMR (DMSO-d6, 850 MHz): d 0.77 (d, 3H, overlap), 0.81 (d, 3H, overlap), 0.84 (t, 3H, overlap),

0.88 (d, 3H, overlap), 0.89 (d, 3H, overlap), 0.97 (m, 1H), 1.03 (m, 1H), 1.03 (m, 1H), 0.85-0.90 (d, 6H), 1.11 (m, 1H), 1.15 (m, 1H), 1.24

(m, 1H), 1.39 (m, 1H), 1.23 (s, 3H), 1.48 (m, 1H), 1.52 (m, 1H),1.65 (m, 1H), 1.66 (m, 1H, H-P7), 1.57 (s, 3H), 1.77 (m, 1H), 1.84 (m, 1H),

1.86 (m, 2H),1.74 (m, 1H), 1.95 (m, 1H), 1.94 (m, 1H), 2.28 (m, 1H), 2.28 (m, 1H, H-P7), 2.72 (m, 1H, H13), 2.99 (s, 3H, 6-NMe), 2.83 (m,

1H, H-P1), 2.97 (m, 1H, H27), 3.09 (s, 3H, 2-NMe), 3.00 (m, 1H, H13), 3.16 (s, 3H, 27-OMe), 3.93 (d, 1H, J =17.8 Hz, H2), 4.60 (d, 1H,

overlap H6), 3.84 (d, 1H, overlap H4), 3.80 (d, 1H, overlap H8), 3.87 (d, 1H, overlap H28), 4.92 (d, 1H, overlap H6), 4.19 (d, 1H,

J =17.8 Hz, H2), 4.89 (dd, 1H, J = 2.7, 9.6 Hz, H16), 4.10 (dd, 1H, overlap H4), 5.00 (d, 1H, J =9.0 Hz, H30), 4.11 (d, 1H, overlap

H8), 5.50 (d, 1H, H10), 5.87 (dd, 1H, J =2.8, 9.0 Hz, H15), 7.48 (4-NH, 1H). (Data S1); ¹³C NMR (DMSO-d6, 212 MHz): d 11.8,

13.0, 15.7, 19.4, 19.5, 19.6, 19.7, 20.2, 20.9, 21.9, 22.0, 22., 22.3, 24.4, 26.0 C-P7, 27.5, 28.2, 29.3, 30.1, 31.4, 31.6, 32.2, 36.2

C6-NMe, 36.9 C2-NMe, 41.0 C4, 45.0, 46.1, 46.7 C15, 46.2 C13, 49.5 C10, 50.9 C8, 51.4 C2, 52.4 C6, 56.5 C27-OMe, 72.3 C-

P1, 75.5 C27, 76.9 C23, 79.8 C28, 78.2 C16, 83.6 C-P2, 207.7 C24, 133.0 C29, 135.5 C30, 166.7.0, 168.6, 168.6, 169.1 C-P8,

170.0, 170.6, 171.0, 176.7 C22; HRMS (ESI-TOF) m/z: [M+NH₄]⁺Calcd for C₅₁H₈₅N₁₀O₁₄1061.6241, found 1061.6276 (Data S1).

Negative probe (NP) was synthetized as described(Li et al., 2013), Brieﬂy, To the solution of aniline (50 mg, 0.54 mmol) in DMF

(3 mL) were added DMAP (80 mg, 0.67 mmol), EDC,HCl (100 mg, 0.55 mmol) and 3-(3-(but-3-yn-1-yl)-3H-diazirin -3-yl)propanoic

acid (80 mg, 0.5 mmol) and the mixture was stirred at room temperature for 24 hours in the dark, the residue was puriﬁed by silica

gel chromatography (1–5% MeOH gradient in CH₂Cl₂) to give compound NP (90 mg, 80%).

NP, ¹H NMR (600 MHz, CDCl3) d 7.51 (d, J = 7.9 Hz, 2H), 7.34 (t, J = 7.9 Hz, 2H), 7.24 (s, 1H), 7.14 (t, J = 7.4 Hz, 1H), 2.17 – 2.11 (m,

2H), 2.06 (td, J = 7.4, 2.6 Hz, 2H), 2.01 (t, J = 2.7 Hz, 1H), 1.96 (t, J = 7.6 Hz, 2H), 1.70 (t, J = 7.4 Hz, 2H); MS (ESI) m/z: 242

[C₁₄H₁₅N₃O + H]⁺

Electrophilic quinazolines (Eq) was synthetized as described(Chen et al., 2017). Brieﬂy, to a solution of 4-chloro-7-nitroquinazoline

(60 mg, 0.29 mmol) in isopropanol (2 mL) was added 3-ethynylaniline (35 mg, 0.30 mmol). The reaction mixture was stirred at room

temperature for 10 h and then cooled in an ice bath. The precipitate was collected through ﬁltration and dried over vacuo to afford N-

(3-ethynylphenyl)-7-nitroquinazolin-4-amine (80 mg). The residues were further suspended in methanol (2 mL), and NH₄Cl (98 mg,

1.8 mmol) and Zn powder (100 mg, 1.5 mmol) were added. The reaction mixture was sonicated for 5 min and stirred at RT for 24

h. The reaction mixture was ﬁltered to remove the residual zinc powder, which was then concentrated in vacuo. The residues

were diluted with EtOAc and washed with saturated NaHCO₃solution. The basic layer was further extracted with EtOAc twice.

The combined organic phases were washed with brine, and concentrated under reduced pressure to provide N⁴-(3-ethynyl-

phenyl)quinazoline-4,7-diamine (50 mg, 70%).

To a solution of N⁴-(3-ethynylphenyl)quinazoline-4,7-diamine (50 mg, 0.19 mmol) in THF/CH₂Cl₂(5:1, 3.0 mL) DIPEA (100 mL,

0.58 mmol) was added and stirred for 10 min. Chloroacetylchloride (23 mL, 0.29 mmol) was added to the reaction mixture and stirred

for another 1 h, the mixture was diluted with EtOAc, and washed with saturated NaHCO₃solution. The aqueous phase was extracted

with EtOAc twice and the combined organic phases were concentrated in vacuo, and puriﬁed by silica gel chromatography (1–5%

MeOH gradient in CH₂Cl₂) to afford Eq (13 mg, 20%).

e6 Cell Chemical Biology 27, 1–12.e1–e8, August 20, 2020

Please cite this article in press as: Wang et al., Pharmacological Targeting of Vacuolar H⁺-ATPase via Subunit V1G Combats Multidrug-Resistant Can-

cer, Cell Chemical Biology (2020), https://doi.org/10.1016/j.chembiol.2020.06.011

ll

Article

Eq, ¹H NMR (600 MHz, DMSO-d6) d 10.76 (s, 1H), 9.83 (s, 1H), 8.61 (s, 1H), 8.51 (d, J = 9.0 Hz, 1H), 8.15 (d, J = 2.2 Hz, 1H), 8.06 (t,

J = 1.9 Hz, 1H), 7.90 (dd, J = 7.6, 2.1 Hz, 1H), 7.75 (dd, J = 9.0, 2.2 Hz, 1H), 7.41 (t, J = 7.9 Hz, 1H), 7.23 (dt, J = 7.6, 1.3 Hz, 1H), 4.36 (s,

2H), 4.21 (s, 1H). MS(ESI) m/z: 336 [C₁₈H₁₃ClN₄O + H]⁺

Isolation of Light Organelles

Light organelles were isolated as described previously (Steinberg et al., 2010; Zoncu et al., 2011). Brieﬂy, cells were scraped and

spun down at 200 g at room temperature, and then resuspended in 750 mL per 15-cm dish of fractionation buffer (140 mM KCl,

1 mM EGTA, 5 mM MgCl₂, 50 mM sucrose, 20 mM HEPES, pH 7.4, supplemented with 2.5 mM ATP, amino acids (Gibco, cat.

11130-077) and protease inhibitor cocktail) at room temperature, and were mechanically broken by spraying 6 times through a

22G needle, yielding post-nuclear supernatants (PNS) after spinning at 2,000 g for 5 min. The PNS was then spun at max speed

for 15 min in a tabletop centrifuge. The pellets are light organelles and supernatants are the cytosol.

Puriﬁcation of Lysosomes

Lysosomes were puriﬁed by Lysosome Isolation Kit according to the manufacturer’s instructions, with minor modiﬁcations. Brieﬂy,

MEFs from sixty 10-cm dishes (60-80% conﬂuence) were collected by directly scrapping at room temperature, followed by centri-

fugation for 5 min at 500g at 37^ꢁC. Cells were resuspend in 7 mL of 13 Extraction Buffer containing protease inhibitor cocktail at room

temperature, and were dounced in a 7-mL Dounce homogeniser (Sigma, cat. P0610) for 120 strokes on ice followed by centrifuging

for 10 min at 1,000 g, 4^ꢁC, yielding post-nuclear supernatants (PNS). The PNS were then centrifuged for 20 min at 20,000g and the

pellet was suspended by 1 3 Extraction Buffer by gentle pipetting, generating Crude Lysosomal Fraction (CLF). The volume of CLF

was adjusted to 2.4 mL and then equally divided into six 1.5 mL Eppendorf tubes (400 mL per tube). 253 mL of OptiPrep and 137 mL of

1 3 OptiPrep Dilution Buffer were added to each CLF, and mixed by gentle pipetting. The mixture is deﬁned as the Diluted OptiPrep

Fraction (DOF). Each DOF (0.8 mL) was loaded to an 11 3 60 mm centrifuge tube at the top of 27% (0.4 mL) and 22.5% (0.5 mL)

OptiPrep solution cushions, and then overlaid with 16% (1 mL), 12% (0.9 mL) and 8% (0.3 mL) OptiPrep solutions. The tube was

then centrifuged on a SW60 Ti rotor (Beckman) at 150,000g for 4 h at 4^ꢁC, and the fraction at the top of 12% OptiPrep solution

was collected as the crude lysosome fraction. The fraction was diluted with two volumes of PBS, followed by centrifugation at

20,000 g for 20 min. The supernatant was then aspirated, and the sediment was the lysosome fraction.

Measurement of V-ATPase Activity In Vitro

For each assay, lysosomes puriﬁed from two 10-cm dishes of MEFs were used. ATP hydrolysis activity was measured using a

coupled spectrophotometric method as described previously (Shao and Forgac, 2004) with some modiﬁcations. Brieﬂy, lysosomes

were suspended in ATPase assay buffer (50 mM NaCl, 30 mM KCl, 20 mM HEPES-NaOH, pH 7.0, 10% glycerol, 1 mM MgCl₂, 1.5 mM

phosphoenolpyruvate, 0.35 mM NADH, 20 U/mL pyruvate kinase, and 10 U/mL lactate dehydrogenase) with 5 mM ConA (for calcu-

lating the v-ATPase-speciﬁc ATP hydrolysis activity) or DMSO, and warmed at 37^ꢁC for 10 min. The assay was initiated by the addi-

tion of 5 mM ATP, and the OD₃₄₁was continuously recorded by a SpectraMax M5 microplate reader.

ATP-dependent proton transport activity was measured by the initial rate of ATP-dependent ﬂuorescent quenching of FITC-

dextran, as described previously(Liberman et al., 2014; Trombetta et al., 2003). Brieﬂy, lysosomes were loaded with FITC-dextran

by incubating cells in DMEM supplemented with 2 mg/mL FITC-dextran (ﬁnal concentration) on ice for 5 min, then transferred to

a 37^ꢁC incubator for 30 min. Cells were washed with DMEM for three times and incubated with DMEM for another 30 min at 37^ꢁC

to allow transport of FITC-dextran to lysosomes. Cells were collected and lysosomes were puriﬁed as described above. The lyso-

somes were resuspended in assay buffer (125 mM KCl, 1 mM EDTA, 20 mM HEPES, pH 7.5, with KOH) and were balanced on

ice for 1 hr, then mixed with 5 mM ConA (for calculating the v-ATPase-speciﬁc proton transport activity) or DMSO, then warmed

at 37^ꢁC for 10 min. Fluorescence of FITC was recorded with excitation at 490 nm and emission at 520 nm using a SpectraMax

M5 microplate reader. The initial slope of ﬂuorescence quenching was measured after addition of 5 mM Mg-ATP (ﬁnal concentration).

Data is representative of three independent experiments.

In Vivo Assay

BALB/c nude mice (4-6 weeks) were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. (Beijing, China). Xe-

nografts were initiated by subcutaneous injection of SGC7901/VCR cells (3310⁷cells per mouse). When tumor size reached to

approximately 100 mm³, mice were randomized to two groups. The mice were i.v. injected with VE by 1 mg kg^-1twice every day,

Mice in the vehicle group received saline (containing 1% DMSO) only. Mice were then examined for tumor growth and body weight

changes using a slide caliper (Mitutoyo), and their volumes were calculated using the following formula: a²3 b 3 0.5, where a refers to

the smaller diameter and b is the diameter perpendicular to a. At 6 hours of post-ﬁnal dose, mice were euthanized and tumors were

separated and subjected to further analysis. All procedures were performed in compliance with the guidelines from the Institutional

Animal Care and Use Committee at Experimental Animal Centre in Xiamen University.

Hematoxylin and Eosin Staining

Tumor tissues were ﬁxed in 4% paraformaldehyde and embedded in parafﬁn. Then, 4 mm thick slices were stained with haematoxylin

and eosin, then examined by light microscopy (Leica DM4 M).

Cell Chemical Biology 27, 1–12.e1–e8, August 20, 2020 e7

Please cite this article in press as: Wang et al., Pharmacological Targeting of Vacuolar H⁺-ATPase via Subunit V1G Combats Multidrug-Resistant Can-

cer, Cell Chemical Biology (2020), https://doi.org/10.1016/j.chembiol.2020.06.011

ll

Article

QUANTIFICATION AND STATISTICAL ANALYSIS

The statistical analysis of the difference between two groups was done using the two-tailed Student’s t-test and multiple groups com-

parisons were determined using one-way or two-way ANOVA using GraphPad Prism 6 and p < 0.05 was considered statistically sig-

niﬁcant. Statistical signiﬁcance is shown as * p < 0.05, ** p < 0.01, *** p < 0.001.

e8 Cell Chemical Biology 27, 1–12.e1–e8, August 20, 2020

Article Doi

Pharmacological Targeting of Vacuolar H+-ATPase via Subunit V1G Combats Multidrug-Resistant Cancer

DOI: 10.1016/j.chembiol.2020.06.011

Source and publish data:

Authors:

Article abstract of DOI:10.1016/j.chembiol.2020.06.011

Full text of DOI:10.1016/j.chembiol.2020.06.011

Products guided by the article

R&D Labs maybe for 1450754-39-8

Relevant to this article

Hot Product